View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 108_7_76 (Length: 169)

Name: 108_7_76
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 108_7_76
108_7_76
[»] chr4 (4 HSPs)
chr4 (1-114)||(7173083-7173195)
chr4 (112-169)||(7173030-7173087)
chr4 (109-169)||(14816443-14816504)
chr4 (109-169)||(7178395-7178460)
[»] scaffold0005 (1 HSPs)
scaffold0005 (109-169)||(23207-23268)


Alignment Details
Target: chr4 (Bit Score: 61; Significance: 2e-26; HSPs: 4)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 1 - 114
Target Start/End: Original strand, 7173083 - 7173195
Alignment:
1 gggatatgagtgaaaacaaacactcttgaagcaggggatgctagtatctccaaatcatcaaagag-aaatgaataaaacgnnnnnnntaaggtgatgcaa 99  Q
    ||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| ||| | ||||||||       |||||||||||||    
7173083 gggatatgagtgaaaacaa-cactcttgaagtaggggatgctagtatctccaaatcatcaaagagaaaacggataaaacg-aataaataaggtgatgcaa 7173180  T
100 tcaacttatattaat 114  Q
    |||||||||||||||    
7173181 tcaacttatattaat 7173195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 112 - 169
Target Start/End: Original strand, 7173030 - 7173087
Alignment:
112 aattttatttataatcctttacgtataatccttcaaataaattttaggaattggggat 169  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
7173030 aattttatttataatcctttacgtataatgcttcaaataaattttaggaattggggat 7173087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 38; E-Value: 0.0000000000009
Query Start/End: Original strand, 109 - 169
Target Start/End: Complemental strand, 14816504 - 14816443
Alignment:
109 attaattttatttataatcctttacgtataatccttcaaataaattttagg-aattggggat 169  Q
    ||||||||||||||||||| |||||||| | | |||||||||||||||||| ||||||||||    
14816504 attaattttatttataatcatttacgtaaacttcttcaaataaattttaggaaattggggat 14816443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 109 - 169
Target Start/End: Original strand, 7178395 - 7178460
Alignment:
109 attaattttatttata----atcctttacgtataatccttcaaataaattttagg-aattggggat 169  Q
    ||||||||||||||||    ||| |||||||| | |||||||||||||||||||| ||||||||||    
7178395 attaattttatttatactcaatcttttacgtaaactccttcaaataaattttaggaaattggggat 7178460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005 (Bit Score: 38; Significance: 0.0000000000009; HSPs: 1)
Name: scaffold0005
Description:

Target: scaffold0005; HSP #1
Raw Score: 38; E-Value: 0.0000000000009
Query Start/End: Original strand, 109 - 169
Target Start/End: Original strand, 23207 - 23268
Alignment:
109 attaattttatttataatcctttacgtataatccttcaaataaattttagg-aattggggat 169  Q
    ||||||||||||||||||| |||||||| | | |||||||||||||||||| ||||||||||    
23207 attaattttatttataatcatttacgtaaacttcttcaaataaattttaggaaattggggat 23268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 105760 times since January 2019
Visitors: 1319