View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 108_7_96 (Length: 202)

Name: 108_7_96
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 108_7_96
108_7_96
[»] chr4 (1 HSPs)
chr4 (1-202)||(29193227-29193432)


Alignment Details
Target: chr4 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 1 - 202
Target Start/End: Original strand, 29193227 - 29193432
Alignment:
1 tttgtctccatcattaaactaaaatgaatgtttaagtgttacgttatgcatgaatgaacgtggcaaaagcagtgaaag---------aaataagataagg 91  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||         |||||||||||||    
29193227 tttgtctccgtcattaaactaaaatgaatgtttaagtgttacgttatgcatgaatgaacgtggcaaaagcagtgaaagaaataactcaaataagataagg 29193326  T
92 annnnnnnggcgataagacaaagtgcaacactgagaaatgaagagaaactaaccaatctcatcaaaccaaaccaatcaatggcgccaatttcggtacctc 191  Q
    |       |||||||||||||||||||||||||| |||||||||||||||||||||||||||     ||||||||||||||||||||| |||  ||||||    
29193327 atttttttggcgataagacaaagtgcaacactgacaaatgaagagaaactaaccaatctcat-----caaaccaatcaatggcgccaacttcattacctc 29193421  T
192 tcaatttgaat 202  Q
    |||||||||||    
29193422 tcaatttgaat 29193432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 202765 times since January 2019
Visitors: 1517