View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 108_8_15 (Length: 355)

Name: 108_8_15
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 108_8_15
108_8_15
[»] chr7 (2 HSPs)
chr7 (74-355)||(3485232-3485514)
chr7 (1-83)||(3485510-3485592)


Alignment Details
Target: chr7 (Bit Score: 267; Significance: 1e-149; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 74 - 355
Target Start/End: Original strand, 3485232 - 3485514
Alignment:
74 attaattttgtttcaaaaaatttaaaattctttagacaaaattaggtttactataaa-tgtttaaacatctcaaaatcaataacacatatctaaaatcaa 172  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
3485232 attaattttgtttcaaaaaatttaaaattctttagacaaaattaggtttactataaaatgtttaaacatctcaaaatcaataacacatatctaaaatcaa 3485331  T
173 tttcaattcttcaaaaagttgaacaaaacaaacaataacaacgtgtcaatgggtatctagtgttcaatttgtagcagcaacctttagaaaccacaacatt 272  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
3485332 tttcaattcttcaaaaagttgaacaaaacaaacaataacaacgtgtcaatgggtatctagtgttcaatttgtatcagcaacctttagaaaccacaacatt 3485431  T
273 gaggtcgaaaatcacttaagacaacccagcacaagcacaagtattctcaaataattgaaaaacaacaaaacccttatctttgt 355  Q
    |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3485432 gaggtcgaaaatcacttaagacaacccaacacaagcacaagtattctcaaataattgaaaaacaacaaaacccttatctttgt 3485514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 1 - 83
Target Start/End: Original strand, 3485510 - 3485592
Alignment:
1 tttgtgggaccttaatttgatttgaaatttccgtacaaaactaacaacttaagagttgtacctctccttcttgattaattttg 83  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||| ||||||||||    
3485510 tttgtgggaccttaatttgatttgaaacttccgtacaaaactaacaacttaagagttgcacctctccttcttaattaattttg 3485592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 108121 times since January 2019
Visitors: 1329