View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 108_8_4 (Length: 419)

Name: 108_8_4
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 108_8_4
108_8_4
[»] chr1 (5 HSPs)
chr1 (8-175)||(16001698-16001865)
chr1 (1-175)||(50889014-50889188)
chr1 (171-306)||(16001151-16001286)
chr1 (71-117)||(16001606-16001652)
chr1 (71-117)||(50889227-50889273)
[»] chr7 (2 HSPs)
chr7 (171-307)||(22348226-22348362)
chr7 (71-117)||(22348659-22348705)
[»] chr3 (2 HSPs)
chr3 (40-175)||(22599352-22599487)
chr3 (175-359)||(22598790-22598973)
[»] chr5 (3 HSPs)
chr5 (175-359)||(6837471-6837654)
chr5 (1-175)||(6836915-6837107)
chr5 (2-71)||(6839784-6839854)
[»] chr8 (1 HSPs)
chr8 (171-307)||(306345-306481)
[»] chr6 (1 HSPs)
chr6 (113-179)||(30774867-30774933)
[»] chr4 (1 HSPs)
chr4 (2-31)||(37078066-37078095)


Alignment Details
Target: chr1 (Bit Score: 140; Significance: 3e-73; HSPs: 5)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 140; E-Value: 3e-73
Query Start/End: Original strand, 8 - 175
Target Start/End: Original strand, 16001698 - 16001865
Alignment:
8 tgttagataatttgatgcataaaatattgttaaatttaatgcataatgttctgttagataaaatgatgcatattgacattgttaaatttgatatatacta 107  Q
    |||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||     
16001698 tgttagataatttgatgcataaaacattgttaaatttgatgcataatgttctgttagataaaatgatgcatattgacactgttaaatttgatatatactg 16001797  T
108 ttatattattgagtttactttgttcatttaaattgagcttcatctacgtggttattgttagggttaat 175  Q
    |||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||    
16001798 ttatgttattgagtttactttgttcatttaaattgagcttcatctacatggttattgttaggattaat 16001865  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 1 - 175
Target Start/End: Complemental strand, 50889188 - 50889014
Alignment:
1 acttatctgttagataatttgatgcataaaatattgttaaatttaatgcataatgttctgttagataaaatgatgcatattgacattgttaaatttgata 100  Q
    |||| |||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
50889188 acttctctgttagataatttgatgcataaaacattgttaaatttgatgcataatgttctgttagataaaatgatgcatattgacattgttaaatttgata 50889089  T
101 tatactattatattattgagtttactttgttcatttaaattgagcttcatctacgtggttattgttagggttaat 175  Q
    |||| | |||| |||||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |||||    
50889088 tatattgttatgttattgagtttactttgtccatttaaattgagcttcatctacatggttattgttaggattaat 50889014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 112; E-Value: 2e-56
Query Start/End: Original strand, 171 - 306
Target Start/End: Original strand, 16001151 - 16001286
Alignment:
171 ttaatttgtcaataaattcgtatttttattangcgtatttgatattgcttaattatttgacttgtttcncanatattgnttcccatgcattttagaaatt 270  Q
    ||||||| ||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||| || |||||| || ||||||||||||||||||    
16001151 ttaatttttcaataaattcgtatttttattatgcgcatttgatattgcttaattatttgacttgtttctcatatattgttttccatgcattttagaaatt 16001250  T
271 ggacaagtcttgagtggagtagatgttggtcctgct 306  Q
    ||||||||||||||||||||||||||||||||||||    
16001251 ggacaagtcttgagtggagtagatgttggtcctgct 16001286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 71 - 117
Target Start/End: Original strand, 16001606 - 16001652
Alignment:
71 tgatgcatattgacattgttaaatttgatatatactattatattatt 117  Q
    ||||||||| |||||||||||||||||||||||||| |||| |||||    
16001606 tgatgcatactgacattgttaaatttgatatatactgttatgttatt 16001652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 71 - 117
Target Start/End: Complemental strand, 50889273 - 50889227
Alignment:
71 tgatgcatattgacattgttaaatttgatatatactattatattatt 117  Q
    ||||||||| ||||||||||| |||||||||||||| |||| |||||    
50889273 tgatgcatactgacattgttatatttgatatatactgttatgttatt 50889227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 117; Significance: 2e-59; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 117; E-Value: 2e-59
Query Start/End: Original strand, 171 - 307
Target Start/End: Original strand, 22348226 - 22348362
Alignment:
171 ttaatttgtcaataaattcgtatttttattangcgtatttgatattgcttaattatttgacttgtttcncanatattgnttcccatgcattttagaaatt 270  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| || |||||| || ||||||||||||||||||    
22348226 ttaatttgtcaataaattcgtatttttattatgcgtatttgatattgcttaattatttgacttgtttctcatatattgtttgccatgcattttagaaatt 22348325  T
271 ggacaagtcttgagtggagtagatgttggtcctgctg 307  Q
     ||||||||||||||||||||||||||||||||||||    
22348326 cgacaagtcttgagtggagtagatgttggtcctgctg 22348362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 71 - 117
Target Start/End: Original strand, 22348659 - 22348705
Alignment:
71 tgatgcatattgacattgttaaatttgatatatactattatattatt 117  Q
    ||||||||| |||||||||||||||||||||||| | |||| |||||    
22348659 tgatgcatactgacattgttaaatttgatatatattgttatgttatt 22348705  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 116; Significance: 7e-59; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 116; E-Value: 7e-59
Query Start/End: Original strand, 40 - 175
Target Start/End: Original strand, 22599352 - 22599487
Alignment:
40 aatttaatgcataatgttctgttagataaaatgatgcatattgacattgttaaatttgatatatactattatattattgagtttactttgttcatttaaa 139  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||    
22599352 aatttgatgcataatgttctgttagataaaatgatgcatattgacattgttaaatttgatatatactgttatgttattgagtttactttgttcatttaaa 22599451  T
140 ttgagcttcatctacgtggttattgttagggttaat 175  Q
    ||||||||||||||| |||||||||||||| |||||    
22599452 ttgagcttcatctacatggttattgttaggattaat 22599487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 111; E-Value: 7e-56
Query Start/End: Original strand, 175 - 359
Target Start/End: Original strand, 22598790 - 22598973
Alignment:
175 tttgtcaataaattcgtatttttattangcgtatttgatattgcttaattatttgacttgtttcncanatattgnttcccatgcattttagaaattggac 274  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| || |||||| || |||||||||||| |||||||||    
22598790 tttgtcaataaattcgtatttttattatgcgtatttgatattgcttaattatttgacttgtttctcatatattgtttgccatgcattttaaaaattggac 22598889  T
275 aagtcttgagtggagtagatgttggtcctgctggctcnactgctggtgttgcaccnacaactgggccctaattcccatttaatgg 359  Q
    ||||||||||||||||| ||||||| |||||| |  |  ||| |||||||| |||  ||||||||| |||||| |||||||||||    
22598890 aagtcttgagtggagtacatgttggccctgctagtcctgctgttggtgttggaccagcaactgggctctaatt-ccatttaatgg 22598973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 115; Significance: 3e-58; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 115; E-Value: 3e-58
Query Start/End: Original strand, 175 - 359
Target Start/End: Complemental strand, 6837654 - 6837471
Alignment:
175 tttgtcaataaattcgtatttttattangcgtatttgatattgcttaattatttgacttgtttcncanatattgnttcccatgcattttagaaattggac 274  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| || |||||| || ||||||||||||||||||||||    
6837654 tttgtcaataaattcgtatttttattatgcgtatttgatattgcttaattatttgacttgtttctcatatattgtttgccatgcattttagaaattggac 6837555  T
275 aagtcttgagtggagtagatgttggtcctgctggctcnactgctggtgttgcaccnacaactgggccctaattcccatttaatgg 359  Q
    ||||||||||||||||| ||||||| |||||| |  |  |||||||||||| |||  ||||||||  |||||| |||||||||||    
6837554 aagtcttgagtggagtacatgttggccctgctagtcctgctgctggtgttggaccagcaactggggtctaatt-ccatttaatgg 6837471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 105; E-Value: 3e-52
Query Start/End: Original strand, 1 - 175
Target Start/End: Complemental strand, 6837107 - 6836915
Alignment:
1 acttatctgttagataatttgatgcataaaatattgttaaatttaatgcataatgttctgttagataaaatgatgcatattgacattgttaaatttgata 100  Q
    |||| |||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6837107 acttctctgttagataatttgatgcataaaacattgttaaatttgatgcataatgttctgttagataaaatgatgcatattgacattgttaaatttgata 6837008  T
101 tatac-----------------ta-ttatattattgagtttactttgttcatttaaattgagcttcatctacgtggttattgttagggttaat 175  Q
    |||||                 || |||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||    
6837007 tatacggttatgttattgagtttacttatgttattgagtttactttgttcatttaaattgagcttcatctacatggttattgttaggattaat 6836915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 2 - 71
Target Start/End: Complemental strand, 6839854 - 6839784
Alignment:
2 cttatctgttagataatttgatgcataaaat-attgttaaatttaatgcataatgttctgttagataaaat 71  Q
    ||||| ||||||||||||||||||||||||  |||||||||||| ||||||||||||||||||||||||||    
6839854 cttatttgttagataatttgatgcataaaaacattgttaaatttgatgcataatgttctgttagataaaat 6839784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 113; Significance: 4e-57; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 171 - 307
Target Start/End: Complemental strand, 306481 - 306345
Alignment:
171 ttaatttgtcaataaattcgtatttttattangcgtatttgatattgcttaattatttgacttgtttcncanatattgnttcccatgcattttagaaatt 270  Q
    ||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||| || |||||| || ||||||||||||||||||    
306481 ttaatttgtcaataaattcatatttttattatgcgtatttgatattgcttaattatttgacttgtttctcatatattgttttccatgcattttagaaatt 306382  T
271 ggacaagtcttgagtggagtagatgttggtcctgctg 307  Q
    |||||||||||||||||||||||||||| ||||||||    
306381 ggacaagtcttgagtggagtagatgttgctcctgctg 306345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 51; Significance: 4e-20; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 113 - 179
Target Start/End: Complemental strand, 30774933 - 30774867
Alignment:
113 ttattgagtttactttgttcatttaaattgagcttcatctacgtggttattgttagggttaatttgt 179  Q
    ||||||||||| ||||||||| |||||||||||||||||||| |||||||||||||| |||||||||    
30774933 ttattgagttttctttgttcaattaaattgagcttcatctacatggttattgttaggattaatttgt 30774867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 2 - 31
Target Start/End: Original strand, 37078066 - 37078095
Alignment:
2 cttatctgttagataatttgatgcataaaa 31  Q
    ||||||||||||||||||||||||||||||    
37078066 cttatctgttagataatttgatgcataaaa 37078095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 110969 times since January 2019
Visitors: 1335