View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 108_8_53 (Length: 826)

Name: 108_8_53
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 108_8_53
108_8_53
[»] chr5 (3 HSPs)
chr5 (1-501)||(39811196-39811696)
chr5 (655-826)||(39811692-39811863)
chr5 (570-649)||(39811000-39811079)
[»] chr3 (2 HSPs)
chr3 (678-823)||(15799110-15799255)
chr3 (284-434)||(15798743-15798893)


Alignment Details
Target: chr5 (Bit Score: 436; Significance: 0; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 436; E-Value: 0
Query Start/End: Original strand, 1 - 501
Target Start/End: Complemental strand, 39811696 - 39811196
Alignment:
1 aatgttattagtttcacnntaataacagtactaactaaggtgtaataagagcaaatataagtaatgcctccaaactttgtactattagtatttcagnnnn 100  Q
    ||||||||||||||||   |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||        
39811696 aatgttattagtttcaagttaataacagtactaactaaggtgtaataagagcaaatataagtaatgcctccaaactttgtactattagtatttcagtttt 39811597  T
101 nnnaatatatttggttattgcgtgacatagtaattctttggttatcggctacaacgagctaatgaccaggatgacccctaagaaatattgatctacactc 200  Q
       |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39811596 tttaatatatttggttattgcgtgacatagtaattctttggttatcggctacaacgagctaatgaccaggatgacccctaagaaatattgatctacactc 39811497  T
201 aaaaccttgaggcatatatgatcacattcttatatatccttcctttaagagatgtatgactaaacgaatattatcactgtataagttactcacttctaac 300  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39811496 aaaaccttgaggcatatataatcacattcttatatatccttcctttaagagatgtatgactaaacgaatattatcactgtataagttactcacttctaac 39811397  T
301 caaatcgaaggtaaagcttttggtgaagaagatccatcagcaccaccagtaagctgtgagagatccccatcgacttcagggccatcttcttgtatcacca 400  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
39811396 caaattgaaggtaaagcttttggtgaagaagatccatcagcaccaccagtaagctgtgagagatccccatcaacttcagggccatcttcttgtatcacca 39811297  T
401 cattgctaaagtccataccaggagggataacctgcagaaattccatttaagacatggntattgtttacataaaaccatcnaagagataa-tgatatatgc 499  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||| ||||||||| ||||||||||    
39811296 cattgctaaagtccataccaggagggataacctgcagaaattccatttaagacatgg-tattgttcacataaaaccatcaaagagataactgatatatgc 39811198  T
500 ta 501  Q
    ||    
39811197 ta 39811196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 165; E-Value: 8e-88
Query Start/End: Original strand, 655 - 826
Target Start/End: Complemental strand, 39811863 - 39811692
Alignment:
655 caattgaattatgttaagttgttacttncaagattagctagttttcttaaggaacgattttctccaaaagcttttaatagagttgttatgttcttctttg 754  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
39811863 caattgaattatgttaagttgttacttacaagattagctagttttcttaaggaacgattttctccaaaagcctttaatagagttgttatgttcttctttg 39811764  T
755 gatctggccttgataaggctaatatcataggcttgtgaggatttgtgaagaaacgcatcacctgcataatgt 826  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39811763 gatctggccttgataaggctaatatcataggcttgtgaggatttgtgaagaaacgcatcacctgcataatgt 39811692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 570 - 649
Target Start/End: Complemental strand, 39811079 - 39811000
Alignment:
570 taatctcaaatactaaatgatcttcaacttcagtangctaaaaacgncattctnnccgccattctaggcatgtancgacc 649  Q
    ||||||||||||||||||||||||||||||||||| |||||||||  ||||||  |||||||||| |||||||| |||||    
39811079 taatctcaaatactaaatgatcttcaacttcagtatgctaaaaactgcattcttaccgccattctgggcatgtaacgacc 39811000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 71; Significance: 1e-31; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 71; E-Value: 1e-31
Query Start/End: Original strand, 678 - 823
Target Start/End: Complemental strand, 15799255 - 15799110
Alignment:
678 acttncaagattagctagttttcttaaggaacgattttctccaaaagcttttaatagagttgttatgttcttctttggatctggccttgataaggctaat 777  Q
    |||| |||| || || |||| |||||||| |||| |||| ||||| |||||||  || || |||| |||||||||||||||||||||||||||||| ||     
15799255 acttacaaggtttgcaagttctcttaagggacgactttcgccaaatgcttttagaagcgtggttaagttcttctttggatctggccttgataaggccaag 15799156  T
778 atcataggcttgtgaggatttgtgaagaaacgcatcacctgcataa 823  Q
    |||| ||| |||||||||||||| ||||||||||||||||||||||    
15799155 atcacaggtttgtgaggatttgtaaagaaacgcatcacctgcataa 15799110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 284 - 434
Target Start/End: Complemental strand, 15798893 - 15798743
Alignment:
284 agttactcacttctaaccaaatcgaaggtaaagcttttggtgaagaagatccatcagcaccaccagtaagctgtgagagatccccatcgacttcagggcc 383  Q
    ||||||| |||||| ||||||| | ||| |  ||||||||||||||   | |  || |||||||||||||||| |  || || ||||| || ||||| |     
15798893 agttacttacttctgaccaaattggaggcactgcttttggtgaagacccttcgacaccaccaccagtaagctgagcaagctctccatcaacatcaggaca 15798794  T
384 atcttcttgtatcaccacattgctaaagtccataccaggagggataacctg 434  Q
    ||||||||||||||| ||||||||||||||||||||||| |||||||||||    
15798793 atcttcttgtatcacaacattgctaaagtccataccaggtgggataacctg 15798743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 361374 times since January 2019
Visitors: 487