View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 108_8_56 (Length: 423)

Name: 108_8_56
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 108_8_56
108_8_56
[»] chr7 (2 HSPs)
chr7 (199-423)||(3485291-3485514)
chr7 (1-103)||(3485510-3485612)


Alignment Details
Target: chr7 (Bit Score: 206; Significance: 1e-112; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 199 - 423
Target Start/End: Original strand, 3485291 - 3485514
Alignment:
199 gtttaaacatctcaaaatcaataacacatatctaaaatcaatttcaattcttcaaaaagttgaacaaaacaaacaataacaacgtgtcaatgggtatcta 298  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3485291 gtttaaacatctcaaaatcaataacacatatctaaaatcaatttcaattcttcaaaaagttgaacaaaacaaacaataacaacgtgtcaatgggtatcta 3485390  T
299 gtgttcaatttgtagcagcaacctttagaaaccacaacattgaggtcgaaaatcacttaagacaacccagcacaagcacaagtattctcaaatnattgaa 398  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||    
3485391 gtgttcaatttgtatcagcaacctttagaaaccacaacattgaggtcgaaaatcacttaagacaacccaacacaagcacaagtattctcaaataattgaa 3485490  T
399 aaacaacaaaaccccttatctttgt 423  Q
    ||||||||||| |||||||||||||    
3485491 aaacaacaaaa-cccttatctttgt 3485514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 91; E-Value: 6e-44
Query Start/End: Original strand, 1 - 103
Target Start/End: Original strand, 3485510 - 3485612
Alignment:
1 tttgtgggaccttaatttgatttgaaatttccgtacaaaactaacaacttaagagttgtacctctccttcttgattaattttgaagtgaaagtgaagcaa 100  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||    
3485510 tttgtgggaccttaatttgatttgaaacttccgtacaaaactaacaacttaagagttgcacctctccttcttaattaattttgaagtgaaagtgaagcaa 3485609  T
101 ttg 103  Q
    |||    
3485610 ttg 3485612  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 106255 times since January 2019
Visitors: 1320