View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 108_8_58 (Length: 425)

Name: 108_8_58
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 108_8_58
108_8_58
[»] chr1 (3 HSPs)
chr1 (285-425)||(14934882-14935022)
chr1 (73-147)||(14935025-14935100)
chr1 (1-40)||(14935018-14935057)
[»] scaffold0075 (1 HSPs)
scaffold0075 (285-368)||(13095-13178)


Alignment Details
Target: chr1 (Bit Score: 126; Significance: 8e-65; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 126; E-Value: 8e-65
Query Start/End: Original strand, 285 - 425
Target Start/End: Original strand, 14934882 - 14935022
Alignment:
285 aattcaacacagatttcagcagtggagctgaatttttgtggnctcacggacagattcaagattcaacatatcaaatgttgaaaacagnatgcagtgttgc 384  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
14934882 aattcaacacagatttcagcagtggagctgaatttttgtggtctcacggacagattcaagattcaacatatcaaatgttgaaaacagtatgcagtgttgc 14934981  T
385 tgaaattagaagacanagtcggactgggaaacngagtnacg 425  Q
    ||||||||||||||| |||||||||||||||| |||| |||    
14934982 tgaaattagaagacagagtcggactgggaaactgagtaacg 14935022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 73 - 147
Target Start/End: Original strand, 14935025 - 14935100
Alignment:
73 tgtgataaagtaaatcggctattgtcaatggaggcatatttttaaaatttgatcattaa-ttttgtccatattttt 147  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||    
14935025 tgtgataaagtaaatcggctattgtcaatggagacatatttttaaaatttgatcattaatttttgtccatattttt 14935100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 1 - 40
Target Start/End: Original strand, 14935018 - 14935057
Alignment:
1 taacgcatgtgataaagtaaatcagctattgtcaatggag 40  Q
    ||||||||||||||||||||||| ||||||||||||||||    
14935018 taacgcatgtgataaagtaaatcggctattgtcaatggag 14935057  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0075 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 1)
Name: scaffold0075
Description:

Target: scaffold0075; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 285 - 368
Target Start/End: Original strand, 13095 - 13178
Alignment:
285 aattcaacacagatttcagcagtggagctgaatttttgtggnctcacggacagattcaagattcaacatatcaaatgttgaaaa 368  Q
    ||||| ||| ||||||||||||||||||||||||||||||| | ||||| || ||    || ||||||||||||||||||||||    
13095 aattcgacaaagatttcagcagtggagctgaatttttgtggtcacacgggcaaatctccgaatcaacatatcaaatgttgaaaa 13178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 202967 times since January 2019
Visitors: 1517