View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 108_8_73 (Length: 493)

Name: 108_8_73
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 108_8_73
108_8_73
[»] chr1 (56 HSPs)
chr1 (271-493)||(39776341-39776563)
chr1 (1-221)||(39776130-39776345)
chr1 (218-274)||(15034764-15034820)
chr1 (218-272)||(23536067-23536121)
chr1 (218-274)||(24273239-24273295)
chr1 (218-274)||(30190241-30190297)
chr1 (218-274)||(34756425-34756481)
chr1 (217-272)||(8224768-8224823)
chr1 (218-272)||(4038075-4038129)
chr1 (218-272)||(15034659-15034713)
chr1 (218-272)||(26501098-26501152)
chr1 (218-275)||(6470705-6470762)
chr1 (218-274)||(4038180-4038236)
chr1 (218-274)||(45565392-45565448)
chr1 (218-268)||(27804269-27804319)
chr1 (218-275)||(47165231-47165288)
chr1 (218-270)||(40264135-40264187)
chr1 (224-272)||(43623003-43623051)
chr1 (218-269)||(37036968-37037019)
chr1 (218-272)||(29446750-29446804)
chr1 (218-272)||(32287952-32288006)
chr1 (218-271)||(32573027-32573080)
chr1 (218-270)||(28632604-28632656)
chr1 (218-270)||(28745799-28745851)
chr1 (218-274)||(44410309-44410365)
chr1 (218-270)||(50005184-50005236)
chr1 (218-272)||(27804370-27804424)
chr1 (218-272)||(27935590-27935644)
chr1 (218-272)||(38277415-38277469)
chr1 (218-272)||(44410416-44410470)
chr1 (219-272)||(31166310-31166363)
chr1 (237-274)||(32572938-32572975)
chr1 (218-263)||(37448420-37448465)
chr1 (218-263)||(44570687-44570732)
chr1 (232-272)||(5474417-5474457)
chr1 (218-270)||(34756532-34756584)
chr1 (218-270)||(38277520-38277571)
chr1 (237-272)||(15245460-15245495)
chr1 (237-275)||(32128045-32128083)
chr1 (218-272)||(49659217-49659270)
chr1 (218-272)||(50005079-50005133)
chr1 (227-269)||(51847855-51847897)
chr1 (237-274)||(23536173-23536210)
chr1 (237-274)||(37214924-37214961)
chr1 (237-274)||(48953585-48953622)
chr1 (218-274)||(946374-946429)
chr1 (220-272)||(10166499-10166551)
chr1 (218-273)||(32652205-32652260)
chr1 (218-265)||(37447921-37447968)
chr1 (237-272)||(40264048-40264083)
chr1 (237-272)||(41823180-41823215)
chr1 (237-272)||(50471768-50471803)
chr1 (237-275)||(17502286-17502324)
chr1 (218-256)||(52280972-52281010)
chr1 (218-267)||(28745901-28745950)
chr1 (237-274)||(34007356-34007393)
[»] chr4 (51 HSPs)
chr4 (218-275)||(49111417-49111474)
chr4 (218-275)||(31473846-31473903)
chr4 (218-274)||(857344-857400)
chr4 (218-274)||(14982278-14982334)
chr4 (218-274)||(15660288-15660344)
chr4 (218-274)||(36455905-36455961)
chr4 (218-272)||(7352917-7352971)
chr4 (218-271)||(4441338-4441391)
chr4 (218-275)||(16516168-16516225)
chr4 (218-274)||(2125855-2125911)
chr4 (218-274)||(4896646-4896702)
chr4 (218-270)||(7352814-7352866)
chr4 (218-274)||(10128079-10128135)
chr4 (218-274)||(11348342-11348398)
chr4 (218-274)||(28845976-28846032)
chr4 (218-269)||(10633035-10633086)
chr4 (218-272)||(1112605-1112659)
chr4 (218-275)||(1107157-1107214)
chr4 (223-272)||(31742874-31742923)
chr4 (218-270)||(4896737-4896789)
chr4 (218-264)||(1539649-1539695)
chr4 (218-272)||(15660183-15660237)
chr4 (218-272)||(36456031-36456085)
chr4 (218-272)||(41498595-41498649)
chr4 (218-267)||(28845876-28845925)
chr4 (225-270)||(42542979-42543024)
chr4 (218-274)||(5715742-5715798)
chr4 (218-274)||(11040966-11041021)
chr4 (218-274)||(35470120-35470176)
chr4 (237-275)||(26251015-26251053)
chr4 (218-272)||(42844543-42844597)
chr4 (220-270)||(42844650-42844700)
chr4 (218-275)||(55266880-55266937)
chr4 (218-274)||(1112727-1112783)
chr4 (218-270)||(10127976-10128028)
chr4 (218-270)||(26250911-26250963)
chr4 (223-274)||(467912-467962)
chr4 (218-275)||(41498486-41498544)
chr4 (237-270)||(42775625-42775658)
chr4 (237-274)||(53760810-53760847)
chr4 (218-270)||(31742778-31742830)
chr4 (237-273)||(47108317-47108353)
chr4 (237-272)||(14982385-14982420)
chr4 (241-271)||(4441438-4441468)
chr4 (218-272)||(52493926-52493978)
chr4 (237-275)||(56339148-56339186)
chr4 (241-274)||(32724928-32724961)
chr4 (237-270)||(46243115-46243148)
chr4 (237-270)||(52295065-52295098)
chr4 (218-270)||(19461755-19461807)
chr4 (224-272)||(42776637-42776685)
[»] chr3 (51 HSPs)
chr3 (218-275)||(46672821-46672878)
chr3 (218-272)||(49457343-49457397)
chr3 (218-274)||(36398007-36398063)
chr3 (218-274)||(44692820-44692876)
chr3 (218-274)||(47767430-47767486)
chr3 (218-277)||(9129449-9129508)
chr3 (218-277)||(9137556-9137615)
chr3 (218-272)||(27251999-27252053)
chr3 (218-272)||(42005971-42006025)
chr3 (218-272)||(44436258-44436312)
chr3 (218-272)||(44692927-44692981)
chr3 (218-274)||(37054392-37054448)
chr3 (218-272)||(5415783-5415837)
chr3 (218-268)||(21307550-21307600)
chr3 (218-268)||(35279920-35279970)
chr3 (218-274)||(28092212-28092268)
chr3 (218-272)||(671637-671691)
chr3 (218-272)||(5415888-5415942)
chr3 (218-272)||(7302346-7302400)
chr3 (218-272)||(34088571-34088625)
chr3 (218-272)||(53129861-53129915)
chr3 (218-274)||(46429501-46429557)
chr3 (218-274)||(47284331-47284387)
chr3 (218-274)||(48947603-48947659)
chr3 (218-274)||(53470447-53470503)
chr3 (218-272)||(9129344-9129398)
chr3 (218-272)||(9137451-9137505)
chr3 (218-256)||(31070422-31070460)
chr3 (218-272)||(46001364-46001418)
chr3 (218-275)||(31189415-31189472)
chr3 (218-275)||(37321547-37321604)
chr3 (237-274)||(46429412-46429449)
chr3 (218-274)||(30767102-30767158)
chr3 (218-274)||(39110392-39110448)
chr3 (218-270)||(42130694-42130746)
chr3 (228-275)||(2732636-2732683)
chr3 (218-264)||(19475824-19475870)
chr3 (218-276)||(46635853-46635911)
chr3 (237-274)||(25655313-25655350)
chr3 (237-270)||(27485474-27485507)
chr3 (218-254)||(30766571-30766607)
chr3 (218-274)||(31070511-31070567)
chr3 (218-266)||(44288477-44288525)
chr3 (229-269)||(52527039-52527079)
chr3 (237-272)||(37321622-37321657)
chr3 (237-272)||(54761583-54761618)
chr3 (243-272)||(9007480-9007509)
chr3 (237-274)||(27251910-27251947)
chr3 (237-274)||(47284222-47284259)
chr3 (224-268)||(47336885-47336929)
chr3 (223-255)||(50168633-50168665)
[»] chr6 (20 HSPs)
chr6 (218-274)||(9285645-9285701)
chr6 (218-274)||(34244999-34245055)
chr6 (218-272)||(6919812-6919866)
chr6 (218-274)||(8574693-8574749)
chr6 (218-274)||(29889453-29889509)
chr6 (218-272)||(8574770-8574824)
chr6 (218-275)||(13487272-13487329)
chr6 (218-270)||(6919710-6919762)
chr6 (218-270)||(9763014-9763066)
chr6 (232-275)||(33733429-33733472)
chr6 (218-272)||(9763117-9763171)
chr6 (218-272)||(28918165-28918219)
chr6 (218-275)||(15299530-15299586)
chr6 (218-274)||(776078-776134)
chr6 (218-274)||(1368475-1368531)
chr6 (218-272)||(776185-776239)
chr6 (239-272)||(1195351-1195384)
chr6 (237-272)||(8475179-8475214)
chr6 (218-268)||(15832470-15832520)
chr6 (218-259)||(15299412-15299453)
[»] chr2 (47 HSPs)
chr2 (218-274)||(41461620-41461676)
chr2 (218-272)||(14365700-14365754)
chr2 (218-274)||(14365804-14365860)
chr2 (218-268)||(11684603-11684653)
chr2 (218-272)||(14537199-14537253)
chr2 (218-272)||(17180297-17180351)
chr2 (218-272)||(27033490-27033544)
chr2 (218-275)||(784898-784955)
chr2 (218-274)||(1583828-1583884)
chr2 (218-274)||(11716406-11716462)
chr2 (218-272)||(769036-769090)
chr2 (218-272)||(10480119-10480173)
chr2 (218-272)||(11141305-11141359)
chr2 (218-264)||(11716504-11716550)
chr2 (218-272)||(33189276-33189330)
chr2 (218-270)||(11532272-11532324)
chr2 (218-270)||(11793897-11793949)
chr2 (218-274)||(35047698-35047754)
chr2 (218-274)||(45094490-45094546)
chr2 (218-269)||(28740599-28740650)
chr2 (218-272)||(7228031-7228085)
chr2 (218-264)||(30698289-30698335)
chr2 (218-274)||(10244175-10244231)
chr2 (218-274)||(13017777-13017833)
chr2 (218-270)||(41461517-41461569)
chr2 (218-272)||(784793-784847)
chr2 (218-272)||(3092282-3092336)
chr2 (218-272)||(39630225-39630279)
chr2 (237-274)||(14537305-14537342)
chr2 (218-270)||(44256212-44256263)
chr2 (218-272)||(17905654-17905708)
chr2 (237-270)||(3345765-3345798)
chr2 (237-274)||(8736461-8736498)
chr2 (237-270)||(11824786-11824819)
chr2 (237-274)||(21504466-21504503)
chr2 (218-271)||(30751365-30751418)
chr2 (218-274)||(8735842-8735898)
chr2 (237-272)||(11684696-11684731)
chr2 (237-268)||(19231305-19231336)
chr2 (218-272)||(14954266-14954320)
chr2 (237-275)||(20935722-20935759)
chr2 (237-274)||(3345852-3345889)
chr2 (237-270)||(11595339-11595372)
chr2 (237-270)||(11607241-11607274)
chr2 (226-267)||(39477976-39478017)
chr2 (218-275)||(40026061-40026118)
chr2 (237-270)||(44205678-44205711)
[»] chr7 (48 HSPs)
chr7 (218-272)||(40110737-40110791)
chr7 (218-272)||(43955517-43955571)
chr7 (218-275)||(43955619-43955676)
chr7 (218-274)||(6498770-6498826)
chr7 (218-274)||(26162142-26162198)
chr7 (218-274)||(28539173-28539229)
chr7 (223-274)||(34398959-34399010)
chr7 (218-272)||(2057395-2057449)
chr7 (218-272)||(31632722-31632776)
chr7 (218-275)||(35455801-35455858)
chr7 (218-274)||(2057500-2057556)
chr7 (218-274)||(5644782-5644838)
chr7 (218-278)||(23548616-23548676)
chr7 (218-281)||(29065810-29065873)
chr7 (218-272)||(5644677-5644731)
chr7 (218-272)||(14603267-14603321)
chr7 (218-272)||(35776960-35777014)
chr7 (218-272)||(39342647-39342701)
chr7 (218-272)||(40110843-40110897)
chr7 (218-271)||(9784936-9784989)
chr7 (218-275)||(29065924-29065981)
chr7 (218-274)||(23455252-23455308)
chr7 (218-272)||(25189231-25189285)
chr7 (218-266)||(21635990-21636038)
chr7 (218-274)||(34388370-34388426)
chr7 (218-272)||(29639220-29639274)
chr7 (218-272)||(30524255-30524309)
chr7 (218-268)||(30629061-30629111)
chr7 (222-272)||(40854079-40854129)
chr7 (237-274)||(40853985-40854022)
chr7 (218-273)||(18789251-18789306)
chr7 (225-272)||(29195709-29195756)
chr7 (237-272)||(31913236-31913271)
chr7 (222-272)||(21635885-21635935)
chr7 (237-271)||(30587909-30587943)
chr7 (241-275)||(31913309-31913343)
chr7 (218-272)||(44915195-44915249)
chr7 (237-274)||(13815000-13815037)
chr7 (218-263)||(22351877-22351922)
chr7 (218-270)||(22391592-22391644)
chr7 (241-272)||(30080811-30080842)
chr7 (224-283)||(46482056-46482115)
chr7 (218-272)||(34388265-34388319)
chr7 (218-272)||(49052786-49052839)
chr7 (221-270)||(18926812-18926861)
chr7 (237-274)||(32650589-32650626)
chr7 (237-274)||(40667357-40667394)
chr7 (218-246)||(43791116-43791144)
[»] chr5 (56 HSPs)
chr5 (218-272)||(15374065-15374119)
chr5 (218-272)||(40643922-40643976)
chr5 (218-275)||(22766949-22767006)
chr5 (218-275)||(26281285-26281342)
chr5 (218-270)||(2721576-2721628)
chr5 (218-274)||(9764443-9764499)
chr5 (218-274)||(22303886-22303942)
chr5 (218-270)||(28828369-28828421)
chr5 (218-274)||(37722910-37722966)
chr5 (218-272)||(2316378-2316432)
chr5 (218-272)||(15804322-15804376)
chr5 (218-271)||(3563278-3563331)
chr5 (218-271)||(20523238-20523291)
chr5 (218-270)||(15804399-15804451)
chr5 (218-272)||(927302-927356)
chr5 (218-272)||(9764338-9764392)
chr5 (218-272)||(25935306-25935360)
chr5 (218-272)||(40090430-40090484)
chr5 (218-272)||(41762231-41762285)
chr5 (218-274)||(15373958-15374014)
chr5 (218-270)||(19533923-19533975)
chr5 (218-274)||(20523131-20523187)
chr5 (221-272)||(23092070-23092121)
chr5 (224-271)||(33245394-33245441)
chr5 (218-272)||(6634015-6634069)
chr5 (218-272)||(16515123-16515177)
chr5 (218-272)||(32250114-32250167)
chr5 (218-272)||(34982216-34982269)
chr5 (218-272)||(40809341-40809395)
chr5 (218-272)||(13243457-13243513)
chr5 (223-275)||(13243514-13243566)
chr5 (218-270)||(28828452-28828504)
chr5 (218-270)||(32389974-32390026)
chr5 (218-274)||(35379342-35379397)
chr5 (218-270)||(37145517-37145569)
chr5 (218-274)||(40809446-40809502)
chr5 (229-268)||(9894349-9894388)
chr5 (218-272)||(32390077-32390131)
chr5 (218-272)||(32470882-32470936)
chr5 (218-275)||(2316484-2316540)
chr5 (227-272)||(5658776-5658821)
chr5 (237-274)||(33146059-33146096)
chr5 (237-274)||(33146189-33146226)
chr5 (218-274)||(23091961-23092016)
chr5 (237-272)||(2550328-2550363)
chr5 (219-270)||(14834826-14834877)
chr5 (237-272)||(22305112-22305147)
chr5 (218-268)||(16515009-16515058)
chr5 (237-274)||(22302537-22302574)
chr5 (218-274)||(32470987-32471041)
chr5 (237-274)||(34982313-34982350)
chr5 (237-272)||(15270871-15270906)
chr5 (237-271)||(12064485-12064519)
chr5 (223-264)||(12991333-12991374)
chr5 (242-275)||(34105086-34105119)
chr5 (218-270)||(20320664-20320716)
[»] chr8 (50 HSPs)
chr8 (218-275)||(33902664-33902721)
chr8 (218-274)||(3853614-3853670)
chr8 (218-274)||(3858072-3858128)
chr8 (218-272)||(17110869-17110923)
chr8 (218-272)||(42711385-42711439)
chr8 (218-275)||(44889351-44889408)
chr8 (218-274)||(14800065-14800121)
chr8 (218-274)||(17110974-17111030)
chr8 (218-274)||(24044958-24045014)
chr8 (218-274)||(28324691-28324747)
chr8 (218-274)||(29257380-29257436)
chr8 (218-272)||(14991692-14991746)
chr8 (218-272)||(33377326-33377380)
chr8 (218-272)||(40046804-40046858)
chr8 (218-275)||(37268112-37268169)
chr8 (218-275)||(44346707-44346764)
chr8 (218-270)||(4156272-4156324)
chr8 (218-270)||(29482836-29482888)
chr8 (221-275)||(515564-515618)
chr8 (218-272)||(23011734-23011788)
chr8 (218-272)||(36103101-36103155)
chr8 (218-275)||(13404824-13404881)
chr8 (227-272)||(27322687-27322732)
chr8 (218-262)||(13404932-13404976)
chr8 (224-272)||(32626069-32626117)
chr8 (218-272)||(14239-14292)
chr8 (218-268)||(30435250-30435300)
chr8 (218-272)||(31807409-31807462)
chr8 (218-272)||(33986004-33986058)
chr8 (237-274)||(29611386-29611423)
chr8 (237-274)||(34008797-34008834)
chr8 (218-270)||(3853721-3853773)
chr8 (218-270)||(3858179-3858231)
chr8 (218-266)||(8689138-8689186)
chr8 (218-257)||(8049269-8049308)
chr8 (237-272)||(14799979-14800014)
chr8 (218-269)||(35979033-35979084)
chr8 (218-272)||(1088306-1088360)
chr8 (218-272)||(33902772-33902825)
chr8 (237-274)||(7202934-7202971)
chr8 (218-255)||(40046895-40046932)
chr8 (218-278)||(11744748-11744808)
chr8 (237-273)||(30435350-30435386)
chr8 (237-272)||(30444963-30444998)
chr8 (237-272)||(42739949-42739984)
chr8 (237-275)||(8409947-8409985)
chr8 (218-275)||(9982634-9982690)
chr8 (242-271)||(34388527-34388556)
chr8 (241-274)||(42711302-42711335)
chr8 (237-269)||(26520469-26520501)
[»] scaffold1562 (2 HSPs)
scaffold1562 (218-270)||(510-562)
scaffold1562 (218-272)||(405-459)
[»] scaffold1158 (2 HSPs)
scaffold1158 (218-270)||(2031-2083)
scaffold1158 (218-272)||(2134-2188)
[»] scaffold0009 (2 HSPs)
scaffold0009 (218-275)||(41994-42051)
scaffold0009 (218-272)||(42083-42137)
[»] scaffold0048 (1 HSPs)
scaffold0048 (218-270)||(82945-82997)
[»] scaffold0318 (1 HSPs)
scaffold0318 (218-274)||(2865-2921)
[»] scaffold0400 (1 HSPs)
scaffold0400 (218-271)||(4517-4570)
[»] scaffold0365 (1 HSPs)
scaffold0365 (218-271)||(5161-5214)
[»] scaffold0301 (1 HSPs)
scaffold0301 (218-270)||(7153-7205)
[»] scaffold0129 (2 HSPs)
scaffold0129 (223-270)||(19200-19247)
scaffold0129 (227-270)||(19813-19855)
[»] scaffold0240 (1 HSPs)
scaffold0240 (237-279)||(17605-17647)
[»] scaffold0169 (1 HSPs)
scaffold0169 (218-272)||(4075-4129)
[»] scaffold0044 (1 HSPs)
scaffold0044 (218-268)||(56379-56429)
[»] scaffold0039 (1 HSPs)
scaffold0039 (237-275)||(109046-109084)
[»] scaffold0027 (1 HSPs)
scaffold0027 (218-271)||(10887-10940)
[»] scaffold0337 (1 HSPs)
scaffold0337 (218-272)||(15883-15936)
[»] scaffold0065 (1 HSPs)
scaffold0065 (218-272)||(2925-2978)


Alignment Details
Target: chr1 (Bit Score: 215; Significance: 1e-118; HSPs: 56)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 271 - 493
Target Start/End: Complemental strand, 39776563 - 39776341
Alignment:
271 ctaaatgtaatttcctgatatgtgtaatttacagctattttatttatcttatttgttatgaccaatgaatggttctgtacgcacgctttctttgtatgct 370  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
39776563 ctaaatgtaatttcctgatatgtgtaatttacagctattttatttatcatatttgttatgaccaatgaatggttctgtacgcacgctttctttgtatgct 39776464  T
371 ttcatattcaaaatgttcatgttaataatctggagttgattgttctgtgcagcttctatcgatgcgagtttgacccggtgcatggtggacaaatgactca 470  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
39776463 ttcatattcaaaatgttcatgttaataatctggagttgattgttctatgcagcttctatcgatgcgagtttgacccggtgcatggtggacaaatgactca 39776364  T
471 acttgaatctcataattttctaa 493  Q
    |||||||||||||||||||||||    
39776363 acttgaatctcataattttctaa 39776341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 201; E-Value: 1e-109
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 39776345 - 39776130
Alignment:
1 tctaaaacttgaagtagcatagtgagacactattttattttagatgaatctttataagaatgtaagtagaaacattattttatagattgatatgatttca 100  Q
    |||||||||||||||||||||||||||||||||||||     ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39776345 tctaaaacttgaagtagcatagtgagacactatttta-----gatgaatctttataagaatgtaagtagaaacattattttatagattgatatgatttca 39776251  T
101 tagatgaatctcataacatttaacgattgacatgatttccttatactagtaattgaaatgaaacaaatttcaagaacatccaatacagctaggattatag 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39776250 tagatgaatctcataacatttaacgattgacatgatttccttatactagtaattgaaatgaaacaaatttcaagaacatccaatacagctaggattatag 39776151  T
201 tactagctagatactacaatt 221  Q
    |||||||||||||||||||||    
39776150 tactagctagatactacaatt 39776130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 218 - 274
Target Start/End: Original strand, 15034764 - 15034820
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 274  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15034764 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 15034820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 218 - 272
Target Start/End: Complemental strand, 23536121 - 23536067
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23536121 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 23536067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 218 - 274
Target Start/End: Original strand, 24273239 - 24273295
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 274  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
24273239 aattccctcataacattacattccctcaaaacattcccccatccaaacacactctaa 24273295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 218 - 274
Target Start/End: Original strand, 30190241 - 30190297
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 274  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
30190241 aattacctcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 30190297  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 218 - 274
Target Start/End: Complemental strand, 34756481 - 34756425
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 274  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
34756481 aattccctcaaaacattacattccctcaaaacattcccccatccaaacactctctaa 34756425  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 217 - 272
Target Start/End: Complemental strand, 8224823 - 8224768
Alignment:
217 caattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
8224823 caattccctcaaaacattacattccctcaaaacattccctcatccaaacacactct 8224768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 218 - 272
Target Start/End: Complemental strand, 4038129 - 4038075
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    ||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
4038129 aattccctcaaaacattacattccctcaaaacattcccccacccaaacacactct 4038075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 218 - 272
Target Start/End: Complemental strand, 15034713 - 15034659
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    ||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
15034713 aattccctcaaaacattacattccctcaaaacattcctccatccaaacacactct 15034659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 218 - 272
Target Start/End: Original strand, 26501098 - 26501152
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    ||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
26501098 aattccctcaaaacattacattccctcaaaacattcctccatccaaacacactct 26501152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 218 - 275
Target Start/End: Original strand, 6470705 - 6470762
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaaa 275  Q
    ||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||    
6470705 aattccctcaaaacattacattctctcaaaacattccgccatccaaacacactctaaa 6470762  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 218 - 274
Target Start/End: Original strand, 4038180 - 4038236
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 274  Q
    ||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||    
4038180 aattccctcaaaacattactttccctcaaaatattcccccatccaaacacactctaa 4038236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 218 - 274
Target Start/End: Complemental strand, 45565448 - 45565392
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 274  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||    
45565448 aattccctcaaaacattacattctctcaaaacattcccccatccaaacacaccctaa 45565392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 218 - 268
Target Start/End: Complemental strand, 27804319 - 27804269
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacaca 268  Q
    ||||||||||||| |||||||||||||||||||||||||||||||||||||    
27804319 aattccctcaaaatattacattccctcaaaacattcccccatccaaacaca 27804269  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 218 - 275
Target Start/End: Original strand, 47165231 - 47165288
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaaa 275  Q
    |||||||||||||||||||||| |||||||||||| | ||||||||||||||||||||    
47165231 aattccctcaaaacattacatttcctcaaaacatttctccatccaaacacactctaaa 47165288  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 218 - 270
Target Start/End: Original strand, 40264135 - 40264187
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacact 270  Q
    |||||||||||||||||||||| |||||||| |||||||||||||||||||||    
40264135 aattccctcaaaacattacattacctcaaaatattcccccatccaaacacact 40264187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 224 - 272
Target Start/End: Original strand, 43623003 - 43623051
Alignment:
224 ctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||||    
43623003 ctcaaaacattacattccatcaaaacattcccccatccaaacacactct 43623051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 218 - 269
Target Start/End: Original strand, 37036968 - 37037019
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacac 269  Q
    ||||||||||||||||||||||| |||||||||||||| |||||||||||||    
37036968 aattccctcaaaacattacattcactcaaaacattccctcatccaaacacac 37037019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 218 - 272
Target Start/End: Complemental strand, 29446804 - 29446750
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    |||||||||||||||||||||||| ||||||||||||||| | ||||||||||||    
29446804 aattccctcaaaacattacattccttcaaaacattcccccgttcaaacacactct 29446750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 218 - 272
Target Start/End: Original strand, 32287952 - 32288006
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    |||| ||||||||||||||||||||||||||| |||| |||||||||||||||||    
32287952 aatttcctcaaaacattacattccctcaaaactttcctccatccaaacacactct 32288006  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 218 - 271
Target Start/End: Original strand, 32573027 - 32573080
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactc 271  Q
    |||||||||||||||||||||| |||||||| |||||||||||||| |||||||    
32573027 aattccctcaaaacattacattacctcaaaatattcccccatccaatcacactc 32573080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 218 - 270
Target Start/End: Original strand, 28632604 - 28632656
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacact 270  Q
    ||||| ||||||||||||||||||||| |||||||||| ||||||||||||||    
28632604 aattctctcaaaacattacattccctccaaacattccctcatccaaacacact 28632656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 218 - 270
Target Start/End: Complemental strand, 28745851 - 28745799
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacact 270  Q
    |||||||||||| |||||||||||||||||| ||||||||||||||| |||||    
28745851 aattccctcaaaccattacattccctcaaaatattcccccatccaaatacact 28745799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 218 - 274
Target Start/End: Complemental strand, 44410365 - 44410309
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 274  Q
    ||||| || ||||||||||||||||||||||||||| |||||||||| |||||||||    
44410365 aattcgcttaaaacattacattccctcaaaacattctcccatccaaatacactctaa 44410309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 218 - 270
Target Start/End: Original strand, 50005184 - 50005236
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacact 270  Q
    |||||||||||||||||||||| |||||||| ||||| |||||||||||||||    
50005184 aattccctcaaaacattacattacctcaaaatattcctccatccaaacacact 50005236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 218 - 272
Target Start/End: Original strand, 27804370 - 27804424
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    |||||| || |||||||||||| |||||||||||||| |||||||||||||||||    
27804370 aattccttctaaacattacatttcctcaaaacattcctccatccaaacacactct 27804424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #28
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 218 - 272
Target Start/End: Original strand, 27935590 - 27935644
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    |||| |||||||||||||||||||||||||| ||| | |||||||||||||||||    
27935590 aatttcctcaaaacattacattccctcaaaatatttctccatccaaacacactct 27935644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #29
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 218 - 272
Target Start/End: Complemental strand, 38277469 - 38277415
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    |||||| |||||||||||||||||||||||| |||| | ||||||||||||||||    
38277469 aattccttcaaaacattacattccctcaaaatattctctcatccaaacacactct 38277415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #30
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 218 - 272
Target Start/End: Original strand, 44410416 - 44410470
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    |||||||||||||| ||||||| |||||||| ||||||| |||||||||||||||    
44410416 aattccctcaaaactttacattacctcaaaatattccccaatccaaacacactct 44410470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #31
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 219 - 272
Target Start/End: Complemental strand, 31166363 - 31166310
Alignment:
219 attccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    ||||| |||||||||||||||  |||||||||||||| ||||||||||||||||    
31166363 attccatcaaaacattacattatctcaaaacattccctcatccaaacacactct 31166310  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #32
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 237 - 274
Target Start/End: Complemental strand, 32572975 - 32572938
Alignment:
237 attccctcaaaacattcccccatccaaacacactctaa 274  Q
    ||||||||||||||||||||||||||||||||||||||    
32572975 attccctcaaaacattcccccatccaaacacactctaa 32572938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #33
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 218 - 263
Target Start/End: Original strand, 37448420 - 37448465
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaa 263  Q
    ||||||||||||||||||||||| |||||||||||||| |||||||    
37448420 aattccctcaaaacattacattctctcaaaacattccctcatccaa 37448465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #34
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 218 - 263
Target Start/End: Complemental strand, 44570732 - 44570687
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaa 263  Q
    |||||| ||||||||||||||||||||||||||||| |||||||||    
44570732 aattccttcaaaacattacattccctcaaaacattctcccatccaa 44570687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #35
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 232 - 272
Target Start/End: Complemental strand, 5474457 - 5474417
Alignment:
232 attacattccctcaaaacattcccccatccaaacacactct 272  Q
    |||| ||||||||||||||||||||||||||||||||||||    
5474457 attaaattccctcaaaacattcccccatccaaacacactct 5474417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #36
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 218 - 270
Target Start/End: Original strand, 34756532 - 34756584
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacact 270  Q
    |||||||||||||||||| ||| |||||||| ||| |||||||||||||||||    
34756532 aattccctcaaaacattatattacctcaaaatatttccccatccaaacacact 34756584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #37
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 218 - 270
Target Start/End: Original strand, 38277520 - 38277571
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacact 270  Q
    |||||||||||||||||||||| |||||||| ||| |||||||||||||||||    
38277520 aattccctcaaaacattacattacctcaaaatatt-ccccatccaaacacact 38277571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #38
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 237 - 272
Target Start/End: Complemental strand, 15245495 - 15245460
Alignment:
237 attccctcaaaacattcccccatccaaacacactct 272  Q
    ||||||||||||||||||||||||||||||||||||    
15245495 attccctcaaaacattcccccatccaaacacactct 15245460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #39
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 237 - 275
Target Start/End: Complemental strand, 32128083 - 32128045
Alignment:
237 attccctcaaaacattcccccatccaaacacactctaaa 275  Q
    |||||||||||||||||||||||| ||||||||||||||    
32128083 attccctcaaaacattcccccatctaaacacactctaaa 32128045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #40
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 218 - 272
Target Start/End: Complemental strand, 49659270 - 49659217
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    |||||||||  |||||||||||||||||| ||||| |||||||||||||||||||    
49659270 aattccctcgtaacattacattccctcaatacatt-ccccatccaaacacactct 49659217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #41
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 218 - 272
Target Start/End: Complemental strand, 50005133 - 50005079
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    ||||| ||||||||||||||||| ||||||| |||||  ||||||||||||||||    
50005133 aattcgctcaaaacattacattctctcaaaatattccgtcatccaaacacactct 50005079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #42
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 227 - 269
Target Start/End: Complemental strand, 51847897 - 51847855
Alignment:
227 aaaacattacattccctcaaaacattcccccatccaaacacac 269  Q
    ||||||||||||| |||||||||||||| ||||||||||||||    
51847897 aaaacattacattacctcaaaacattcctccatccaaacacac 51847855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #43
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 237 - 274
Target Start/End: Original strand, 23536173 - 23536210
Alignment:
237 attccctcaaaacattcccccatccaaacacactctaa 274  Q
    |||||||||||||||||||||||||||||||| |||||    
23536173 attccctcaaaacattcccccatccaaacacattctaa 23536210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #44
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 237 - 274
Target Start/End: Original strand, 37214924 - 37214961
Alignment:
237 attccctcaaaacattcccccatccaaacacactctaa 274  Q
    ||||||||||||||||| ||||||||||||||||||||    
37214924 attccctcaaaacattctcccatccaaacacactctaa 37214961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #45
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 237 - 274
Target Start/End: Complemental strand, 48953622 - 48953585
Alignment:
237 attccctcaaaacattcccccatccaaacacactctaa 274  Q
    ||||| ||||||||||||||||||||||||||||||||    
48953622 attccttcaaaacattcccccatccaaacacactctaa 48953585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #46
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 218 - 274
Target Start/End: Complemental strand, 946429 - 946374
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 274  Q
    ||||||||||||||| |||||||||||||| ||||  | ||||||||||||||||||    
946429 aattccctcaaaacaatacattccctcaaagcatt-tctcatccaaacacactctaa 946374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #47
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 220 - 272
Target Start/End: Complemental strand, 10166551 - 10166499
Alignment:
220 ttccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    |||| ||||||||||||||| || |||||||||| | ||||||||||||||||    
10166551 ttccttcaaaacattacattaccacaaaacattctctcatccaaacacactct 10166499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #48
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 218 - 273
Target Start/End: Complemental strand, 32652260 - 32652205
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactcta 273  Q
    |||| |||||||||| |||||| |||||||||||| | ||||||||| ||||||||    
32652260 aatttcctcaaaacaatacatttcctcaaaacatttctccatccaaatacactcta 32652205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #49
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 218 - 265
Target Start/End: Original strand, 37447921 - 37447968
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaac 265  Q
    |||||| |||||||||||||||||||| ||| ||||||| ||||||||    
37447921 aattccttcaaaacattacattccctccaaatattcccctatccaaac 37447968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #50
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 237 - 272
Target Start/End: Complemental strand, 40264083 - 40264048
Alignment:
237 attccctcaaaacattcccccatccaaacacactct 272  Q
    |||||||||||||||||||| |||||||||||||||    
40264083 attccctcaaaacattcccctatccaaacacactct 40264048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #51
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 237 - 272
Target Start/End: Original strand, 41823180 - 41823215
Alignment:
237 attccctcaaaacattcccccatccaaacacactct 272  Q
    ||||| ||||||||||||||||||||||||||||||    
41823180 attccttcaaaacattcccccatccaaacacactct 41823215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #52
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 237 - 272
Target Start/End: Complemental strand, 50471803 - 50471768
Alignment:
237 attccctcaaaacattcccccatccaaacacactct 272  Q
    ||||||||||||| ||||||||||||||||||||||    
50471803 attccctcaaaactttcccccatccaaacacactct 50471768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #53
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 237 - 275
Target Start/End: Original strand, 17502286 - 17502324
Alignment:
237 attccctcaaaacattcccccatccaaacacactctaaa 275  Q
    |||||||||||||||||||| ||| ||||||||||||||    
17502286 attccctcaaaacattccccaatcaaaacacactctaaa 17502324  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #54
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 218 - 256
Target Start/End: Original strand, 52280972 - 52281010
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccc 256  Q
    ||||||||||||||||||| ||||||||||| |||||||    
52280972 aattccctcaaaacattactttccctcaaaagattcccc 52281010  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #55
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 218 - 267
Target Start/End: Original strand, 28745901 - 28745950
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacac 267  Q
    ||||||||||||| |||||||||||| |||| |||| | |||||||||||    
28745901 aattccctcaaaatattacattcccttaaaatattctctcatccaaacac 28745950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #56
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 237 - 274
Target Start/End: Complemental strand, 34007393 - 34007356
Alignment:
237 attccctcaaaacattcccccatccaaacacactctaa 274  Q
    |||||||||||| ||| |||||||||||||||||||||    
34007393 attccctcaaaatatttccccatccaaacacactctaa 34007356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 58; Significance: 3e-24; HSPs: 51)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 218 - 275
Target Start/End: Original strand, 49111417 - 49111474
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaaa 275  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49111417 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaaa 49111474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 218 - 275
Target Start/End: Complemental strand, 31473903 - 31473846
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaaa 275  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
31473903 aattccctcataacattacattccctcaaaacattcccccatccaaacacactctaaa 31473846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 218 - 274
Target Start/End: Original strand, 857344 - 857400
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 274  Q
    ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
857344 aattccctcaaaacattacattccctcaaaacatttccccatccaaacacactctaa 857400  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 218 - 274
Target Start/End: Complemental strand, 14982334 - 14982278
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 274  Q
    ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
14982334 aattccctcaaaacattacattccctcaaaacattcctccatccaaacacactctaa 14982278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 218 - 274
Target Start/End: Original strand, 15660288 - 15660344
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 274  Q
    |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
15660288 aattccctcaaaacattacattccctcaaaacattccctcatccaaacacactctaa 15660344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 218 - 274
Target Start/End: Complemental strand, 36455961 - 36455905
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 274  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
36455961 aattccctcaaaacattagattccctcaaaacattcccccatccaaacacactctaa 36455905  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 218 - 272
Target Start/End: Original strand, 7352917 - 7352971
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    ||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
7352917 aattccctcaaaacattacattccctcaaaacatttccccatccaaacacactct 7352971  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 218 - 271
Target Start/End: Complemental strand, 4441391 - 4441338
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactc 271  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
4441391 aattccctcaaaacattacattccctcaaaacattccaccatccaaacacactc 4441338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 218 - 275
Target Start/End: Complemental strand, 16516225 - 16516168
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaaa 275  Q
    |||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||    
16516225 aattccttcaaaacattacattccgtcaaaacattcccccatccaaacacactctaaa 16516168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 218 - 274
Target Start/End: Complemental strand, 2125911 - 2125855
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 274  Q
    ||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||    
2125911 aattccctcaaaacaatacattccctcaaaatattcccccatccaaacacactctaa 2125855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 218 - 274
Target Start/End: Complemental strand, 4896702 - 4896646
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 274  Q
    |||||||||||||||||||||| |||||||| |||||||||||||||||||||||||    
4896702 aattccctcaaaacattacattacctcaaaatattcccccatccaaacacactctaa 4896646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 218 - 270
Target Start/End: Complemental strand, 7352866 - 7352814
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacact 270  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||||||||    
7352866 aattccatcaaaacattacattccctcaaaacattcccccatccaaacacact 7352814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 218 - 274
Target Start/End: Original strand, 10128079 - 10128135
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 274  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||    
10128079 aattccctcaaaacattacattctctcaaaacattcccccatccaaatacactctaa 10128135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 218 - 274
Target Start/End: Original strand, 11348342 - 11348398
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 274  Q
    |||||||||||||||||||||||||| |||||||||||||||||||| |||||||||    
11348342 aattccctcaaaacattacattcccttaaaacattcccccatccaaatacactctaa 11348398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 218 - 274
Target Start/End: Original strand, 28845976 - 28846032
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 274  Q
    |||||||||||||||||| |||||||||||||||| |||||||||||||||||||||    
28845976 aattccctcaaaacattatattccctcaaaacatttccccatccaaacacactctaa 28846032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 218 - 269
Target Start/End: Complemental strand, 10633086 - 10633035
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacac 269  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||    
10633086 aattccctcataacattacattccctcaaaacattcccccatccaaacacac 10633035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 218 - 272
Target Start/End: Complemental strand, 1112659 - 1112605
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    ||||||||| |||||||||||| ||||||||||||||||||||||||||||||||    
1112659 aattccctcgaaacattacatttcctcaaaacattcccccatccaaacacactct 1112605  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 218 - 275
Target Start/End: Original strand, 1107157 - 1107214
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaaa 275  Q
    |||||||||||||||||| |||||||||||| ||||||||||||||| ||||||||||    
1107157 aattccctcaaaacattatattccctcaaaatattcccccatccaaatacactctaaa 1107214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 223 - 272
Target Start/End: Original strand, 31742874 - 31742923
Alignment:
223 cctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||    
31742874 cctcaaaacattacattccctcaaaacattcctccatccaaacacactct 31742923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 218 - 270
Target Start/End: Original strand, 4896737 - 4896789
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacact 270  Q
    ||||||||||||||||||||||||||||||| ||| |||||||||||||||||    
4896737 aattccctcaaaacattacattccctcaaaatatttccccatccaaacacact 4896789  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 218 - 264
Target Start/End: Complemental strand, 1539695 - 1539649
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaa 264  Q
    ||||||||||||||||||||||||||||||||||||| |||||||||    
1539695 aattccctcaaaacattacattccctcaaaacattcctccatccaaa 1539649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 218 - 272
Target Start/End: Complemental strand, 15660237 - 15660183
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    |||||||||||||||||||||| |||||||| ||||||| |||||||||||||||    
15660237 aattccctcaaaacattacattacctcaaaatattcccctatccaaacacactct 15660183  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 218 - 272
Target Start/End: Original strand, 36456031 - 36456085
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    |||| |||||||| ||||||||||||||||||||||| |||||||||||||||||    
36456031 aatttcctcaaaatattacattccctcaaaacattcctccatccaaacacactct 36456085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 218 - 272
Target Start/End: Original strand, 41498595 - 41498649
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    |||||| |||||||||||||||||||||||| ||||| |||||||||||||||||    
41498595 aattccttcaaaacattacattccctcaaaatattcctccatccaaacacactct 41498649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 218 - 267
Target Start/End: Complemental strand, 28845925 - 28845876
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacac 267  Q
    ||||||||| ||||||||||||||||||||||||||| ||||||||||||    
28845925 aattccctcgaaacattacattccctcaaaacattcctccatccaaacac 28845876  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 225 - 270
Target Start/End: Original strand, 42542979 - 42543024
Alignment:
225 tcaaaacattacattccctcaaaacattcccccatccaaacacact 270  Q
    |||||||||||||||||||||||||||||| |||||||||||||||    
42542979 tcaaaacattacattccctcaaaacattccaccatccaaacacact 42543024  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 218 - 274
Target Start/End: Complemental strand, 5715798 - 5715742
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 274  Q
    |||| |||||||||||||||||  |||||||||||||| ||||||||||||||||||    
5715798 aattacctcaaaacattacattatctcaaaacattccctcatccaaacacactctaa 5715742  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 218 - 274
Target Start/End: Complemental strand, 11041021 - 11040966
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 274  Q
    ||||| ||||||||||||||||||||||||| ||| |||||||||||||||||||||    
11041021 aattctctcaaaacattacattccctcaaaatatt-ccccatccaaacacactctaa 11040966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 218 - 274
Target Start/End: Complemental strand, 35470176 - 35470120
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 274  Q
    ||||||||||||||| ||||||||||||||||||| | ||||| |||||||||||||    
35470176 aattccctcaaaacaatacattccctcaaaacatttcaccatctaaacacactctaa 35470120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 237 - 275
Target Start/End: Original strand, 26251015 - 26251053
Alignment:
237 attccctcaaaacattcccccatccaaacacactctaaa 275  Q
    |||||||||||||||||||||||||||||||||||||||    
26251015 attccctcaaaacattcccccatccaaacacactctaaa 26251053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 218 - 272
Target Start/End: Complemental strand, 42844597 - 42844543
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    |||||| |||||| ||||||||||||||||||||||||||||| | |||||||||    
42844597 aattccttcaaaatattacattccctcaaaacattcccccatctatacacactct 42844543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #32
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 220 - 270
Target Start/End: Original strand, 42844650 - 42844700
Alignment:
220 ttccctcaaaacattacattccctcaaaacattcccccatccaaacacact 270  Q
    |||||||||||||||||||| |||||||| ||| |||||||||||||||||    
42844650 ttccctcaaaacattacattacctcaaaatatttccccatccaaacacact 42844700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #33
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 218 - 275
Target Start/End: Original strand, 55266880 - 55266937
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaaa 275  Q
    ||||||||||||| |||| ||| |||||||||||||  ||||||||||||||||||||    
55266880 aattccctcaaaatattatatttcctcaaaacattcatccatccaaacacactctaaa 55266937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #34
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 218 - 274
Target Start/End: Original strand, 1112727 - 1112783
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 274  Q
    ||||||||| ||||||||||||  |||||||||| |||||||||||||| |||||||    
1112727 aattccctcgaaacattacatttgctcaaaacatccccccatccaaacaaactctaa 1112783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #35
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 218 - 270
Target Start/End: Complemental strand, 10128028 - 10127976
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacact 270  Q
    |||||| ||||||||||||||| | |||||| |||||||||||||||||||||    
10128028 aattccttcaaaacattacattacttcaaaatattcccccatccaaacacact 10127976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #36
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 218 - 270
Target Start/End: Complemental strand, 26250963 - 26250911
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacact 270  Q
    |||| ||||||||||||||||| |||||||| |||||| ||||||||||||||    
26250963 aatttcctcaaaacattacattacctcaaaatattccctcatccaaacacact 26250911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #37
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 223 - 274
Target Start/End: Original strand, 467912 - 467962
Alignment:
223 cctcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 274  Q
    ||||||||||||||||||| |||||||||| | |||||||||||||||||||    
467912 cctcaaaacattacattccatcaaaacatt-ctccatccaaacacactctaa 467962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #38
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 218 - 275
Target Start/End: Complemental strand, 41498544 - 41498486
Alignment:
218 aattccctcaaaa-cattacattccctcaaaacattcccccatccaaacacactctaaa 275  Q
    ||||||||||||| |||||  ||| ||||||||| ||||||||||||||||||||||||    
41498544 aattccctcaaaaacattattttctctcaaaacaatcccccatccaaacacactctaaa 41498486  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #39
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 237 - 270
Target Start/End: Complemental strand, 42775658 - 42775625
Alignment:
237 attccctcaaaacattcccccatccaaacacact 270  Q
    ||||||||||||||||||||||||||||||||||    
42775658 attccctcaaaacattcccccatccaaacacact 42775625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #40
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 237 - 274
Target Start/End: Original strand, 53760810 - 53760847
Alignment:
237 attccctcaaaacattcccccatccaaacacactctaa 274  Q
    ||||||||||||||||||||||| ||||||||||||||    
53760810 attccctcaaaacattcccccattcaaacacactctaa 53760847  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #41
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 218 - 270
Target Start/End: Complemental strand, 31742830 - 31742778
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacact 270  Q
    |||||||||||||||||||| | ||| |||| ||||| |||||||||||||||    
31742830 aattccctcaaaacattacactaccttaaaatattcctccatccaaacacact 31742778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #42
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 237 - 273
Target Start/End: Complemental strand, 47108353 - 47108317
Alignment:
237 attccctcaaaacattcccccatccaaacacactcta 273  Q
    ||||||||||||||||||| |||||||||||||||||    
47108353 attccctcaaaacattccctcatccaaacacactcta 47108317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #43
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 237 - 272
Target Start/End: Original strand, 14982385 - 14982420
Alignment:
237 attccctcaaaacattcccccatccaaacacactct 272  Q
    |||||||||||| |||||||||||||||||||||||    
14982385 attccctcaaaagattcccccatccaaacacactct 14982420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #44
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 241 - 271
Target Start/End: Original strand, 4441438 - 4441468
Alignment:
241 cctcaaaacattcccccatccaaacacactc 271  Q
    |||||||||||||||||||||||||||||||    
4441438 cctcaaaacattcccccatccaaacacactc 4441468  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #45
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 218 - 272
Target Start/End: Complemental strand, 52493978 - 52493926
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    |||||||||||| ||||||||| | |||||||||| |||||||||||||||||||    
52493978 aattccctcaaa-cattacattacttcaaaacatt-ccccatccaaacacactct 52493926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #46
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 237 - 275
Target Start/End: Complemental strand, 56339186 - 56339148
Alignment:
237 attccctcaaaacattcccccatccaaacacactctaaa 275  Q
    ||||||||||||||||||  |||||||||||||||||||    
56339186 attccctcaaaacattccatcatccaaacacactctaaa 56339148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #47
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 241 - 274
Target Start/End: Complemental strand, 32724961 - 32724928
Alignment:
241 cctcaaaacattcccccatccaaacacactctaa 274  Q
    ||||||||||||||||||| ||||||||||||||    
32724961 cctcaaaacattcccccattcaaacacactctaa 32724928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #48
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 237 - 270
Target Start/End: Original strand, 46243115 - 46243148
Alignment:
237 attccctcaaaacattcccccatccaaacacact 270  Q
    |||| |||||||||||||||||||||||||||||    
46243115 attctctcaaaacattcccccatccaaacacact 46243148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #49
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 237 - 270
Target Start/End: Original strand, 52295065 - 52295098
Alignment:
237 attccctcaaaacattcccccatccaaacacact 270  Q
    |||||||| |||||||||||||||||||||||||    
52295065 attccctcgaaacattcccccatccaaacacact 52295098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #50
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 218 - 270
Target Start/End: Original strand, 19461755 - 19461807
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacact 270  Q
    ||||| |||||||||||||||| | |||||| ||| ||||||||||| |||||    
19461755 aattcgctcaaaacattacattacttcaaaatatttccccatccaaaaacact 19461807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #51
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 224 - 272
Target Start/End: Complemental strand, 42776685 - 42776637
Alignment:
224 ctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    |||||||||||||||  ||| |||||||||  |||||||||||||||||    
42776685 ctcaaaacattacataacctaaaaacattcttccatccaaacacactct 42776637  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 58; Significance: 3e-24; HSPs: 51)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 218 - 275
Target Start/End: Original strand, 46672821 - 46672878
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaaa 275  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46672821 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaaa 46672878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 218 - 272
Target Start/End: Complemental strand, 49457397 - 49457343
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49457397 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 49457343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 218 - 274
Target Start/End: Original strand, 36398007 - 36398063
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 274  Q
    ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
36398007 aattccctcaaaacaatacattccctcaaaacattcccccatccaaacacactctaa 36398063  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 218 - 274
Target Start/End: Complemental strand, 44692876 - 44692820
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 274  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
44692876 aattccctcaaaacattactttccctcaaaacattcccccatccaaacacactctaa 44692820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 218 - 274
Target Start/End: Complemental strand, 47767486 - 47767430
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 274  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
47767486 aattccttcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 47767430  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 218 - 277
Target Start/End: Original strand, 9129449 - 9129508
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaaatg 277  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||    
9129449 aattccctcaaaacattacattccctcaaaacattccctcatccaaacacactcttaatg 9129508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 218 - 277
Target Start/End: Original strand, 9137556 - 9137615
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaaatg 277  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||    
9137556 aattccctcaaaacattacattccctcaaaacattccctcatccaaacacactcttaatg 9137615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 218 - 272
Target Start/End: Original strand, 27251999 - 27252053
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    |||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
27251999 aattccctcaaaacattacattccctcaaaacatccccccatccaaacacactct 27252053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 218 - 272
Target Start/End: Original strand, 42005971 - 42006025
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
42005971 aattccttcaaaacattacattccctcaaaacattcccccatccaaacacactct 42006025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 218 - 272
Target Start/End: Complemental strand, 44436312 - 44436258
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
44436312 aatttcctcaaaacattacattccctcaaaacattcccccatccaaacacactct 44436258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 218 - 272
Target Start/End: Original strand, 44692927 - 44692981
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    ||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
44692927 aattccctcaaaacattacattccctcaaaacattcctccatccaaacacactct 44692981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 218 - 274
Target Start/End: Complemental strand, 37054448 - 37054392
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 274  Q
    |||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||    
37054448 aattccttcaaaacattacattcccttaaaacattcccccatccaaacacactctaa 37054392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 218 - 272
Target Start/End: Complemental strand, 5415837 - 5415783
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    ||||||||||||||||||||||||||||||| ||||||| |||||||||||||||    
5415837 aattccctcaaaacattacattccctcaaaatattcccctatccaaacacactct 5415783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 218 - 268
Target Start/End: Original strand, 21307550 - 21307600
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacaca 268  Q
    ||||||||||||||||||||||||| |||||||||||||||||||||||||    
21307550 aattccctcaaaacattacattcccgcaaaacattcccccatccaaacaca 21307600  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 218 - 268
Target Start/End: Original strand, 35279920 - 35279970
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacaca 268  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||    
35279920 aattcactcaaaacattacattccctcaaaacattcccccatccaaacaca 35279970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 218 - 274
Target Start/End: Complemental strand, 28092268 - 28092212
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 274  Q
    |||||||||||||||| ||||| |||||||||||||||||||||||||| |||||||    
28092268 aattccctcaaaacatcacatttcctcaaaacattcccccatccaaacatactctaa 28092212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 218 - 272
Target Start/End: Original strand, 671637 - 671691
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    ||||||||||||||| ||||||||||||||||||||||| ||||||| |||||||    
671637 aattccctcaaaacaatacattccctcaaaacattcccctatccaaaaacactct 671691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 218 - 272
Target Start/End: Original strand, 5415888 - 5415942
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    |||||| |||||||||||| ||||||||||| |||||||||||||||||||||||    
5415888 aattccatcaaaacattactttccctcaaaatattcccccatccaaacacactct 5415942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 218 - 272
Target Start/End: Complemental strand, 7302400 - 7302346
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    |||||| |||||||||||||||| |||||||||||||| ||||||||||||||||    
7302400 aattccttcaaaacattacattctctcaaaacattccctcatccaaacacactct 7302346  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 218 - 272
Target Start/End: Complemental strand, 34088625 - 34088571
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    ||||||||||||||| ||||||||||||||||||| | |||||||||||||||||    
34088625 aattccctcaaaacaatacattccctcaaaacatttctccatccaaacacactct 34088571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 218 - 272
Target Start/End: Original strand, 53129861 - 53129915
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    |||||||| |||||||||||||||||| |||||||||| ||||||||||||||||    
53129861 aattcccttaaaacattacattccctcgaaacattccctcatccaaacacactct 53129915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 218 - 274
Target Start/End: Original strand, 46429501 - 46429557
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 274  Q
    |||||| ||||||||||||||| |||||||| |||||| ||||||||||||||||||    
46429501 aattccttcaaaacattacattacctcaaaatattccctcatccaaacacactctaa 46429557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 218 - 274
Target Start/End: Original strand, 47284331 - 47284387
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 274  Q
    |||||||||||||||||||||| |||||||| |||| | ||||||||||||||||||    
47284331 aattccctcaaaacattacattacctcaaaatattctctcatccaaacacactctaa 47284387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 218 - 274
Target Start/End: Complemental strand, 48947659 - 48947603
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 274  Q
    ||||| ||||||||| ||||||||||||||||||||  |||||||||||||||||||    
48947659 aattctctcaaaacaatacattccctcaaaacattcttccatccaaacacactctaa 48947603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 218 - 274
Target Start/End: Original strand, 53470447 - 53470503
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 274  Q
    ||||||||||||||| || |||||||||||||||| || ||||||||||||||||||    
53470447 aattccctcaaaacaatagattccctcaaaacatttcctcatccaaacacactctaa 53470503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 218 - 272
Target Start/End: Complemental strand, 9129398 - 9129344
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    |||||| |||||||||||||||||||||||| | || ||||||||||||||||||    
9129398 aattccatcaaaacattacattccctcaaaatagtctcccatccaaacacactct 9129344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 218 - 272
Target Start/End: Complemental strand, 9137505 - 9137451
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    |||||| |||||||||||||||||||||||| | || ||||||||||||||||||    
9137505 aattccatcaaaacattacattccctcaaaatagtctcccatccaaacacactct 9137451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 218 - 256
Target Start/End: Complemental strand, 31070460 - 31070422
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccc 256  Q
    |||||||||||||||||||||||||||||||||||||||    
31070460 aattccctcaaaacattacattccctcaaaacattcccc 31070422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 218 - 272
Target Start/End: Complemental strand, 46001418 - 46001364
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    ||||||||| |||||||||||| |||||||| ||||| |||||||||||||||||    
46001418 aattccctcgaaacattacattacctcaaaatattccgccatccaaacacactct 46001364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 218 - 275
Target Start/End: Original strand, 31189415 - 31189472
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaaa 275  Q
    ||||| |||||||||||||||| ||||||||||||| | ||| |||||||||||||||    
31189415 aattctctcaaaacattacattacctcaaaacattctctcattcaaacacactctaaa 31189472  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 218 - 275
Target Start/End: Complemental strand, 37321604 - 37321547
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaaa 275  Q
    |||| |||||||||||||| || |||||||| ||||||||||||||| ||||||||||    
37321604 aatttcctcaaaacattacttttcctcaaaatattcccccatccaaatacactctaaa 37321547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #32
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 237 - 274
Target Start/End: Complemental strand, 46429449 - 46429412
Alignment:
237 attccctcaaaacattcccccatccaaacacactctaa 274  Q
    ||||||||||||||||||||||||||||||||||||||    
46429449 attccctcaaaacattcccccatccaaacacactctaa 46429412  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #33
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 218 - 274
Target Start/End: Complemental strand, 30767158 - 30767102
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 274  Q
    |||||| ||| ||||||| |||||||||||||||| ||||||||||| |||||||||    
30767158 aattccttcataacattagattccctcaaaacattaccccatccaaatacactctaa 30767102  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #34
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 218 - 274
Target Start/End: Complemental strand, 39110448 - 39110392
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 274  Q
    ||||||| ||||||||||||||| ||||||||||| |  ||||||||||||||||||    
39110448 aattcccacaaaacattacattcgctcaaaacatttcttcatccaaacacactctaa 39110392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #35
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 218 - 270
Target Start/End: Complemental strand, 42130746 - 42130694
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacact 270  Q
    |||||||||||||||||||||  |||||||| ||||||||| |||||||||||    
42130746 aattccctcaaaacattacatcacctcaaaatattcccccacccaaacacact 42130694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #36
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 228 - 275
Target Start/End: Complemental strand, 2732683 - 2732636
Alignment:
228 aaacattacattccctcaaaacattcccccatccaaacacactctaaa 275  Q
    |||||||| ||| |||||||||||| ||||||||||||||||||||||    
2732683 aaacattatattacctcaaaacatttccccatccaaacacactctaaa 2732636  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #37
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 218 - 264
Target Start/End: Complemental strand, 19475870 - 19475824
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaa 264  Q
    |||| ||||| |||||||||||||||||||||||||| |||||||||    
19475870 aattacctcataacattacattccctcaaaacattcctccatccaaa 19475824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #38
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 218 - 276
Target Start/End: Complemental strand, 46635911 - 46635853
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaaat 276  Q
    |||| |||||||||||||||||  |||||||||||  | ||||||||||||||||||||    
46635911 aatttcctcaaaacattacattagctcaaaacattttctcatccaaacacactctaaat 46635853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #39
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 237 - 274
Target Start/End: Complemental strand, 25655350 - 25655313
Alignment:
237 attccctcaaaacattcccccatccaaacacactctaa 274  Q
    |||||||||||||||| |||||||||||||||||||||    
25655350 attccctcaaaacatttccccatccaaacacactctaa 25655313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #40
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 237 - 270
Target Start/End: Complemental strand, 27485507 - 27485474
Alignment:
237 attccctcaaaacattcccccatccaaacacact 270  Q
    ||||||||||||||||||||||||||||||||||    
27485507 attccctcaaaacattcccccatccaaacacact 27485474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #41
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 218 - 254
Target Start/End: Complemental strand, 30766607 - 30766571
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcc 254  Q
    |||||| ||||||||||||||||||||||||||||||    
30766607 aattccttcaaaacattacattccctcaaaacattcc 30766571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #42
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 218 - 274
Target Start/End: Original strand, 31070511 - 31070567
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 274  Q
    |||||||||||||||||||||| |||||||| |||| || || |||||| |||||||    
31070511 aattccctcaaaacattacattacctcaaaatattctccaattcaaacatactctaa 31070567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #43
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 218 - 266
Target Start/End: Original strand, 44288477 - 44288525
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaaca 266  Q
    |||||| ||||||||||| ||| |||||||||||||| |||||||||||    
44288477 aattccatcaaaacattatattacctcaaaacattcctccatccaaaca 44288525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #44
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 229 - 269
Target Start/End: Complemental strand, 52527079 - 52527039
Alignment:
229 aacattacattccctcaaaacattcccccatccaaacacac 269  Q
    |||||||||| || |||||||||||||||||||||||||||    
52527079 aacattacatcccttcaaaacattcccccatccaaacacac 52527039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #45
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 237 - 272
Target Start/End: Original strand, 37321622 - 37321657
Alignment:
237 attccctcaaaacattcccccatccaaacacactct 272  Q
    |||||||||||||||||||| |||||||||||||||    
37321622 attccctcaaaacattccccaatccaaacacactct 37321657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #46
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 237 - 272
Target Start/End: Original strand, 54761583 - 54761618
Alignment:
237 attccctcaaaacattcccccatccaaacacactct 272  Q
    |||||||||||||||||| |||||||||||||||||    
54761583 attccctcaaaacattcctccatccaaacacactct 54761618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #47
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 243 - 272
Target Start/End: Original strand, 9007480 - 9007509
Alignment:
243 tcaaaacattcccccatccaaacacactct 272  Q
    ||||||||||||||||||||||||||||||    
9007480 tcaaaacattcccccatccaaacacactct 9007509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #48
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 237 - 274
Target Start/End: Complemental strand, 27251947 - 27251910
Alignment:
237 attccctcaaaacattcccccatccaaacacactctaa 274  Q
    ||||||| |||||||||||||||||||||||| |||||    
27251947 attcccttaaaacattcccccatccaaacacattctaa 27251910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #49
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 237 - 274
Target Start/End: Original strand, 47284222 - 47284259
Alignment:
237 attccctcaaaacattcccccatccaaacacactctaa 274  Q
    |||||||||||| |||||| ||||||||||||||||||    
47284222 attccctcaaaatattccctcatccaaacacactctaa 47284259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #50
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 224 - 268
Target Start/End: Complemental strand, 47336929 - 47336885
Alignment:
224 ctcaaaacattacattccctcaaaacattcccccatccaaacaca 268  Q
    |||||||||||||||| ||| |||||||| ||||||||| |||||    
47336929 ctcaaaacattacattaccttaaaacatttccccatccacacaca 47336885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #51
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 223 - 255
Target Start/End: Original strand, 50168633 - 50168665
Alignment:
223 cctcaaaacattacattccctcaaaacattccc 255  Q
    ||||||||||||||||| |||||||||||||||    
50168633 cctcaaaacattacattacctcaaaacattccc 50168665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 57; Significance: 1e-23; HSPs: 20)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 218 - 274
Target Start/End: Complemental strand, 9285701 - 9285645
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 274  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9285701 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 9285645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 218 - 274
Target Start/End: Original strand, 34244999 - 34245055
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 274  Q
    ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
34244999 aattccctcaaaacattacattccctcaaaacattcctccatccaaacacactctaa 34245055  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 218 - 272
Target Start/End: Original strand, 6919812 - 6919866
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
6919812 aattccctcaaaacattactttccctcaaaacattcccccatccaaacacactct 6919866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 218 - 274
Target Start/End: Complemental strand, 8574749 - 8574693
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 274  Q
    ||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||    
8574749 aattccctcaaaacattacattcactcaaaacatttccccatccaaacacactctaa 8574693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 218 - 274
Target Start/End: Original strand, 29889453 - 29889509
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 274  Q
    |||||||||||||||||||||||| |||||||||||| |||||||||||||||||||    
29889453 aattccctcaaaacattacattccatcaaaacattcctccatccaaacacactctaa 29889509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 218 - 272
Target Start/End: Original strand, 8574770 - 8574824
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    ||||||||||||||||||||||| ||||||||||| |||||||||||||||||||    
8574770 aattccctcaaaacattacattcactcaaaacatttccccatccaaacacactct 8574824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 218 - 275
Target Start/End: Complemental strand, 13487329 - 13487272
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaaa 275  Q
    |||||||||| |||| ||||||||||||||||||||||||||| ||||||||||||||    
13487329 aattccctcataacactacattccctcaaaacattcccccatctaaacacactctaaa 13487272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 218 - 270
Target Start/End: Complemental strand, 6919762 - 6919710
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacact 270  Q
    |||||||||||||||||||||||||||||| |||||| |||||||||||||||    
6919762 aattccctcaaaacattacattccctcaaaccattcctccatccaaacacact 6919710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 218 - 270
Target Start/End: Complemental strand, 9763066 - 9763014
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacact 270  Q
    ||||||||||||||||||||||||||||||||||| |||| ||||||||||||    
9763066 aattccctcaaaacattacattccctcaaaacatttccccttccaaacacact 9763014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 232 - 275
Target Start/End: Complemental strand, 33733472 - 33733429
Alignment:
232 attacattccctcaaaacattcccccatccaaacacactctaaa 275  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
33733472 attacattccctcaaaacattcccccatccaaacacactctaaa 33733429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 218 - 272
Target Start/End: Original strand, 9763117 - 9763171
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    |||||||||||||||||||||| |||||||| ||||| |||||||||||||||||    
9763117 aattccctcaaaacattacattacctcaaaatattcctccatccaaacacactct 9763171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 218 - 272
Target Start/End: Complemental strand, 28918219 - 28918165
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    |||| ||| |||||||||||||||||||||||||||| |||||||||||||||||    
28918219 aatttccttaaaacattacattccctcaaaacattcctccatccaaacacactct 28918165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 218 - 275
Target Start/End: Original strand, 15299530 - 15299586
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaaa 275  Q
    |||||| |||||||||||||||||||||||||||| ||||||||||||||| ||||||    
15299530 aattccttcaaaacattacattccctcaaaacatt-ccccatccaaacacattctaaa 15299586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 218 - 274
Target Start/End: Complemental strand, 776134 - 776078
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 274  Q
    |||| |||||||||||||||||||||||||||||| | ||||| |||||||||||||    
776134 aatttcctcaaaacattacattccctcaaaacatttctccatctaaacacactctaa 776078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 218 - 274
Target Start/End: Complemental strand, 1368531 - 1368475
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 274  Q
    |||||||| |||| ||||||||| ||||||||||||| |||||||||||||||||||    
1368531 aattcccttaaaatattacattctctcaaaacattcctccatccaaacacactctaa 1368475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 218 - 272
Target Start/End: Original strand, 776185 - 776239
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    |||| ||||||||||||||||||||||||||||||  || |||||||||||||||    
776185 aatttcctcaaaacattacattccctcaaaacattttcctatccaaacacactct 776239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 239 - 272
Target Start/End: Complemental strand, 1195384 - 1195351
Alignment:
239 tccctcaaaacattcccccatccaaacacactct 272  Q
    ||||||||||||||||||||||||||||||||||    
1195384 tccctcaaaacattcccccatccaaacacactct 1195351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 237 - 272
Target Start/End: Complemental strand, 8475214 - 8475179
Alignment:
237 attccctcaaaacattcccccatccaaacacactct 272  Q
    |||||||||||||||| |||||||||||||||||||    
8475214 attccctcaaaacatttccccatccaaacacactct 8475179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 218 - 268
Target Start/End: Complemental strand, 15832520 - 15832470
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacaca 268  Q
    |||||||| ||||||||||||||| || ||||||| || ||||||||||||    
15832520 aattcccttaaaacattacattccttcgaaacattacctcatccaaacaca 15832470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 218 - 259
Target Start/End: Complemental strand, 15299453 - 15299412
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccat 259  Q
    ||||| ||||||||||||||||| ||||||||||||| ||||    
15299453 aattctctcaaaacattacattcgctcaaaacattcctccat 15299412  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 57; Significance: 1e-23; HSPs: 47)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 218 - 274
Target Start/End: Original strand, 41461620 - 41461676
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 274  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41461620 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 41461676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 218 - 272
Target Start/End: Complemental strand, 14365754 - 14365700
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14365754 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 14365700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 218 - 274
Target Start/End: Original strand, 14365804 - 14365860
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 274  Q
    ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
14365804 aattccctcaaaacattacattccctcaaaacattcctccatccaaacacactctaa 14365860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 218 - 268
Target Start/End: Complemental strand, 11684653 - 11684603
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacaca 268  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||    
11684653 aattccctcaaaacattacattccctcaaaacattcccccatccaaacaca 11684603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 218 - 272
Target Start/End: Complemental strand, 14537253 - 14537199
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
14537253 aattacctcaaaacattacattccctcaaaacattcccccatccaaacacactct 14537199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 218 - 272
Target Start/End: Complemental strand, 17180351 - 17180297
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    |||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
17180351 aattccctcaaaacattacattccctcaaaacattccctcatccaaacacactct 17180297  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 218 - 272
Target Start/End: Complemental strand, 27033544 - 27033490
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
27033544 aattccctcaaaacattacattctctcaaaacattcccccatccaaacacactct 27033490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 218 - 275
Target Start/End: Original strand, 784898 - 784955
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaaa 275  Q
    |||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||    
784898 aattccctcaaaacattacattccatcaaaatattcccccatccaaacacactctaaa 784955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 218 - 274
Target Start/End: Original strand, 1583828 - 1583884
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 274  Q
    |||||||| |||||| |||||||||||||||||||||||||||||||||||||||||    
1583828 aattcccttaaaacaatacattccctcaaaacattcccccatccaaacacactctaa 1583884  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 218 - 274
Target Start/End: Complemental strand, 11716462 - 11716406
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 274  Q
    ||||||||||||||||||||||||||||||||||||  |||||||||||||||||||    
11716462 aattccctcaaaacattacattccctcaaaacattcttccatccaaacacactctaa 11716406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 218 - 272
Target Start/End: Complemental strand, 769090 - 769036
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    |||||||| |||||| |||||||||||||||||||||||||||||||||||||||    
769090 aattcccttaaaacaatacattccctcaaaacattcccccatccaaacacactct 769036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 218 - 272
Target Start/End: Complemental strand, 10480173 - 10480119
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    |||||||||  ||||||||||||||||||||||||||||||||||||||||||||    
10480173 aattccctcgtaacattacattccctcaaaacattcccccatccaaacacactct 10480119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 218 - 272
Target Start/End: Complemental strand, 11141359 - 11141305
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    |||||||| |||||| |||||||||||||||||||||||||||||||||||||||    
11141359 aattcccttaaaacaatacattccctcaaaacattcccccatccaaacacactct 11141305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 218 - 264
Target Start/End: Original strand, 11716504 - 11716550
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaa 264  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
11716504 aattccctcaaaacattacattccctcaaaacattcccccatccaaa 11716550  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 218 - 272
Target Start/End: Original strand, 33189276 - 33189330
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    |||||||| |||||| |||||||||||||||||||||||||||||||||||||||    
33189276 aattcccttaaaacaatacattccctcaaaacattcccccatccaaacacactct 33189330  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 218 - 270
Target Start/End: Original strand, 11532272 - 11532324
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacact 270  Q
    ||||||||||||||||||||||||||| ||| |||||||||||||||||||||    
11532272 aattccctcaaaacattacattccctccaaatattcccccatccaaacacact 11532324  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 218 - 270
Target Start/End: Complemental strand, 11793949 - 11793897
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacact 270  Q
    |||||||||| |||||||||||||||||||| |||||||||||||||||||||    
11793949 aattccctcataacattacattccctcaaaatattcccccatccaaacacact 11793897  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 218 - 274
Target Start/End: Original strand, 35047698 - 35047754
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 274  Q
    |||||||| |||||| |||||| ||||||||||||||||||||||||||||||||||    
35047698 aattcccttaaaacaatacatttcctcaaaacattcccccatccaaacacactctaa 35047754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 218 - 274
Target Start/End: Original strand, 45094490 - 45094546
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 274  Q
    |||||||||||||||||| ||||||||||||||||||| ||| ||||||||||||||    
45094490 aattccctcaaaacattatattccctcaaaacattccctcattcaaacacactctaa 45094546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 218 - 269
Target Start/End: Complemental strand, 28740650 - 28740599
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacac 269  Q
    ||||||||||||||||||||||||||||||||||| |||||| |||||||||    
28740650 aattccctcaaaacattacattccctcaaaacatttccccattcaaacacac 28740599  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 218 - 272
Target Start/End: Original strand, 7228031 - 7228085
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    |||||| |||||||||||||||| ||||||||||| |||||||||||||||||||    
7228031 aattccttcaaaacattacattctctcaaaacatttccccatccaaacacactct 7228085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 218 - 264
Target Start/End: Complemental strand, 30698335 - 30698289
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaa 264  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||    
30698335 aattccttcaaaacattacattccctcaaaacattcccccatccaaa 30698289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 218 - 274
Target Start/End: Complemental strand, 10244231 - 10244175
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 274  Q
    ||||||||||||||||||| |||||||| || |||| ||||||||||||||||||||    
10244231 aattccctcaaaacattactttccctcagaatattctcccatccaaacacactctaa 10244175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 218 - 274
Target Start/End: Complemental strand, 13017833 - 13017777
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 274  Q
    |||||||| |||| ||||||||||||||||||||| || ||||||||||||||||||    
13017833 aattcccttaaaatattacattccctcaaaacatttccacatccaaacacactctaa 13017777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 218 - 270
Target Start/End: Complemental strand, 41461569 - 41461517
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacact 270  Q
    |||||||||||||||||||||| |||||||| ||| |||||||||||||||||    
41461569 aattccctcaaaacattacattacctcaaaatatttccccatccaaacacact 41461517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #26
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 218 - 272
Target Start/End: Complemental strand, 784847 - 784793
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    |||||| ||||||||||||||||||||||||||||   |||||||||||||||||    
784847 aattccttcaaaacattacattccctcaaaacatttttccatccaaacacactct 784793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #27
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 218 - 272
Target Start/End: Complemental strand, 3092336 - 3092282
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    |||| |||||||||| ||||||||||||||||||||| ||||||||| |||||||    
3092336 aatttcctcaaaacaatacattccctcaaaacattcctccatccaaatacactct 3092282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #28
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 218 - 272
Target Start/End: Complemental strand, 39630279 - 39630225
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    ||||||||||||||| ||||||||||||||||||| | |||| ||||||||||||    
39630279 aattccctcaaaacaatacattccctcaaaacatttctccattcaaacacactct 39630225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #29
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 237 - 274
Target Start/End: Original strand, 14537305 - 14537342
Alignment:
237 attccctcaaaacattcccccatccaaacacactctaa 274  Q
    ||||||||||||||||||||||||||||||||||||||    
14537305 attccctcaaaacattcccccatccaaacacactctaa 14537342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #30
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 218 - 270
Target Start/End: Original strand, 44256212 - 44256263
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacact 270  Q
    |||||||||||||||||||||| |||| ||| |||||||||||||||||||||    
44256212 aattccctcaaaacattacattacctc-aaatattcccccatccaaacacact 44256263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #31
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 218 - 272
Target Start/End: Complemental strand, 17905708 - 17905654
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    |||||| | |||||||||||||| |||||||||||||| ||||| ||||||||||    
17905708 aattcctttaaaacattacattctctcaaaacattccctcatcctaacacactct 17905654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #32
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 237 - 270
Target Start/End: Complemental strand, 3345798 - 3345765
Alignment:
237 attccctcaaaacattcccccatccaaacacact 270  Q
    ||||||||||||||||||||||||||||||||||    
3345798 attccctcaaaacattcccccatccaaacacact 3345765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #33
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 237 - 274
Target Start/End: Original strand, 8736461 - 8736498
Alignment:
237 attccctcaaaacattcccccatccaaacacactctaa 274  Q
    ||||||||||||||||||| ||||||||||||||||||    
8736461 attccctcaaaacattccctcatccaaacacactctaa 8736498  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #34
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 237 - 270
Target Start/End: Original strand, 11824786 - 11824819
Alignment:
237 attccctcaaaacattcccccatccaaacacact 270  Q
    ||||||||||||||||||||||||||||||||||    
11824786 attccctcaaaacattcccccatccaaacacact 11824819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #35
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 237 - 274
Target Start/End: Complemental strand, 21504503 - 21504466
Alignment:
237 attccctcaaaacattcccccatccaaacacactctaa 274  Q
    |||||||||||||||||||| |||||||||||||||||    
21504503 attccctcaaaacattccccgatccaaacacactctaa 21504466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #36
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 218 - 271
Target Start/End: Original strand, 30751365 - 30751418
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactc 271  Q
    ||||| ||||||||||||||||  |||||||||||| | |||||||||||||||    
30751365 aattcactcaaaacattacattatctcaaaacattctctcatccaaacacactc 30751418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #37
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 218 - 274
Target Start/End: Complemental strand, 8735898 - 8735842
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 274  Q
    |||||||||  ||||||| |||||||||||||||   ||||||||||||||||||||    
8735898 aattccctcgtaacattatattccctcaaaacatgttcccatccaaacacactctaa 8735842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #38
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 237 - 272
Target Start/End: Original strand, 11684696 - 11684731
Alignment:
237 attccctcaaaacattcccccatccaaacacactct 272  Q
    |||||||||||||||||| |||||||||||||||||    
11684696 attccctcaaaacattcctccatccaaacacactct 11684731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #39
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 237 - 268
Target Start/End: Original strand, 19231305 - 19231336
Alignment:
237 attccctcaaaacattcccccatccaaacaca 268  Q
    ||||||||||||||||||||||||||||||||    
19231305 attccctcaaaacattcccccatccaaacaca 19231336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #40
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 218 - 272
Target Start/End: Complemental strand, 14954320 - 14954266
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    ||||| || |||| ||||||||| ||||||||||||| | |||||||||||||||    
14954320 aattctcttaaaagattacattcactcaaaacattcctctatccaaacacactct 14954266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #41
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 237 - 275
Target Start/End: Complemental strand, 20935759 - 20935722
Alignment:
237 attccctcaaaacattcccccatccaaacacactctaaa 275  Q
    |||||||||||||||||||| ||||||||||||||||||    
20935759 attccctcaaaacattcccc-atccaaacacactctaaa 20935722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #42
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 237 - 274
Target Start/End: Original strand, 3345852 - 3345889
Alignment:
237 attccctcaaaacattcccccatccaaacacactctaa 274  Q
    |||||||||||||||| |||||||||||||| ||||||    
3345852 attccctcaaaacatttccccatccaaacacgctctaa 3345889  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #43
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 237 - 270
Target Start/End: Complemental strand, 11595372 - 11595339
Alignment:
237 attccctcaaaacattcccccatccaaacacact 270  Q
    |||||||||||||||| |||||||||||||||||    
11595372 attccctcaaaacattaccccatccaaacacact 11595339  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #44
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 237 - 270
Target Start/End: Complemental strand, 11607274 - 11607241
Alignment:
237 attccctcaaaacattcccccatccaaacacact 270  Q
    |||||||||||||||| |||||||||||||||||    
11607274 attccctcaaaacattaccccatccaaacacact 11607241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #45
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 226 - 267
Target Start/End: Original strand, 39477976 - 39478017
Alignment:
226 caaaacattacattccctcaaaacattcccccatccaaacac 267  Q
    |||||||||||||| ||||||||||||| | |||||||||||    
39477976 caaaacattacattacctcaaaacattctcacatccaaacac 39478017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #46
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 218 - 275
Target Start/End: Complemental strand, 40026118 - 40026061
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaaa 275  Q
    |||| ||||||||||||| ||| |||||||| |||||||||| |||||| | ||||||    
40026118 aatttcctcaaaacattatattacctcaaaatattcccccattcaaacatattctaaa 40026061  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #47
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 237 - 270
Target Start/End: Original strand, 44205678 - 44205711
Alignment:
237 attccctcaaaacattcccccatccaaacacact 270  Q
    |||||||||||||||| |||||||||||||||||    
44205678 attccctcaaaacatttccccatccaaacacact 44205711  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 55; Significance: 2e-22; HSPs: 48)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 218 - 272
Target Start/End: Complemental strand, 40110791 - 40110737
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40110791 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 40110737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 218 - 272
Target Start/End: Complemental strand, 43955571 - 43955517
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43955571 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 43955517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 218 - 275
Target Start/End: Original strand, 43955619 - 43955676
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaaa 275  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
43955619 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactataaa 43955676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 218 - 274
Target Start/End: Original strand, 6498770 - 6498826
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 274  Q
    ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
6498770 aattccctcaaaacattacattccctcaaaacattcctccatccaaacacactctaa 6498826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 218 - 274
Target Start/End: Original strand, 26162142 - 26162198
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 274  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
26162142 aattccctcataacattacattccctcaaaacattcccccatccaaacacactctaa 26162198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 218 - 274
Target Start/End: Original strand, 28539173 - 28539229
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 274  Q
    ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
28539173 aattccctcaaaacaatacattccctcaaaacattcccccatccaaacacactctaa 28539229  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 223 - 274
Target Start/End: Original strand, 34398959 - 34399010
Alignment:
223 cctcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 274  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||    
34398959 cctcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 34399010  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 218 - 272
Target Start/End: Complemental strand, 2057449 - 2057395
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
2057449 aattccctcaaaacattacattcgctcaaaacattcccccatccaaacacactct 2057395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 218 - 272
Target Start/End: Complemental strand, 31632776 - 31632722
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
31632776 aattccctcataacattacattccctcaaaacattcccccatccaaacacactct 31632722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 218 - 275
Target Start/End: Complemental strand, 35455858 - 35455801
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaaa 275  Q
    |||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||    
35455858 aattcccttaaaacaatacattccctcaaaacattcccccatccaaacacactctaaa 35455801  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 218 - 274
Target Start/End: Original strand, 2057500 - 2057556
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 274  Q
    ||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||    
2057500 aattccctcaaaacattactttccctcaaaatattcccccatccaaacacactctaa 2057556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 218 - 274
Target Start/End: Original strand, 5644782 - 5644838
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 274  Q
    |||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||    
5644782 aattccctcaaaacattacattacctcaaaacgttcccccatccaaacacactctaa 5644838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 218 - 278
Target Start/End: Original strand, 23548616 - 23548676
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaaatgt 278  Q
    |||| |||||||||| ||||||||||||||||||||| |||||||||||||||||||||||    
23548616 aatttcctcaaaacaatacattccctcaaaacattcctccatccaaacacactctaaatgt 23548676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 218 - 281
Target Start/End: Complemental strand, 29065873 - 29065810
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaaatgtaat 281  Q
    ||||||||||||||||||||||||||||||||||||  ||||||||||||||||| || |||||    
29065873 aattccctcaaaacattacattccctcaaaacattcatccatccaaacacactcttaaggtaat 29065810  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 218 - 272
Target Start/End: Complemental strand, 5644731 - 5644677
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    ||||||||||||||||||||||||||||||||||||| |||| ||||||||||||    
5644731 aattccctcaaaacattacattccctcaaaacattcctccattcaaacacactct 5644677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 218 - 272
Target Start/End: Original strand, 14603267 - 14603321
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    |||||||| |||||| |||||||||||||||||||||||||||||||||||||||    
14603267 aattcccttaaaacaatacattccctcaaaacattcccccatccaaacacactct 14603321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 218 - 272
Target Start/End: Original strand, 35776960 - 35777014
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    |||||||||| ||||||||||||||||||||||||||| ||||||||||||||||    
35776960 aattccctcataacattacattccctcaaaacattccctcatccaaacacactct 35777014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 218 - 272
Target Start/End: Original strand, 39342647 - 39342701
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    |||||||| |||||| |||||||||||||||||||||||||||||||||||||||    
39342647 aattcccttaaaacaatacattccctcaaaacattcccccatccaaacacactct 39342701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 218 - 272
Target Start/End: Original strand, 40110843 - 40110897
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    ||||||||||||||||||||||||||| ||||||| |||||||||||||||||||    
40110843 aattccctcaaaacattacattccctcgaaacatttccccatccaaacacactct 40110897  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 218 - 271
Target Start/End: Original strand, 9784936 - 9784989
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactc 271  Q
    ||||||||||||||| ||||||||||||||||||||| ||||||||||||||||    
9784936 aattccctcaaaacaatacattccctcaaaacattcctccatccaaacacactc 9784989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 218 - 275
Target Start/End: Original strand, 29065924 - 29065981
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaaa 275  Q
    |||||||||||||||||||||| ||| |||||||||| ||||||||||||||||||||    
29065924 aattccctcaaaacattacattaccttaaaacattcctccatccaaacacactctaaa 29065981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 218 - 274
Target Start/End: Original strand, 23455252 - 23455308
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 274  Q
    ||||||||||||||| |||||||||||||||||||||| |||||||||||| |||||    
23455252 aattccctcaaaacaatacattccctcaaaacattccctcatccaaacacattctaa 23455308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 218 - 272
Target Start/End: Original strand, 25189231 - 25189285
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    ||||||||||||||||| |||| ||||||||||||||| ||||||||||||||||    
25189231 aattccctcaaaacattgcattacctcaaaacattcccacatccaaacacactct 25189285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 218 - 266
Target Start/End: Original strand, 21635990 - 21636038
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaaca 266  Q
    |||||| |||||||||||||||||||||||||||| |||||||||||||    
21635990 aattccttcaaaacattacattccctcaaaacatttccccatccaaaca 21636038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 218 - 274
Target Start/End: Original strand, 34388370 - 34388426
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 274  Q
    ||||||||||||| |||||||||||||||||||||||  ||| ||||||||||||||    
34388370 aattccctcaaaatattacattccctcaaaacattccatcattcaaacacactctaa 34388426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 218 - 272
Target Start/End: Original strand, 29639220 - 29639274
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    |||| ||||| ||||||||||||||| |||||||||||||||||| |||||||||    
29639220 aatttcctcataacattacattccctgaaaacattcccccatccatacacactct 29639274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 218 - 272
Target Start/End: Complemental strand, 30524309 - 30524255
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    |||||||||||||||||||||||| |||||||||| | ||||||| |||||||||    
30524309 aattccctcaaaacattacattccttcaaaacattactccatccatacacactct 30524255  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 218 - 268
Target Start/End: Complemental strand, 30629111 - 30629061
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacaca 268  Q
    ||||| || |||||| |||||||||||||||||||||||||||||||||||    
30629111 aattctcttaaaacaatacattccctcaaaacattcccccatccaaacaca 30629061  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 222 - 272
Target Start/End: Original strand, 40854079 - 40854129
Alignment:
222 ccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    ||||||||| |||||||||||||| |||||| |||||||||||||||||||    
40854079 ccctcaaaatattacattccctcagaacatttccccatccaaacacactct 40854129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #30
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 237 - 274
Target Start/End: Complemental strand, 40854022 - 40853985
Alignment:
237 attccctcaaaacattcccccatccaaacacactctaa 274  Q
    ||||||||||||||||||||||||||||||||||||||    
40854022 attccctcaaaacattcccccatccaaacacactctaa 40853985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #31
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 218 - 273
Target Start/End: Original strand, 18789251 - 18789306
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactcta 273  Q
    |||||||||| ||||||| |||| ||||||| ||||| ||||||||||||||||||    
18789251 aattccctcataacattatattctctcaaaatattcctccatccaaacacactcta 18789306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #32
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 225 - 272
Target Start/End: Complemental strand, 29195756 - 29195709
Alignment:
225 tcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    ||||||||||||||| |||||||| ||||| |||||||||||||||||    
29195756 tcaaaacattacattacctcaaaatattcctccatccaaacacactct 29195709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #33
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 237 - 272
Target Start/End: Complemental strand, 31913271 - 31913236
Alignment:
237 attccctcaaaacattcccccatccaaacacactct 272  Q
    ||||||||||||||||||||||||||||||||||||    
31913271 attccctcaaaacattcccccatccaaacacactct 31913236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #34
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 222 - 272
Target Start/End: Complemental strand, 21635935 - 21635885
Alignment:
222 ccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    |||||||||||||||||| |||||||| |||| ||||||||| ||||||||    
21635935 ccctcaaaacattacattacctcaaaatattctcccatccaagcacactct 21635885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #35
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 237 - 271
Target Start/End: Original strand, 30587909 - 30587943
Alignment:
237 attccctcaaaacattcccccatccaaacacactc 271  Q
    |||||||||||||||||||||||||||||||||||    
30587909 attccctcaaaacattcccccatccaaacacactc 30587943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #36
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 241 - 275
Target Start/End: Original strand, 31913309 - 31913343
Alignment:
241 cctcaaaacattcccccatccaaacacactctaaa 275  Q
    |||||||||||||||||||||||||||||||||||    
31913309 cctcaaaacattcccccatccaaacacactctaaa 31913343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #37
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 218 - 272
Target Start/End: Complemental strand, 44915249 - 44915195
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    |||||| |||||||||||| ||||||||||| |||| | ||||||||||||||||    
44915249 aattccttcaaaacattacgttccctcaaaaaattctctcatccaaacacactct 44915195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #38
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 237 - 274
Target Start/End: Original strand, 13815000 - 13815037
Alignment:
237 attccctcaaaacattcccccatccaaacacactctaa 274  Q
    |||||||||||||||||||| |||||||||||||||||    
13815000 attccctcaaaacattcccctatccaaacacactctaa 13815037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #39
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 218 - 263
Target Start/End: Original strand, 22351877 - 22351922
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaa 263  Q
    ||||| |||||||||||||||| || ||||||||||||||||||||    
22351877 aattctctcaaaacattacattaccccaaaacattcccccatccaa 22351922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #40
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 218 - 270
Target Start/End: Original strand, 22391592 - 22391644
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacact 270  Q
    ||||| |||||||||||||||||||||||||||||  | ||| ||||||||||    
22391592 aattctctcaaaacattacattccctcaaaacattatctcattcaaacacact 22391644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #41
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 241 - 272
Target Start/End: Original strand, 30080811 - 30080842
Alignment:
241 cctcaaaacattcccccatccaaacacactct 272  Q
    ||||||||||||||||||||||||||||||||    
30080811 cctcaaaacattcccccatccaaacacactct 30080842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #42
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 224 - 283
Target Start/End: Original strand, 46482056 - 46482115
Alignment:
224 ctcaaaacattacattccctcaaaacattcccccatccaaacacactctaaatgtaattt 283  Q
    |||||||||||||||||| |||| ||||| | |||| ||||||||||||||  |||||||    
46482056 ctcaaaacattacattccttcaacacatttctccattcaaacacactctaagagtaattt 46482115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #43
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 218 - 272
Target Start/End: Complemental strand, 34388319 - 34388265
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    ||||| |||| |||||||| || |||||||| ||| |||||||||||||||||||    
34388319 aattctctcagaacattacttttcctcaaaatatttccccatccaaacacactct 34388265  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #44
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 218 - 272
Target Start/End: Complemental strand, 49052839 - 49052786
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    ||||| |||||||||||||||||| ||||||||||  | ||||||||||||||||    
49052839 aattcactcaaaacattacattcc-tcaaaacattttctcatccaaacacactct 49052786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #45
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 221 - 270
Target Start/End: Original strand, 18926812 - 18926861
Alignment:
221 tccctcaaaacattacattccctcaaaacattcccccatccaaacacact 270  Q
    ||||||||||||||||||| ||||||||  | |||||||| |||||||||    
18926812 tccctcaaaacattacattacctcaaaatgtccccccatcaaaacacact 18926861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #46
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 237 - 274
Target Start/End: Complemental strand, 32650626 - 32650589
Alignment:
237 attccctcaaaacattcccccatccaaacacactctaa 274  Q
    |||||||||||||||||| ||||| |||||||||||||    
32650626 attccctcaaaacattcctccatcgaaacacactctaa 32650589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #47
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 237 - 274
Target Start/End: Complemental strand, 40667394 - 40667357
Alignment:
237 attccctcaaaacattcccccatccaaacacactctaa 274  Q
    ||||||||||||||||  ||||||||||||||||||||    
40667394 attccctcaaaacattttcccatccaaacacactctaa 40667357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #48
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 218 - 246
Target Start/End: Complemental strand, 43791144 - 43791116
Alignment:
218 aattccctcaaaacattacattccctcaa 246  Q
    |||||||||||||||||||||||||||||    
43791144 aattccctcaaaacattacattccctcaa 43791116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 55; Significance: 2e-22; HSPs: 56)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 218 - 272
Target Start/End: Original strand, 15374065 - 15374119
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15374065 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 15374119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 218 - 272
Target Start/End: Original strand, 40643922 - 40643976
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40643922 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 40643976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 218 - 275
Target Start/End: Complemental strand, 22767006 - 22766949
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaaa 275  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
22767006 aattccctcaaaacattatattccctcaaaacattcccccatccaaacacactctaaa 22766949  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 218 - 275
Target Start/End: Original strand, 26281285 - 26281342
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaaa 275  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
26281285 aattccctcaaaacattacattccctcaaaacgttcccccatccaaacacactctaaa 26281342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 218 - 270
Target Start/End: Original strand, 2721576 - 2721628
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacact 270  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||    
2721576 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacact 2721628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 218 - 274
Target Start/End: Original strand, 9764443 - 9764499
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 274  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
9764443 aattccctcaaaacattacattccctcgaaacattcccccatccaaacacactctaa 9764499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 218 - 274
Target Start/End: Original strand, 22303886 - 22303942
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 274  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
22303886 aattccttcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 22303942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 218 - 270
Target Start/End: Complemental strand, 28828421 - 28828369
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacact 270  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||    
28828421 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacact 28828369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 218 - 274
Target Start/End: Original strand, 37722910 - 37722966
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 274  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
37722910 aattccctcaaaacattacattccctcaaaatattcccccatccaaacacactctaa 37722966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 218 - 272
Target Start/End: Complemental strand, 2316432 - 2316378
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    ||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
2316432 aattccctcaaaatattacattccctcaaaacattcccccatccaaacacactct 2316378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 218 - 272
Target Start/End: Complemental strand, 15804376 - 15804322
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    ||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
15804376 aattccctcaaaacactacattccctcaaaacattcccccatccaaacacactct 15804322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 218 - 271
Target Start/End: Complemental strand, 3563331 - 3563278
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactc 271  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
3563331 aattccctcaaaacattacattccctcaaaacattcccctatccaaacacactc 3563278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 218 - 271
Target Start/End: Original strand, 20523238 - 20523291
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactc 271  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
20523238 aattccctcaaaacattacattctctcaaaacattcccccatccaaacacactc 20523291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 218 - 270
Target Start/End: Original strand, 15804399 - 15804451
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacact 270  Q
    ||||||||||||||||||||||||||||||||||| |||||||||||||||||    
15804399 aattccctcaaaacattacattccctcaaaacatttccccatccaaacacact 15804451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 218 - 272
Target Start/End: Complemental strand, 927356 - 927302
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    ||||||||||||||| ||||||||||||||||||| |||||||||||||||||||    
927356 aattccctcaaaacaatacattccctcaaaacatttccccatccaaacacactct 927302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 218 - 272
Target Start/End: Complemental strand, 9764392 - 9764338
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    ||||||||||||||||||| ||||||||||| |||||||||||||||||||||||    
9764392 aattccctcaaaacattactttccctcaaaatattcccccatccaaacacactct 9764338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 218 - 272
Target Start/End: Original strand, 25935306 - 25935360
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    |||| ||||| ||||||||||||||||||||||||||||||||||||||||||||    
25935306 aatttcctcataacattacattccctcaaaacattcccccatccaaacacactct 25935360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 218 - 272
Target Start/End: Original strand, 40090430 - 40090484
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    |||||| ||||||||||||||| ||||||||||||||||||||||||||||||||    
40090430 aattccatcaaaacattacatttcctcaaaacattcccccatccaaacacactct 40090484  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 218 - 272
Target Start/End: Original strand, 41762231 - 41762285
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    |||||||| |||||| |||||||||||||||||||||||||||||||||||||||    
41762231 aattcccttaaaacaatacattccctcaaaacattcccccatccaaacacactct 41762285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 218 - 274
Target Start/End: Complemental strand, 15374014 - 15373958
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 274  Q
    ||||||||||||||||||||||||||||||| ||||  |||||||||||||||||||    
15374014 aattccctcaaaacattacattccctcaaaaaattcttccatccaaacacactctaa 15373958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 218 - 270
Target Start/End: Original strand, 19533923 - 19533975
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacact 270  Q
    |||||||||| |||||||||||||||||||||||||| |||||||||||||||    
19533923 aattccctcataacattacattccctcaaaacattcctccatccaaacacact 19533975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 218 - 274
Target Start/End: Complemental strand, 20523187 - 20523131
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 274  Q
    |||||||||| || |||||||||||||||||||||| ||||||||||||||||||||    
20523187 aattccctcagaatattacattccctcaaaacattctcccatccaaacacactctaa 20523131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 221 - 272
Target Start/End: Original strand, 23092070 - 23092121
Alignment:
221 tccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    ||||||||||||||||||||  ||||||||||||||||||||||||||||||    
23092070 tccctcaaaacattacattcgttcaaaacattcccccatccaaacacactct 23092121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 224 - 271
Target Start/End: Original strand, 33245394 - 33245441
Alignment:
224 ctcaaaacattacattccctcaaaacattcccccatccaaacacactc 271  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||    
33245394 ctcaaaacattacattccatcaaaacattcccccatccaaacacactc 33245441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #25
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 218 - 272
Target Start/End: Complemental strand, 6634069 - 6634015
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    |||||||||||||||||||||| |||||||| || ||||||||||||||||||||    
6634069 aattccctcaaaacattacattacctcaaaatatccccccatccaaacacactct 6634015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #26
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 218 - 272
Target Start/End: Original strand, 16515123 - 16515177
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    |||||||||||||||||||||||||| ||||||||| | ||||||||||||||||    
16515123 aattccctcaaaacattacattccctaaaaacattctctcatccaaacacactct 16515177  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #27
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 218 - 272
Target Start/End: Original strand, 32250114 - 32250167
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    ||||||||||||||||||| ||||||||||||||| |||||||||||||||||||    
32250114 aattccctcaaaacattactttccctcaaaacatt-ccccatccaaacacactct 32250167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #28
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 218 - 272
Target Start/End: Complemental strand, 34982269 - 34982216
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    |||||||||||||||| |||||||||||||||||||||| |||||||||||||||    
34982269 aattccctcaaaacat-acattccctcaaaacattcccctatccaaacacactct 34982216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #29
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 218 - 272
Target Start/End: Complemental strand, 40809395 - 40809341
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    |||||||||||||||||| |||| ||||||||||| |||||||||||||||||||    
40809395 aattccctcaaaacattatattctctcaaaacatttccccatccaaacacactct 40809341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #30
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 218 - 272
Target Start/End: Complemental strand, 13243513 - 13243457
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatc--caaacacactct 272  Q
    |||||||||||||||||||||||||||||||||||||| ||||  ||||||||||||    
13243513 aattccctcaaaacattacattccctcaaaacattccctcatccacaaacacactct 13243457  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #31
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 223 - 275
Target Start/End: Original strand, 13243514 - 13243566
Alignment:
223 cctcaaaacattacattccctcaaaacattcccccatccaaacacactctaaa 275  Q
    ||||||||||||||||| |||||||| ||||||||||||||||||||| ||||    
13243514 cctcaaaacattacattacctcaaaatattcccccatccaaacacactataaa 13243566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #32
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 218 - 270
Target Start/End: Original strand, 28828452 - 28828504
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacact 270  Q
    |||||||||||||||||||||| |||||||| ||| |||||||||||||||||    
28828452 aattccctcaaaacattacattacctcaaaatatttccccatccaaacacact 28828504  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #33
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 218 - 270
Target Start/End: Complemental strand, 32390026 - 32389974
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacact 270  Q
    ||||||||||||| |||||||||| ||||||||||||| ||||||||||||||    
32390026 aattccctcaaaatattacattccttcaaaacattccctcatccaaacacact 32389974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #34
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 218 - 274
Target Start/End: Complemental strand, 35379397 - 35379342
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 274  Q
    ||||||||||||||||||||||  ||||||||||| |||||||||||||||||||||    
35379397 aattccctcaaaacattacattatctcaaaacatt-ccccatccaaacacactctaa 35379342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #35
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 218 - 270
Target Start/End: Original strand, 37145517 - 37145569
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacact 270  Q
    ||||| |||| ||||||||||||||||||||||||||||||||||||| ||||    
37145517 aattctctcataacattacattccctcaaaacattcccccatccaaacccact 37145569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #36
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 218 - 274
Target Start/End: Original strand, 40809446 - 40809502
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 274  Q
    ||||| ||||||||||||||||| ||||||||||| ||||||| |||||||||||||    
40809446 aattcactcaaaacattacattctctcaaaacatttccccatctaaacacactctaa 40809502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #37
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 229 - 268
Target Start/End: Original strand, 9894349 - 9894388
Alignment:
229 aacattacattccctcaaaacattcccccatccaaacaca 268  Q
    ||||||||||||||||||||||||||||||||||||||||    
9894349 aacattacattccctcaaaacattcccccatccaaacaca 9894388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #38
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 218 - 272
Target Start/End: Original strand, 32390077 - 32390131
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    ||||||||||||||||||||||||||||||| |||| |  |||||||||||||||    
32390077 aattccctcaaaacattacattccctcaaaaaattctctaatccaaacacactct 32390131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #39
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 218 - 272
Target Start/End: Complemental strand, 32470936 - 32470882
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    |||||| |||||||||||||||||||||||||||| | ||||||||| |||||||    
32470936 aattccttcaaaacattacattccctcaaaacatttctccatccaaatacactct 32470882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #40
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 218 - 275
Target Start/End: Original strand, 2316484 - 2316540
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaaa 275  Q
    ||||| |||||||||||||||||||||||||||||   ||||||||||||||||||||    
2316484 aattctctcaaaacattacattccctcaaaacatt-ttccatccaaacacactctaaa 2316540  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #41
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 227 - 272
Target Start/End: Complemental strand, 5658821 - 5658776
Alignment:
227 aaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    |||||||||||||||||||||||||| | |||||||||||||||||    
5658821 aaaacattacattccctcaaaacatttctccatccaaacacactct 5658776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #42
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 237 - 274
Target Start/End: Complemental strand, 33146096 - 33146059
Alignment:
237 attccctcaaaacattcccccatccaaacacactctaa 274  Q
    ||||||||||||||||||||||||||||||||||||||    
33146096 attccctcaaaacattcccccatccaaacacactctaa 33146059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #43
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 237 - 274
Target Start/End: Complemental strand, 33146226 - 33146189
Alignment:
237 attccctcaaaacattcccccatccaaacacactctaa 274  Q
    ||||||||||||||||||||||||||||||||||||||    
33146226 attccctcaaaacattcccccatccaaacacactctaa 33146189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #44
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 218 - 274
Target Start/End: Complemental strand, 23092016 - 23091961
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 274  Q
    |||||| |||||||||||||||||||||||| ||| ||||||| |||||||||||||    
23092016 aattccttcaaaacattacattccctcaaaatatt-ccccatcaaaacacactctaa 23091961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #45
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 237 - 272
Target Start/End: Complemental strand, 2550363 - 2550328
Alignment:
237 attccctcaaaacattcccccatccaaacacactct 272  Q
    ||||||||||||||||||||||||||||||||||||    
2550363 attccctcaaaacattcccccatccaaacacactct 2550328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #46
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 219 - 270
Target Start/End: Complemental strand, 14834877 - 14834826
Alignment:
219 attccctcaaaacattacattccctcaaaacattcccccatccaaacacact 270  Q
    ||||||| |||||||||||||||||| |||||||| ||||| ||||||||||    
14834877 attcccttaaaacattacattccctcgaaacattctcccatgcaaacacact 14834826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #47
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 237 - 272
Target Start/End: Complemental strand, 22305147 - 22305112
Alignment:
237 attccctcaaaacattcccccatccaaacacactct 272  Q
    ||||||||||||||||||||||||||||||||||||    
22305147 attccctcaaaacattcccccatccaaacacactct 22305112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #48
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 218 - 268
Target Start/End: Complemental strand, 16515058 - 16515009
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacaca 268  Q
    |||||||||||||| |||||||||||||||||||| | |||||||||||||    
16515058 aattccctcaaaaccttacattccctcaaaacatt-ctccatccaaacaca 16515009  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #49
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 237 - 274
Target Start/End: Complemental strand, 22302574 - 22302537
Alignment:
237 attccctcaaaacattcccccatccaaacacactctaa 274  Q
    |||||||||||||||| |||||||||||||||||||||    
22302574 attccctcaaaacattaccccatccaaacacactctaa 22302537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #50
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 218 - 274
Target Start/End: Original strand, 32470987 - 32471041
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 274  Q
    |||||||||||||||||||||||||||  || ||| || ||||||||||||||||||    
32470987 aattccctcaaaacattacattccctc--aagatttccacatccaaacacactctaa 32471041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #51
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 237 - 274
Target Start/End: Original strand, 34982313 - 34982350
Alignment:
237 attccctcaaaacattcccccatccaaacacactctaa 274  Q
    |||||||||||||||||| |||||||||||||||||||    
34982313 attccctcaaaacattcctccatccaaacacactctaa 34982350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #52
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 237 - 272
Target Start/End: Original strand, 15270871 - 15270906
Alignment:
237 attccctcaaaacattcccccatccaaacacactct 272  Q
    |||||||||||||||||| |||||||||||||||||    
15270871 attccctcaaaacattcctccatccaaacacactct 15270906  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #53
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 237 - 271
Target Start/End: Original strand, 12064485 - 12064519
Alignment:
237 attccctcaaaacattcccccatccaaacacactc 271  Q
    |||||||||||||||||||||||| ||||||||||    
12064485 attccctcaaaacattcccccatcaaaacacactc 12064519  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #54
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 223 - 264
Target Start/End: Original strand, 12991333 - 12991374
Alignment:
223 cctcaaaacattacattccctcaaaacattcccccatccaaa 264  Q
    |||||||||||||| || ||||||||||||||| ||||||||    
12991333 cctcaaaacattactttacctcaaaacattccctcatccaaa 12991374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #55
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 242 - 275
Target Start/End: Complemental strand, 34105119 - 34105086
Alignment:
242 ctcaaaacattcccccatccaaacacactctaaa 275  Q
    ||||||||||||| ||||||||||||||||||||    
34105119 ctcaaaacattcctccatccaaacacactctaaa 34105086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #56
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 218 - 270
Target Start/End: Original strand, 20320664 - 20320716
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacact 270  Q
    |||||||| |||| |||||||||| |||||||||||   ||||||||||||||    
20320664 aattcccttaaaatattacattccttcaaaacattcattcatccaaacacact 20320716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 54; Significance: 8e-22; HSPs: 50)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 218 - 275
Target Start/End: Complemental strand, 33902721 - 33902664
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaaa 275  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
33902721 aattccctcaaaacattacattccctcaaaacattcctccatccaaacacactctaaa 33902664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 218 - 274
Target Start/End: Complemental strand, 3853670 - 3853614
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 274  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
3853670 aatttcctcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 3853614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 218 - 274
Target Start/End: Complemental strand, 3858128 - 3858072
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 274  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
3858128 aatttcctcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 3858072  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 218 - 272
Target Start/End: Complemental strand, 17110923 - 17110869
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    ||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
17110923 aattccctcaaaacattacattccctcaaaacatttccccatccaaacacactct 17110869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 218 - 272
Target Start/End: Original strand, 42711385 - 42711439
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    ||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
42711385 aattccctcaaaacattacattccctcaaaacattccccaatccaaacacactct 42711439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 218 - 275
Target Start/End: Complemental strand, 44889408 - 44889351
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaaa 275  Q
    |||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||    
44889408 aattccctcaaaacattatattccctcaaaacattcctccatccaaacacactctaaa 44889351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 218 - 274
Target Start/End: Original strand, 14800065 - 14800121
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 274  Q
    ||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||    
14800065 aattccctcaaaacattactttccctcaaaatattcccccatccaaacacactctaa 14800121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 218 - 274
Target Start/End: Original strand, 17110974 - 17111030
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 274  Q
    ||||||||||||||||||||||||||||||||||| | |||||||||||||||||||    
17110974 aattccctcaaaacattacattccctcaaaacatttctccatccaaacacactctaa 17111030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 218 - 274
Target Start/End: Complemental strand, 24045014 - 24044958
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 274  Q
    |||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||    
24045014 aattccttcaaaacattacattccctcaaaacattccctcatccaaacacactctaa 24044958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 218 - 274
Target Start/End: Original strand, 28324691 - 28324747
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 274  Q
    |||||| |||||||||||||||||||||||||||||| |||||||||||||||||||    
28324691 aattccttcaaaacattacattccctcaaaacattcctccatccaaacacactctaa 28324747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 218 - 274
Target Start/End: Original strand, 29257380 - 29257436
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 274  Q
    |||||||| |||||| |||||||||||||||||||||||||||||||||||||||||    
29257380 aattcccttaaaacaatacattccctcaaaacattcccccatccaaacacactctaa 29257436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 218 - 272
Target Start/End: Complemental strand, 14991746 - 14991692
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    |||| ||||||||||||||||| ||||||||||||||||||||||||||||||||    
14991746 aattgcctcaaaacattacattacctcaaaacattcccccatccaaacacactct 14991692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 218 - 272
Target Start/End: Original strand, 33377326 - 33377380
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    ||||||||||||||| || ||||||||||||||||||||||||||||||||||||    
33377326 aattccctcaaaacaatatattccctcaaaacattcccccatccaaacacactct 33377380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 218 - 272
Target Start/End: Complemental strand, 40046858 - 40046804
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    ||||||||||||||||||||||||||||||||||||  |||||||||||||||||    
40046858 aattccctcaaaacattacattccctcaaaacattcatccatccaaacacactct 40046804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 218 - 275
Target Start/End: Original strand, 37268112 - 37268169
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaaa 275  Q
    |||||||||||||||||||||| |||||||| ||||||| ||||||||||||||||||    
37268112 aattccctcaaaacattacattacctcaaaatattcccctatccaaacacactctaaa 37268169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 218 - 275
Target Start/End: Original strand, 44346707 - 44346764
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaaa 275  Q
    |||||||| |||||| ||||||||||||||||||||||||||||||||||| ||||||    
44346707 aattcccttaaaacaatacattccctcaaaacattcccccatccaaacacattctaaa 44346764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 218 - 270
Target Start/End: Original strand, 4156272 - 4156324
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacact 270  Q
    ||||||||||||||||||||||||||||||| |||| ||||||||||||||||    
4156272 aattccctcaaaacattacattccctcaaaatattctcccatccaaacacact 4156324  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 218 - 270
Target Start/End: Original strand, 29482836 - 29482888
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacact 270  Q
    ||||||||||||||| ||| |||||||||||||||||||||||||||||||||    
29482836 aattccctcaaaacaatacgttccctcaaaacattcccccatccaaacacact 29482888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 221 - 275
Target Start/End: Original strand, 515564 - 515618
Alignment:
221 tccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaaa 275  Q
    ||||| ||||||||||||||| |||||||||||| ||||||||||||||||||||    
515564 tcccttaaaacattacattccttcaaaacattcctccatccaaacacactctaaa 515618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 218 - 272
Target Start/End: Complemental strand, 23011788 - 23011734
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    |||||||||| ||||||||||||||||||||||||| ||| ||||||||||||||    
23011788 aattccctcataacattacattccctcaaaacattctcccgtccaaacacactct 23011734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 218 - 272
Target Start/End: Complemental strand, 36103155 - 36103101
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    |||| ||| |||||||||||||||||||||||||||| |||||||||||||||||    
36103155 aatttccttaaaacattacattccctcaaaacattcctccatccaaacacactct 36103101  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 218 - 275
Target Start/End: Complemental strand, 13404881 - 13404824
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaaa 275  Q
    |||||||||||||||||||||| |||||||| ||| ||||||||||||||||| ||||    
13404881 aattccctcaaaacattacattacctcaaaatatttccccatccaaacacactataaa 13404824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 227 - 272
Target Start/End: Original strand, 27322687 - 27322732
Alignment:
227 aaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||    
27322687 aaaacattacattccctcaaaacattctcccatccaaacacactct 27322732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 218 - 262
Target Start/End: Original strand, 13404932 - 13404976
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatcca 262  Q
    ||||||||||||||||||||||||||||||||||||||| |||||    
13404932 aattccctcaaaacattacattccctcaaaacattcccctatcca 13404976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 224 - 272
Target Start/End: Original strand, 32626069 - 32626117
Alignment:
224 ctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    ||||||||||||||||||||||||| |||||||||||||| ||||||||    
32626069 ctcaaaacattacattccctcaaaagattcccccatccaagcacactct 32626117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 218 - 272
Target Start/End: Complemental strand, 14292 - 14239
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    |||||||| |||||||||||||||||| ||||||| |||||||||||||||||||    
14292 aattcccttaaaacattacattccctccaaacatt-ccccatccaaacacactct 14239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #27
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 218 - 268
Target Start/End: Complemental strand, 30435300 - 30435250
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacaca 268  Q
    ||||||||| ||||||||||||||||||||||||| | |||||||||||||    
30435300 aattccctccaaacattacattccctcaaaacatttctccatccaaacaca 30435250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #28
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 218 - 272
Target Start/End: Complemental strand, 31807462 - 31807409
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    |||||||||||||||||||||||| ||||||||||| | ||||||||||||||||    
31807462 aattccctcaaaacattacattcc-tcaaaacattctctcatccaaacacactct 31807409  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #29
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 218 - 272
Target Start/End: Complemental strand, 33986058 - 33986004
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    ||||| |||||||||||||||| | |||| |||||||||||||||||||||||||    
33986058 aattctctcaaaacattacattacttcaagacattcccccatccaaacacactct 33986004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #30
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 237 - 274
Target Start/End: Complemental strand, 29611423 - 29611386
Alignment:
237 attccctcaaaacattcccccatccaaacacactctaa 274  Q
    ||||||||||||||||||||||||||||||||||||||    
29611423 attccctcaaaacattcccccatccaaacacactctaa 29611386  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #31
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 237 - 274
Target Start/End: Complemental strand, 34008834 - 34008797
Alignment:
237 attccctcaaaacattcccccatccaaacacactctaa 274  Q
    ||||||||||||||||||||||||||||||||||||||    
34008834 attccctcaaaacattcccccatccaaacacactctaa 34008797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #32
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 218 - 270
Target Start/End: Original strand, 3853721 - 3853773
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacact 270  Q
    ||||||||| |||||||||||| |||||||| ||| |||||||||||||||||    
3853721 aattccctccaaacattacattacctcaaaatatttccccatccaaacacact 3853773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #33
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 218 - 270
Target Start/End: Original strand, 3858179 - 3858231
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacact 270  Q
    ||||||||| |||||||||||| |||||||| ||| |||||||||||||||||    
3858179 aattccctccaaacattacattacctcaaaatatttccccatccaaacacact 3858231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #34
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 218 - 266
Target Start/End: Complemental strand, 8689186 - 8689138
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaaca 266  Q
    |||||||||||||||||||||||| |||||||||| | |||||||||||    
8689186 aattccctcaaaacattacattccttcaaaacatttctccatccaaaca 8689138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #35
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 218 - 257
Target Start/End: Complemental strand, 8049308 - 8049269
Alignment:
218 aattccctcaaaacattacattccctcaaaacattccccc 257  Q
    |||||||||||||||||| |||||||||||||||||||||    
8049308 aattccctcaaaacattatattccctcaaaacattccccc 8049269  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #36
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 237 - 272
Target Start/End: Complemental strand, 14800014 - 14799979
Alignment:
237 attccctcaaaacattcccccatccaaacacactct 272  Q
    ||||||||||||||||||||||||||||||||||||    
14800014 attccctcaaaacattcccccatccaaacacactct 14799979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #37
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 218 - 269
Target Start/End: Original strand, 35979033 - 35979084
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacac 269  Q
    |||||||||  || ||||||||||||||||||||||| ||||||||||||||    
35979033 aattccctcttaagattacattccctcaaaacattcctccatccaaacacac 35979084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #38
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 218 - 272
Target Start/End: Original strand, 1088306 - 1088360
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    |||| |||||||||| ||||||| ||||||||||||| ||| |||||||||||||    
1088306 aatttcctcaaaacaatacattctctcaaaacattcctccacccaaacacactct 1088360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #39
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 218 - 272
Target Start/End: Original strand, 33902772 - 33902825
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    |||||||||||||||  ||||||||||||| ||||||||||||| ||||||||||    
33902772 aattccctcaaaacaaaacattccctcaaa-cattcccccatcccaacacactct 33902825  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #40
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 237 - 274
Target Start/End: Original strand, 7202934 - 7202971
Alignment:
237 attccctcaaaacattcccccatccaaacacactctaa 274  Q
    |||||||||||||||||| |||||||||||||||||||    
7202934 attccctcaaaacattcctccatccaaacacactctaa 7202971  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #41
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 218 - 255
Target Start/End: Original strand, 40046895 - 40046932
Alignment:
218 aattccctcaaaacattacattccctcaaaacattccc 255  Q
    |||||||||||||||||||||| |||||||||||||||    
40046895 aattccctcaaaacattacattacctcaaaacattccc 40046932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #42
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 218 - 278
Target Start/End: Original strand, 11744748 - 11744808
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaaatgt 278  Q
    |||||| ||| |||||||||||||||| ||| |||| | |||||||||||||||| |||||    
11744748 aattccttcacaacattacattccctctaaatattctctcatccaaacacactcttaatgt 11744808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #43
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 237 - 273
Target Start/End: Original strand, 30435350 - 30435386
Alignment:
237 attccctcaaaacattcccccatccaaacacactcta 273  Q
    |||||||||||||||| ||||||||||||||||||||    
30435350 attccctcaaaacatttccccatccaaacacactcta 30435386  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #44
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 237 - 272
Target Start/End: Original strand, 30444963 - 30444998
Alignment:
237 attccctcaaaacattcccccatccaaacacactct 272  Q
    |||||||||||||||||| |||||||||||||||||    
30444963 attccctcaaaacattcctccatccaaacacactct 30444998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #45
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 237 - 272
Target Start/End: Complemental strand, 42739984 - 42739949
Alignment:
237 attccctcaaaacattcccccatccaaacacactct 272  Q
    |||||||||||||||||| |||||||||||||||||    
42739984 attccctcaaaacattcctccatccaaacacactct 42739949  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #46
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 237 - 275
Target Start/End: Original strand, 8409947 - 8409985
Alignment:
237 attccctcaaaacattcccccatccaaacacactctaaa 275  Q
    ||||||| |||||||||| ||||||||||||||||||||    
8409947 attcccttaaaacattcctccatccaaacacactctaaa 8409985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #47
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 218 - 275
Target Start/End: Complemental strand, 9982690 - 9982634
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaaa 275  Q
    ||||| |||||||||||||||| ||| |||||||| | |||||||||||| |||||||    
9982690 aattctctcaaaacattacattaccttaaaacatt-ctccatccaaacacgctctaaa 9982634  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #48
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 242 - 271
Target Start/End: Complemental strand, 34388556 - 34388527
Alignment:
242 ctcaaaacattcccccatccaaacacactc 271  Q
    ||||||||||||||||||||||||||||||    
34388556 ctcaaaacattcccccatccaaacacactc 34388527  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #49
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 241 - 274
Target Start/End: Complemental strand, 42711335 - 42711302
Alignment:
241 cctcaaaacattcccccatccaaacacactctaa 274  Q
    |||||||||||| |||||||||||||||||||||    
42711335 cctcaaaacatttccccatccaaacacactctaa 42711302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #50
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 237 - 269
Target Start/End: Original strand, 26520469 - 26520501
Alignment:
237 attccctcaaaacattcccccatccaaacacac 269  Q
    ||||||||||||||||||| |||||||||||||    
26520469 attccctcaaaacattccctcatccaaacacac 26520501  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1562 (Bit Score: 53; Significance: 3e-21; HSPs: 2)
Name: scaffold1562
Description:

Target: scaffold1562; HSP #1
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 218 - 270
Target Start/End: Original strand, 510 - 562
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacact 270  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||    
510 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacact 562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1562; HSP #2
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 218 - 272
Target Start/End: Complemental strand, 459 - 405
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    ||||||||||||||||||  ||||||||||| |||||||||||||||||||||||    
459 aattccctcaaaacattattttccctcaaaatattcccccatccaaacacactct 405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1158 (Bit Score: 53; Significance: 3e-21; HSPs: 2)
Name: scaffold1158
Description:

Target: scaffold1158; HSP #1
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 218 - 270
Target Start/End: Complemental strand, 2083 - 2031
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacact 270  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||    
2083 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacact 2031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1158; HSP #2
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 218 - 272
Target Start/End: Original strand, 2134 - 2188
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    ||||||||||||||||||  ||||||||||| |||||||||||||||||||||||    
2134 aattccctcaaaacattattttccctcaaaatattcccccatccaaacacactct 2188  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0009 (Bit Score: 50; Significance: 2e-19; HSPs: 2)
Name: scaffold0009
Description:

Target: scaffold0009; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 218 - 275
Target Start/End: Complemental strand, 42051 - 41994
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaaa 275  Q
    ||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||    
42051 aattccctcaaaacattacattccctcaaaacattcctccattcaaacacactctaaa 41994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0009; HSP #2
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 218 - 272
Target Start/End: Original strand, 42083 - 42137
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    ||||| |||||||||||||||||||||||||| ||||||||||||||||||||||    
42083 aattctctcaaaacattacattccctcaaaacgttcccccatccaaacacactct 42137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0048 (Bit Score: 49; Significance: 8e-19; HSPs: 1)
Name: scaffold0048
Description:

Target: scaffold0048; HSP #1
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 218 - 270
Target Start/End: Complemental strand, 82997 - 82945
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacact 270  Q
    |||||||||||||||||||||||||||||||||||| ||||||||||||||||    
82997 aattccctcaaaacattacattccctcaaaacattcacccatccaaacacact 82945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0318 (Bit Score: 45; Significance: 2e-16; HSPs: 1)
Name: scaffold0318
Description:

Target: scaffold0318; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 218 - 274
Target Start/End: Complemental strand, 2921 - 2865
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactctaa 274  Q
    ||||||||||||||||||||||| ||| ||||||||||||||| |||||||||||||    
2921 aattccctcaaaacattacattctctcgaaacattcccccatctaaacacactctaa 2865  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0400 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 1)
Name: scaffold0400
Description:

Target: scaffold0400; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 218 - 271
Target Start/End: Original strand, 4517 - 4570
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactc 271  Q
    |||| ||||||||||||| ||||||||||||||||||| |||||||||||||||    
4517 aatttcctcaaaacattatattccctcaaaacattccctcatccaaacacactc 4570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0365 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 1)
Name: scaffold0365
Description:

Target: scaffold0365; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 218 - 271
Target Start/End: Original strand, 5161 - 5214
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactc 271  Q
    |||| ||||||||||||| ||||||||||||||||||| |||||||||||||||    
5161 aatttcctcaaaacattatattccctcaaaacattccctcatccaaacacactc 5214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0301 (Bit Score: 41; Significance: 0.00000000000005; HSPs: 1)
Name: scaffold0301
Description:

Target: scaffold0301; HSP #1
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 218 - 270
Target Start/End: Complemental strand, 7205 - 7153
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacact 270  Q
    |||||||| |||||| ||||||||||||||||||||| |||||||||||||||    
7205 aattcccttaaaacaatacattccctcaaaacattcctccatccaaacacact 7153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0129 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 2)
Name: scaffold0129
Description:

Target: scaffold0129; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 223 - 270
Target Start/End: Complemental strand, 19247 - 19200
Alignment:
223 cctcaaaacattacattccctcaaaacattcccccatccaaacacact 270  Q
    |||||||||||||||||||||||||| | |||||||||||||||||||    
19247 cctcaaaacattacattccctcaaaatactcccccatccaaacacact 19200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0129; HSP #2
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 227 - 270
Target Start/End: Original strand, 19813 - 19855
Alignment:
227 aaaacattacattccctcaaaacattcccccatccaaacacact 270  Q
    |||||||||||||||||||||||| |||||||||||||||||||    
19813 aaaacattacattccctcaaaaca-tcccccatccaaacacact 19855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0240 (Bit Score: 39; Significance: 0.0000000000007; HSPs: 1)
Name: scaffold0240
Description:

Target: scaffold0240; HSP #1
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 237 - 279
Target Start/End: Original strand, 17605 - 17647
Alignment:
237 attccctcaaaacattcccccatccaaacacactctaaatgta 279  Q
    |||||||||||||||||||||||||||||||||||||| ||||    
17605 attccctcaaaacattcccccatccaaacacactctaagtgta 17647  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0169 (Bit Score: 39; Significance: 0.0000000000007; HSPs: 1)
Name: scaffold0169
Description:

Target: scaffold0169; HSP #1
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 218 - 272
Target Start/End: Complemental strand, 4129 - 4075
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    ||||||||||||||||||||||| |||||||||||||   |||||||||||||||    
4129 aattccctcaaaacattacattctctcaaaacattcctttatccaaacacactct 4075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0044 (Bit Score: 39; Significance: 0.0000000000007; HSPs: 1)
Name: scaffold0044
Description:

Target: scaffold0044; HSP #1
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 218 - 268
Target Start/End: Original strand, 56379 - 56429
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacaca 268  Q
    ||||||||||||||||||| ||||||||||| |||||| ||||||||||||    
56379 aattccctcaaaacattactttccctcaaaatattccctcatccaaacaca 56429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0039 (Bit Score: 39; Significance: 0.0000000000007; HSPs: 1)
Name: scaffold0039
Description:

Target: scaffold0039; HSP #1
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 237 - 275
Target Start/End: Complemental strand, 109084 - 109046
Alignment:
237 attccctcaaaacattcccccatccaaacacactctaaa 275  Q
    |||||||||||||||||||||||||||||||||||||||    
109084 attccctcaaaacattcccccatccaaacacactctaaa 109046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0027 (Bit Score: 38; Significance: 0.000000000003; HSPs: 1)
Name: scaffold0027
Description:

Target: scaffold0027; HSP #1
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 218 - 271
Target Start/End: Complemental strand, 10940 - 10887
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactc 271  Q
    |||||||||||||||||||||||||| |||||||||  |||| |||||||||||    
10940 aattccctcaaaacattacattcccttaaaacattcttccattcaaacacactc 10887  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0337 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0337
Description:

Target: scaffold0337; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 218 - 272
Target Start/End: Original strand, 15883 - 15936
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    ||||| |||| | |||||||||||| ||||||| |||||||||||||||||||||    
15883 aattctctcatagcattacattccc-caaaacaatcccccatccaaacacactct 15936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0065 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0065
Description:

Target: scaffold0065; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 218 - 272
Target Start/End: Original strand, 2925 - 2978
Alignment:
218 aattccctcaaaacattacattccctcaaaacattcccccatccaaacacactct 272  Q
    ||||| |||| | |||||||||||| ||||||| |||||||||||||||||||||    
2925 aattctctcatagcattacattccc-caaaacaatcccccatccaaacacactct 2978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 201403 times since January 2019
Visitors: 1513