View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 108_8_74 (Length: 627)

Name: 108_8_74
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 108_8_74
108_8_74
[»] chr3 (4 HSPs)
chr3 (128-627)||(29305019-29305517)
chr3 (1-131)||(29305513-29305643)
chr3 (270-471)||(29322350-29322550)
chr3 (211-394)||(29333482-29333665)


Alignment Details
Target: chr3 (Bit Score: 477; Significance: 0; HSPs: 4)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 477; E-Value: 0
Query Start/End: Original strand, 128 - 627
Target Start/End: Original strand, 29305019 - 29305517
Alignment:
128 aattctaccttaagaagatcgacggtttggcttcgtctctgaagattaggttggagtttgaggattttgatgagtttgaatgagaatgcgttaggataat 227  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
29305019 aattctaccttaagaagatcgacggtttggcttcgtctctgaagattaggttgaagtttgaggattttgatgagtttgaatgagaatgcgttaggataat 29305118  T
228 gaagtgtgaaagatttgaaaatcgtgaataaagattgattcctggtttgagagtattcatcgattgcttcttgcaacgacgagaggtcgttggataggag 327  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29305119 gaagtgtgaaagatttgaaaatcgtgaataaagattgattcctggtttgagagtattcatcgattgcttcttgcaacgacgagaggtcgttggataggag 29305218  T
328 aaacctttcggcgtgttgtcgaagttcgaagccgtggatgagtgatctgtcttggttttcttcgatggacccttctcttgttgattctttcgtgcaagcc 427  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||     
29305219 aaacctttcggcgtgttgtcgaagttcgaagccgtggatgagtgatctgtcttggttttcttcgatgga-ccttctcttgttgattctttcgtgcaagcg 29305317  T
428 attgcgcggtggcgtgttgatatctggatcaaacggattgcgtaaggaagcttcttgcggtggtgatgaagattcagtggttgacgccattgttgaggan 527  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
29305318 attgcgcggaggcgtgttgatatctggatcaaacggattgcgtaaggaagcttcttgcggtggtgatgaagattcagtggttgacgccattgttgaggaa 29305417  T
528 ggttgaaacttcgaatgtgggttttggagggaagagttttgtaacggttagtttggtggaatcggttattctgttgtggaaattatccacgtcagctttt 627  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29305418 ggttgaaacttcgaatgtgggttttggagggaagagttttgtaacggttagtttggtggaatcggttattctgttgtggaaattatccacgtcagctttt 29305517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 127; E-Value: 3e-65
Query Start/End: Original strand, 1 - 131
Target Start/End: Original strand, 29305513 - 29305643
Alignment:
1 cttttgtattgaatgaatgggacgggcttgaagcccgttgtttgggttcaatgtgatggacgggcctgaagcccgttactcgataattctctgaagcttt 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
29305513 cttttgtattgaatgaatgggacgggcttgaagcccgttgtttgggttcaatgtgatggacgggcctgaagcccgttagtcgataattctctgaagcttt 29305612  T
101 tggaatccggtggcggagattctcttcaatt 131  Q
    |||||||||||||||||||||||||||||||    
29305613 tggaatccggtggcggagattctcttcaatt 29305643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 270 - 471
Target Start/End: Original strand, 29322350 - 29322550
Alignment:
270 tggtttgagagtattcatcgattgcttcttgcaacgacgagaggtcgttggataggagaaacctttcggcgtgttgtcgaagttcgaagccgtggatgag 369  Q
    ||||||||| |||||| |||||||||| ||||| ||| | |||||||||||||  ||| || |||   ||||||| | |||||| || ||||||||||||    
29322350 tggtttgagtgtattcttcgattgcttgttgcagcgatgcgaggtcgttggatccgagcaatcttgttgcgtgttcttgaagttggaggccgtggatgag 29322449  T
370 tgatctgtcttggttttcttcgatggacccttctcttgttgattctttcgtgcaagccattgcgcggtggcgtgttgatatctggatcaaacggattgcg 469  Q
    |||| | |||||||| | |||||||  || |||||||||| ||| |||| | ||||  ||||||| |||| | ||| ||||| |||||||||||||||||    
29322450 tgatttatcttggttgtgttcgatgcgcc-ttctcttgttcattatttcttccaagtgattgcgcagtggtgggtttatatccggatcaaacggattgcg 29322548  T
470 ta 471  Q
    ||    
29322549 ta 29322550  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 211 - 394
Target Start/End: Original strand, 29333482 - 29333665
Alignment:
211 gaatgcgttaggataatgaagtgtgaaagatttgaaaatcgtgaataaagattgattcctggtttgagagtattcatcgattgcttcttgcaacgacgag 310  Q
    |||||||||||| |||||| ||| ||| ||||||||||| |||||||| ||||  | | |||  |  | ||| || |||||| ||||||| | ||| ||     
29333482 gaatgcgttagggtaatgatgtgcgaatgatttgaaaattgtgaataatgattcgtccttggaattcgcgtactcgtcgattacttcttgaagcgatgaa 29333581  T
311 aggtcgttggataggagaaacctttcggcgtgttgtcgaagttcgaagccgtggatgagtgatctgtcttggttttcttcgatg 394  Q
    || ||||||||| | |||| | || || |||||||| ||||||||||||| |||| |||||||  |||||||||||||||||||    
29333582 agatcgttggattgaagaatcgttgcgacgtgttgttgaagttcgaagccatggaggagtgattcgtcttggttttcttcgatg 29333665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 108428 times since January 2019
Visitors: 1329