View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 108_9_10 (Length: 308)

Name: 108_9_10
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 108_9_10
108_9_10
[»] chr4 (4 HSPs)
chr4 (1-127)||(7168014-7168140)
chr4 (227-300)||(7167945-7168018)
chr4 (6-98)||(7178008-7178100)
chr4 (233-277)||(7177932-7177976)
[»] chr6 (1 HSPs)
chr6 (25-65)||(6768154-6768194)


Alignment Details
Target: chr4 (Bit Score: 90; Significance: 2e-43; HSPs: 4)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 1 - 127
Target Start/End: Original strand, 7168014 - 7168140
Alignment:
1 ttatgctcatggtaccactagtgataagcaattacgatcagttaaggaagttgtaaatcacttacttccggaaggctgcaccatgttagattcaaaggnn 100  Q
    ||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||      
7168014 ttatgctcatgataccactagtggtaagcaattacgatcagttaaggaagttgtaaatcacttacttccggaaggctacaccatgttagattcaaaggaa 7168113  T
101 nnnnngggaaaggtgaagcattaaaac 127  Q
          |||||||||||||||||||||    
7168114 aaaaaaggaaaggtgaagcattaaaac 7168140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 227 - 300
Target Start/End: Original strand, 7167945 - 7168018
Alignment:
227 aattaatatatatttgttaatgataataagactcatttatcttcattttttgttatatttcttgtagtattatg 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7167945 aattaatatatatttgttaatgataataagactcatttatcttcattttttgttatatttcttgtagtattatg 7168018  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 6 - 98
Target Start/End: Original strand, 7178008 - 7178100
Alignment:
6 ctcatggtaccactagtgataagcaattacgatcagttaaggaagttgtaaatcacttacttccggaaggctgcaccatgttagattcaaagg 98  Q
    ||||||||||||||| || |||| ||||||||||||| |  ||||||||||||||||||||||| ||||||| ||||| | |||| |||||||    
7178008 ctcatggtaccactactggtaagaaattacgatcagtgacagaagttgtaaatcacttacttccagaaggctacaccaagatagaatcaaagg 7178100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 233 - 277
Target Start/End: Original strand, 7177932 - 7177976
Alignment:
233 tatatatttgttaatgataataagactcatttatcttcatttttt 277  Q
    ||||||||||| |||| ||| || |||||||||||||||||||||    
7177932 tatatatttgtcaatgttaacaacactcatttatcttcatttttt 7177976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 37; Significance: 0.000000000007; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 25 - 65
Target Start/End: Complemental strand, 6768194 - 6768154
Alignment:
25 taagcaattacgatcagttaaggaagttgtaaatcacttac 65  Q
    |||| ||||||||||||||||||||||||||||||||||||    
6768194 taagaaattacgatcagttaaggaagttgtaaatcacttac 6768154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 108413 times since January 2019
Visitors: 1329