View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 108_9_19 (Length: 475)

Name: 108_9_19
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 108_9_19
108_9_19
[»] chr3 (2 HSPs)
chr3 (1-322)||(53159235-53159556)
chr3 (378-453)||(53159611-53159686)
[»] chr6 (2 HSPs)
chr6 (1-322)||(7368745-7369066)
chr6 (378-453)||(7368611-7368686)
[»] chr7 (2 HSPs)
chr7 (1-322)||(45632420-45632744)
chr7 (378-435)||(45632307-45632364)
[»] chr2 (1 HSPs)
chr2 (44-315)||(39905900-39906169)
[»] chr4 (1 HSPs)
chr4 (144-184)||(41730603-41730643)


Alignment Details
Target: chr3 (Bit Score: 281; Significance: 1e-157; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 1 - 322
Target Start/End: Original strand, 53159235 - 53159556
Alignment:
1 tctaatcaacccaataataaaaacccaataattaaaatgcttcatatatatagtagaacacactcttctcaaaattgtgttagcaacgtgacaaaaaatg 100  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||    
53159235 tctaatcaacccaataaaaaaaacccaataattaaaatgcttcatatatatagtagaacacactcttttcaaaattgtgttagcagcgtgacaaaaaatg 53159334  T
101 gagcaactacttagccgtaaaatacaatatcaaagacataaataaaggcagcaaattaaggaaggaacatagaatgcattaagtctttcactccatagaa 200  Q
    ||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
53159335 gagcaactacttagccgtaaattacaatatcaaagacaaaaataaaggcagcaaattaaggaaggaacaaagaatgcattaagtctttcactccatagaa 53159434  T
201 gaaatattgagtcaaaaaagtcattcattccaatccatgggccagtagttacagatggagtctcaaacttggagcatccccatngaagaaatatcngtaa 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||  ||||    
53159435 gaaatattgagtcaaaaaagtcattcattccaatccatgggccagtagttacagatgcagtctcaaacttggagcatccccatagaagaaatatgagtaa 53159534  T
301 gaagaataaggaaatcngaagt 322  Q
    |||||||||||||||| |||||    
53159535 gaagaataaggaaatcagaagt 53159556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 378 - 453
Target Start/End: Original strand, 53159611 - 53159686
Alignment:
378 cccntaatgtctaaccggcgacnccttaactgccacggncactctagttattatagaatcaattanagagtaaatt 453  Q
    ||| ||||||| |||||||||| | ||||||||||||| |||||||||||||| ||||  ||| | ||||||||||    
53159611 cccataatgtcaaaccggcgacactttaactgccacggtcactctagttattaaagaacaaatgaaagagtaaatt 53159686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 273; Significance: 1e-152; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 1 - 322
Target Start/End: Complemental strand, 7369066 - 7368745
Alignment:
1 tctaatcaacccaataataaaaacccaataattaaaatgcttcatatatatagtagaacacactcttctcaaaattgtgttagcaacgtgacaaaaaatg 100  Q
    ||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
7369066 tctaatcaacccaataaaaaaaacccaataattaaaacgcttcatatatatagtagaacacactcttctcaaaattgtgttagcagcgtgacaaaaaatg 7368967  T
101 gagcaactacttagccgtaaaatacaatatcaaagacataaataaaggcagcaaattaaggaaggaacatagaatgcattaagtctttcactccatagaa 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| | ||||||||||||||||||||||||| ||||    
7368966 gagcaactacttagccgtaaaatacaatatcaaagacataaataaaggcaacaaattaaggaaggaataaagaatgcattaagtctttcactccagagaa 7368867  T
201 gaaatattgagtcaaaaaagtcattcattccaatccatgggccagtagttacagatggagtctcaaacttggagcatccccatngaagaaatatcngtaa 300  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||  ||||    
7368866 gaaatattgagtcaaaaaaatcattcattccaatccatgggccagtagttacagatgcagtctcaaacttggagcatccccatagaagaaatatgagtaa 7368767  T
301 gaagaataaggaaatcngaagt 322  Q
    |||||||||||||||| |||||    
7368766 gaagaataaggaaatcagaagt 7368745  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 378 - 453
Target Start/End: Complemental strand, 7368686 - 7368611
Alignment:
378 cccntaatgtctaaccggcgacnccttaactgccacggncactctagttattatagaatcaattanagagtaaatt 453  Q
    ||| ||||||| |||||||||| ||||||||||||||| |||| ||||||||| ||||  ||| | ||||||||||    
7368686 cccataatgtcaaaccggcgacaccttaactgccacggtcactatagttattaaagaacaaatgaaagagtaaatt 7368611  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 261; Significance: 1e-145; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 1 - 322
Target Start/End: Complemental strand, 45632744 - 45632420
Alignment:
1 tctaatcaacccaataataaaaacc-caataattaaaatgcttcatatatatagtagaacacactcttctcaaaattgtgttagcaacgtgacaaaaaat 99  Q
    |||||||||| |||||| ||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
45632744 tctaatcaactcaataaaaaaaaactcaataattaaaatgcttcatatatatagtagaacacactcttctcaaaattgtgttagcagcgtgacaaaaaat 45632645  T
100 ggagcaactacttagccgtaaaatacaatatcaaagacataaataaaggcagcaaattaaggaaggaacatagaatgcattaagtctttcactccataga 199  Q
    |||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||    
45632644 ggagcaactacttacccgtaaaatacaatatcaaagacataaataaaggcagtaaattaaggaaggaacaaagaatgcattaagtctttcactccataga 45632545  T
200 agaaatattgagtcaaaaaagtcattcattccaatccatgggccagtagttacagatggagtctcaaacttggagcat--ccccatngaagaaatatcng 297  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||  |||||| ||||||||||  |    
45632544 agaaatattgagtcaaaaaagtcattcattccaatccatgggccagtagttacagatgcagtctcaaacttggagcatccccccatagaagaaatatgag 45632445  T
298 taagaagaataaggaaatcngaagt 322  Q
    ||||||||||||||||||| |||||    
45632444 taagaagaataaggaaatcagaagt 45632420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 378 - 435
Target Start/End: Complemental strand, 45632364 - 45632307
Alignment:
378 cccntaatgtctaaccggcgacnccttaactgccacggncactctagttattatagaa 435  Q
    ||| ||||||| |||||||||| | ||||||||||||| |||||||||||||| ||||    
45632364 cccataatgtcaaaccggcgacactttaactgccacggtcactctagttattaaagaa 45632307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 134; Significance: 1e-69; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 44 - 315
Target Start/End: Complemental strand, 39906169 - 39905900
Alignment:
44 atatatatagtagaacacactcttctcaaaattgtgttagcaacgtgacaaaaaatggagcaactacttagccgtaaaatacaatatcaaagacataaat 143  Q
    |||||||||||||||| |||| ||||||||| ||||||| |  ||||| || |||||||||||| ||||||||||||| ||||||||||||||||| ||     
39906169 atatatatagtagaacgcactattctcaaaagtgtgttacccgcgtgagaacaaatggagcaaccacttagccgtaaa-tacaatatcaaagacatgaac 39906071  T
144 aaaggcagcaaattaaggaaggaacatagaatgcattaagtctttcactccatagaagaaatattgagtcaaaaaagtcattcattccaatccatgggcc 243  Q
    |||| || ||||||||||||  |||| ||||||  |||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |    
39906070 aaagacaacaaattaaggaaccaacaaagaatgtcttaagtttttcactccatagaagaaatattgagtcaaaaaactcattcattccaatccatgggtc 39905971  T
244 agtagttacagatggagtctcaaacttggagcatccccatngaagaaatatcngtaagaagaataaggaaat 315  Q
    |||||||||||||| ||||||||| || ||| | ||| || |||||||| |  || ||||||||||||||||    
39905970 agtagttacagatgcagtctcaaattttgag-aaccctatagaagaaatgtgagtgagaagaataaggaaat 39905900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 144 - 184
Target Start/End: Original strand, 41730603 - 41730643
Alignment:
144 aaaggcagcaaattaaggaaggaacatagaatgcattaagt 184  Q
    |||||||||||||||||||| ||||| |||| |||||||||    
41730603 aaaggcagcaaattaaggaacgaacaaagaaggcattaagt 41730643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 361743 times since January 2019
Visitors: 488