View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 108_9_20 (Length: 484)

Name: 108_9_20
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 108_9_20
108_9_20
[»] chr4 (1 HSPs)
chr4 (1-417)||(9498073-9498486)


Alignment Details
Target: chr4 (Bit Score: 360; Significance: 0; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 360; E-Value: 0
Query Start/End: Original strand, 1 - 417
Target Start/End: Complemental strand, 9498486 - 9498073
Alignment:
1 ataacatcctggggtacttccaccacgagcataataataggtatctatacaagaaggatacagatgttattactaggaatgagtggtgtagactacatga 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
9498486 ataacatcctggggtacttccaccacgagcataataataggtatctatacaagaaggatacagatgttattaataggaatgagtggtgtagactacatga 9498387  T
101 cttgaaatgacaattaacagccaagagaagaggtattacagcagtattttccactattttcagagaatcattttttacccattcctgattggcaagatac 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
9498386 cttgaaatgacaattaacagccaagagaagaggtattacagcagtattttccactgttttcagagaatcattttttacccattcctgattggcaagatac 9498287  T
201 ctagctgcatgctggcacaaaaacacagtagtgtcaattgtctgacatactgagagatttcttgttcttgtgattattgttgtaaaaatcnatacatctt 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||| |||||||||    
9498286 ctagctgcatgctggcacaaaaacacagtagtgtcaattgtctgacatactgaaagatttcttgttcttgagattattgttgtaaaaatcaatacatctt 9498187  T
301 ccaatcacatgtttacaaagtattgcaaaaagggaatnaattaccnaacaaaaaattacttttaanaatgtcaatcanaatcaaaaccctcnttcaaaca 400  Q
    ||||||||||||||||||||||||||||||||||||| ||||||  ||||||||||||||||||| ||||||||||| |||||||  |||| ||||||||    
9498186 ccaatcacatgtttacaaagtattgcaaaaagggaataaattacaaaacaaaaaattacttttaaaaatgtcaatca-aatcaaa--cctcattcaaaca 9498090  T
401 ganttgaaacagtcaat 417  Q
    || ||||||||||||||    
9498089 gaattgaaacagtcaat 9498073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 175847 times since January 2019
Visitors: 1577