View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 108_9_3 (Length: 464)

Name: 108_9_3
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 108_9_3
108_9_3
[»] chr2 (5 HSPs)
chr2 (70-305)||(42352039-42352279)
chr2 (300-464)||(42352343-42352507)
chr2 (1-48)||(42352300-42352347)
chr2 (121-181)||(4141304-4141364)
chr2 (113-156)||(4141420-4141463)
[»] chr6 (4 HSPs)
chr6 (113-154)||(2308402-2308443)
chr6 (126-181)||(1303360-1303415)
chr6 (113-156)||(2308470-2308513)
chr6 (70-141)||(33940927-33940995)
[»] chr5 (1 HSPs)
chr5 (112-152)||(41982566-41982606)
[»] chr7 (1 HSPs)
chr7 (113-179)||(30572586-30572652)
[»] chr8 (1 HSPs)
chr8 (113-152)||(6924235-6924275)


Alignment Details
Target: chr2 (Bit Score: 193; Significance: 1e-105; HSPs: 5)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 70 - 305
Target Start/End: Complemental strand, 42352279 - 42352039
Alignment:
70 taatgtaatcatatcaatcaacagcatttcatatttgtattctttttaatgttttcatttgat-----gtgagtgtgcccaaatatttttcacttaagat 164  Q
    ||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||     |||||||||||||||||||||| |||||||||    
42352279 taatgtaatcacatcaatcaacaacatttcatatttgtattctttttaatgttttcatttgatttgatgtgagtgtgcccaaatattttttacttaagat 42352180  T
165 tgtgcccataaaagagtcgctacatttatgcatatgatcaaatgttggtaaaatagaagcttacaaatgaagtgcatatatgttgcatcaactaattaaa 264  Q
    ||||||||||||||||||||| |||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42352179 tgtgcccataaaagagtcgctccatttgggcatatgatcaaatgttggtaaaatagaagcttacaaatgaagtgcatatatgttgcatcaactaattaaa 42352080  T
265 tgttatctataatagtcgatgcattatgaagcacaattaat 305  Q
    |||| ||||||||||||||||||||||||||||||||||||    
42352079 tgttgtctataatagtcgatgcattatgaagcacaattaat 42352039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 141; E-Value: 9e-74
Query Start/End: Original strand, 300 - 464
Target Start/End: Complemental strand, 42352507 - 42352343
Alignment:
300 attaatattttttatcgtctgatctcaatttgtatatgtatgatttgaactgtcctttaacggtcgagatcgtctatcacgtgtaactacgtaattcccc 399  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||| ||| |||||    
42352507 attaatattttttatcgtctgatctcaatttgtatatgtatgatttgaactgtcctttaacagtcgagatcgtctatcacatgtaactacataactcccc 42352408  T
400 taaggcaagggaatctcaatcctaattgatgtaaggtaaatcctcatttgtacgagcaagtttta 464  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||    
42352407 taaggcaagggaatctcaatcctaattgatgtaaggtaaatcttcatttgtacgaacaagtttta 42352343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 42352347 - 42352300
Alignment:
1 ttttatataatcacaattccaaatcaaaaacatttgagaacaccaaat 48  Q
    ||||||||| ||| ||||||||||||||||||||||||||||||||||    
42352347 ttttatatagtcataattccaaatcaaaaacatttgagaacaccaaat 42352300  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 121 - 181
Target Start/End: Complemental strand, 4141364 - 4141304
Alignment:
121 ttttcatttgatgtgagtgtgcccaaatatttttcacttaagattgtgcccataaaagagt 181  Q
    |||| ||||||||||| ||| | ||||||||||||| ||| ||||||||||||| ||||||    
4141364 tttttatttgatgtgaatgtactcaaatatttttcatttaggattgtgcccatacaagagt 4141304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 113 - 156
Target Start/End: Original strand, 4141420 - 4141463
Alignment:
113 ttttaatgttttcatttgatgtgagtgtgcccaaatatttttca 156  Q
    ||||||| ||||||||||||||||| ||||| ||||||||||||    
4141420 ttttaattttttcatttgatgtgagagtgcctaaatatttttca 4141463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 34; Significance: 0.0000000007; HSPs: 4)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 113 - 154
Target Start/End: Original strand, 2308402 - 2308443
Alignment:
113 ttttaatgttttcatttgatgtgagtgtgcccaaatattttt 154  Q
    ||||||| |||| |||||||||||||||||||||||||||||    
2308402 ttttaattttttgatttgatgtgagtgtgcccaaatattttt 2308443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 126 - 181
Target Start/End: Complemental strand, 1303415 - 1303360
Alignment:
126 atttgatgtgagtgtgcccaaatatttttcacttaagattgtgcccataaaagagt 181  Q
    ||||||||||||||||  ||||||||||||| ||| ||||||| ||||| ||||||    
1303415 atttgatgtgagtgtgttcaaatatttttcatttaggattgtgtccatagaagagt 1303360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 113 - 156
Target Start/End: Original strand, 2308470 - 2308513
Alignment:
113 ttttaatgttttcatttgatgtgagtgtgcccaaatatttttca 156  Q
    ||||||| ||| ||||||| ||||||||||||||||||||||||    
2308470 ttttaatttttccatttgacgtgagtgtgcccaaatatttttca 2308513  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 70 - 141
Target Start/End: Complemental strand, 33940995 - 33940927
Alignment:
70 taatgtaatcatatcaatcaacagcatttcatatttgtattctttttaatgttttcatttgatgtgagtgtg 141  Q
    |||| |||||| ||||||||||| ||||| || ||   |||||||||||| |||| ||||||||||||||||    
33940995 taatttaatcacatcaatcaacatcatttaatttt---attctttttaatttttttatttgatgtgagtgtg 33940927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 33; Significance: 0.000000003; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 112 - 152
Target Start/End: Original strand, 41982566 - 41982606
Alignment:
112 tttttaatgttttcatttgatgtgagtgtgcccaaatattt 152  Q
    |||| ||| ||||||||||||||||||||||||||||||||    
41982566 ttttaaattttttcatttgatgtgagtgtgcccaaatattt 41982606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 113 - 179
Target Start/End: Original strand, 30572586 - 30572652
Alignment:
113 ttttaatgttttcatttgatgtgagtgtgcccaaatatttttcacttaagattgtgcccataaaaga 179  Q
    ||||||| ||| ||||||||||||||||||||||||  |||||| ||  | ||||| ||||||||||    
30572586 ttttaatttttccatttgatgtgagtgtgcccaaatgcttttcatttggggttgtgaccataaaaga 30572652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 113 - 152
Target Start/End: Original strand, 6924235 - 6924275
Alignment:
113 ttttaatgttttc-atttgatgtgagtgtgcccaaatattt 152  Q
    ||||||| ||||| |||||||||||||||||||||||||||    
6924235 ttttaattttttctatttgatgtgagtgtgcccaaatattt 6924275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 108443 times since January 2019
Visitors: 1329