View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 108_9_51 (Length: 413)

Name: 108_9_51
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 108_9_51
108_9_51
[»] chr3 (12 HSPs)
chr3 (1-307)||(28584946-28585254)
chr3 (7-307)||(26314859-26315160)
chr3 (20-307)||(28573717-28574000)
chr3 (1-307)||(28566971-28567273)
chr3 (96-173)||(20616242-20616319)
chr3 (304-392)||(28568141-28568228)
chr3 (304-392)||(28586194-28586281)
chr3 (305-392)||(28580037-28580123)
chr3 (304-392)||(20618388-20618475)
chr3 (305-392)||(28574984-28575070)
chr3 (307-392)||(26316042-26316126)
chr3 (251-307)||(20616052-20616108)
[»] chr6 (3 HSPs)
chr6 (1-307)||(24070401-24070704)
chr6 (1-307)||(24080032-24080335)
chr6 (305-392)||(24071665-24071751)
[»] scaffold0870 (1 HSPs)
scaffold0870 (304-392)||(4861-4948)
[»] scaffold0889 (1 HSPs)
scaffold0889 (304-385)||(4657-4737)
[»] chr2 (1 HSPs)
chr2 (96-167)||(2602442-2602513)


Alignment Details
Target: chr3 (Bit Score: 244; Significance: 1e-135; HSPs: 12)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 1 - 307
Target Start/End: Complemental strand, 28585254 - 28584946
Alignment:
1 actatgaaatgatttcttcattcaggtgggaaatcacaggtacagagcaacttccaaacttcatgaaaatagctttgaatgcactttacgacatcaccaa 100  Q
    ||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
28585254 actatgaaatgatttcttcattcaggtgggaaatcactggaacagagcaacttccaaacttcatgaaaatagctttgaatgcactttacgacattaccaa 28585155  T
101 taattttgctgaaatggtctacaaaaagcatggattcaaccctatagacacacttaaaaaatcggtacactaactagcc--nnnnnnnnnnnnnnccatc 198  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||                |||||    
28585154 taattttgctgaaatggtctacaaaaagcatggattcaaccctatagacacacttaaaaaatcggtacactaactagcctttttttttcttttttccatc 28585055  T
199 atatatataaattatgttttcaaatggctgagtatatataaaattatttgcgtgaaacagtgggtactcttattgaacgctttcatggaggaggctcatt 298  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28585054 atatatataaattatgttttcaaatggctgagtatatataaaattatttgcgtgaaacagtgggtactcttattgaacgctttcatggaggaggctcatt 28584955  T
299 ggttgaatt 307  Q
    |||||||||    
28584954 ggttgaatt 28584946  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 163; E-Value: 6e-87
Query Start/End: Original strand, 7 - 307
Target Start/End: Complemental strand, 26315160 - 26314859
Alignment:
7 aaatgatttcttcattcaggtgggaaatcacaggtacagagcaacttccaaacttcatgaaaatagctttgaatgcactttacgacatcaccaataattt 106  Q
    |||||||||||| |||||||||||||||||| || |||||||||||||||||||||||||||||| ||||||||||||||||||| || || | ||||||    
26315160 aaatgatttcttgattcaggtgggaaatcactggcacagagcaacttccaaacttcatgaaaatatctttgaatgcactttacgaaattactagtaattt 26315061  T
107 tgctgaaatggtctacaaaaagcatggattcaaccctatagacacacttaaaaaatcggtacactaactagccnnnnnnnnnnnnnnccatcatatat-- 204  Q
    |||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||               ||||||||||      
26315060 tgctgatatggtctacaaaaagcatggattcaaccctatagacactcttaaaaaatcggtacactaactagccgtcttttttattt--catcatatatac 26314963  T
205 ataaattatgttttcaaatggctgagtatatat-aaaattatttgcgtgaaacagtgggtactcttattgaacgctttcatggaggaggctcattggttg 303  Q
    |||||||||  |||||||||||||||||||| | ||||| ||||| |||||||||||| ||| ||||||||||||||||||||| |||||||||||||||    
26314962 ataaattattctttcaaatggctgagtatatgtaaaaatgatttgggtgaaacagtggatacgcttattgaacgctttcatggaagaggctcattggttg 26314863  T
304 aatt 307  Q
    ||||    
26314862 aatt 26314859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 20 - 307
Target Start/End: Complemental strand, 28574000 - 28573717
Alignment:
20 attcaggtgggaaatcacaggtacagagcaacttccaaacttcatgaaaatagctttgaatgcactttacgacatcaccaataattttgctgaaatggtc 119  Q
    ||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||    
28574000 attcaggtgggaattcactggtacagagcaacttccaaacttcatgaaaatagctttgaatgcactttacgacattaccaatagttttgctgaaatggtc 28573901  T
120 tacaaaaagcatggattcaaccctatagacacacttaaaaaatcggtacactaactagccnnnnnnnnnnnnnnccatcatatatataaattatgttttc 219  Q
    ||||||||||||||||| |||||||||||||| || ||||||||||||||||| ||| |                ||||||||||||||||||| |||||    
28573900 tacaaaaagcatggatttaaccctatagacactctcaaaaaatcggtacactagctatc--tgtcttctttatttcatcatatatataaattattttttc 28573803  T
220 aaatggctgagtatatataaaattatttgcgtgaaacagtgggtactcttattgaacgctttcatggaggaggctcattggttgaatt 307  Q
    |||   |||||  ||||||||| |||||| | |||||||||| ||||||||||||||||||||||||| ||||| |||||||||||||    
28573802 aaacaactgag--tatataaaaatatttgtgcgaaacagtggatactcttattgaacgctttcatggaagaggcccattggttgaatt 28573717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 143; E-Value: 5e-75
Query Start/End: Original strand, 1 - 307
Target Start/End: Complemental strand, 28567273 - 28566971
Alignment:
1 actatgaaatgatttcttcattcaggtgggaaatcacaggtacagagcaacttccaaacttcatgaaaatagctttgaatgcactttacgacatcaccaa 100  Q
    ||||||||||||||| || |||||||||||||| ||| || |||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||    
28567273 actatgaaatgattt-ttgattcaggtgggaaaccactggcacagagcaacttccaaacttcatgaaaatatctttgaatgcactttacgacattaccaa 28567175  T
101 taattttgctgaaatggtctacaaaaagcatggattcaaccctatagacacacttaaaaaatcggtacactaactagccnnnnnnnnnnnnnnccatcat 200  Q
    ||| ||||||||||  |||||||| ||||||||||| ||||||||||||||||| |||||||||||||||| |||| ||               ||||||    
28567174 taaatttgctgaaaatgtctacaagaagcatggatttaaccctatagacacactcaaaaaatcggtacacttactatccgtcttttttattt--catcat 28567077  T
201 atatataaatta-tgttttcaaatggctgagtatatataaaattatttgcgtgaaacagtgggtactcttattgaacgctttcatggaggaggctcattg 299  Q
    |||||||||||| | |||||||| ||||||   ||||||| | ||||||||||||||||||| ||| ||||||||||||||||||||| |||||||||||    
28567076 atatataaattatttttttcaaacggctga--ttatataataatatttgcgtgaaacagtggatacgcttattgaacgctttcatggaagaggctcattg 28566979  T
300 gttgaatt 307  Q
    ||||||||    
28566978 gttgaatt 28566971  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 96 - 173
Target Start/End: Complemental strand, 20616319 - 20616242
Alignment:
96 accaataattttgctgaaatggtctacaaaaagcatggattcaaccctatagacacacttaaaaaatcggtacactaa 173  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||| |||||    
20616319 accaataattttgctgaaatggtctacaaaaagcatggattcaaccctatagatacacttaaaatatcggtaaactaa 20616242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 304 - 392
Target Start/End: Complemental strand, 28568228 - 28568141
Alignment:
304 aattgattttgcgagtagccntgaactctatgaagttgcncttgccattccgcttgctgagacaaggnggccnttacgtaaatgcaggt 392  Q
    ||||||||||| |||||||| |||||||||||||||||| ||||| ||||||||||||||||||||| |||| ||||||||||||||||    
28568228 aattgattttgtgagtagccatgaactctatgaagttgcacttgc-attccgcttgctgagacaaggaggccattacgtaaatgcaggt 28568141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 304 - 392
Target Start/End: Complemental strand, 28586281 - 28586194
Alignment:
304 aattgattttgcgagtagccntgaactctatgaagttgcncttgccattccgcttgctgagacaaggnggccnttacgtaaatgcaggt 392  Q
    |||||||||||||||||||| |||| ||||||||||||| ||||| ||||||||||||||||||||| |||| ||||||||||||||||    
28586281 aattgattttgcgagtagccatgaaatctatgaagttgcacttgc-attccgcttgctgagacaaggaggccattacgtaaatgcaggt 28586194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 305 - 392
Target Start/End: Complemental strand, 28580123 - 28580037
Alignment:
305 attgattttgcgagtagccntgaactctatgaagttgcncttgccattccgcttgctgagacaaggnggccnttacgtaaatgcaggt 392  Q
    ||||||||||  ||||||| |||||||||||||||||| ||||| ||||||||||||||||||||| |||| ||||||||||||||||    
28580123 attgattttgtaagtagccatgaactctatgaagttgcacttgc-attccgcttgctgagacaaggaggccattacgtaaatgcaggt 28580037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 304 - 392
Target Start/End: Complemental strand, 20618475 - 20618388
Alignment:
304 aattgattttgcgagtagccntgaactctatgaagttgcncttgccattccgcttgctgagacaaggnggccnttacgtaaatgcaggt 392  Q
    |||||||||||  ||||||| |||||||||||||||||| |||| ||||||| ||||| |||||||| |||  ||| || |||||||||    
20618475 aattgattttgttagtagccatgaactctatgaagttgcacttg-cattccgtttgctcagacaaggaggctattatgtcaatgcaggt 20618388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 305 - 392
Target Start/End: Complemental strand, 28575070 - 28574984
Alignment:
305 attgattttgcgagtagccntgaactctatgaagttgcncttgccattccgcttgctgagacaaggnggccnttacgtaaatgcaggt 392  Q
    |||||||||| || ||||| ||||||||||||| || | ||||| ||||||||||||||||||||| ||||  || || |||||||||    
28575070 attgattttgtgaatagccatgaactctatgaattttcacttgc-attccgcttgctgagacaaggaggccactatgtcaatgcaggt 28574984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 307 - 392
Target Start/End: Complemental strand, 26316126 - 26316042
Alignment:
307 tgattttgcgagtagccntgaactctatgaagttgcncttgccattccgcttgctgagacaaggnggccnttacgtaaatgcaggt 392  Q
    |||||||  ||||| || ||||||||| |||||||| ||||| |||||||||||| |||||||| || | ||| ||||||||||||    
26316126 tgattttatgagtatccatgaactctacgaagttgcacttgc-attccgcttgctcagacaaggaggacattatgtaaatgcaggt 26316042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 251 - 307
Target Start/End: Complemental strand, 20616108 - 20616052
Alignment:
251 tgaaacagtgggtactcttattgaacgctttcatggaggaggctcattggttgaatt 307  Q
    ||||||||||||| | |||||| || |||||| || | |||||||||||||||||||    
20616108 tgaaacagtgggtgcgcttattaaatgctttcttgaaagaggctcattggttgaatt 20616052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 162; Significance: 2e-86; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 1 - 307
Target Start/End: Complemental strand, 24070704 - 24070401
Alignment:
1 actatgaaatgatttcttcattcaggtgggaaatcacaggtacagagcaacttccaaacttcatgaaaatagctttgaatgcactttacgacatcaccaa 100  Q
    ||||||||||||||| || |||||||||||||||||| || || ||||||||||||||||||||||||||| |||||||||||||||||||||| |||||    
24070704 actatgaaatgattt-ttgattcaggtgggaaatcactggcactgagcaacttccaaacttcatgaaaatatctttgaatgcactttacgacattaccaa 24070606  T
101 taattttgctgaaatggtctacaaaaagcatggattcaaccctatagacacacttaaaaaatcggtacactaactagccnnnnnnnnnnnnnnccatcat 200  Q
    |||||||||||||| ||||||||| |||||||||||||||||||||||||| ||||||||||||||| |||||||| ||                |||||    
24070605 taattttgctgaaaaggtctacaagaagcatggattcaaccctatagacactcttaaaaaatcggtatactaactaaccgtcttttatatttt--atcat 24070508  T
201 atatataaattatgttttcaaatggctgagtatatataaaattatttgcgtgaaacagtgggtactcttattgaacgctttcatggaggaggctcattgg 300  Q
    ||||||||||||  |||||||||| |||||| ||||||||| |||||| |||||||||||| ||| ||||||||||||||||||||| ||||||| ||||    
24070507 atatataaattaatttttcaaatgactgagtctatataaaactatttgggtgaaacagtggatacgcttattgaacgctttcatggaagaggctcgttgg 24070408  T
301 ttgaatt 307  Q
    |||||||    
24070407 ttgaatt 24070401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 1 - 307
Target Start/End: Original strand, 24080032 - 24080335
Alignment:
1 actatgaaatgatttcttcattcaggtgggaaatcacaggtacagagcaacttccaaacttcatgaaaatagctttgaatgcactttacgacatcaccaa 100  Q
    ||||||||||||||| || |||||||||||||||||| || || ||||||||||||||||||||||||||| |||||||||||||||||||||| |||||    
24080032 actatgaaatgattt-ttgattcaggtgggaaatcactggcactgagcaacttccaaacttcatgaaaatatctttgaatgcactttacgacattaccaa 24080130  T
101 taattttgctgaaatggtctacaaaaagcatggattcaaccctatagacacacttaaaaaatcggtacactaactagccnnnnnnnnnnnnnnccatcat 200  Q
    |||||||||||||| ||||||||| |||||||||||||||||||||||||| |||||||||| |||| |||||||| ||                |||||    
24080131 taattttgctgaaaaggtctacaagaagcatggattcaaccctatagacactcttaaaaaatgggtatactaactaaccgtcttttatatttt--atcat 24080228  T
201 atatataaattatgttttcaaatggctgagtatatataaaattatttgcgtgaaacagtgggtactcttattgaacgctttcatggaggaggctcattgg 300  Q
    ||||||||||||| |||||||||| |||||| ||||||||| |||||| |||||||||||| ||| ||||||||||||||||||||| ||||||| ||||    
24080229 atatataaattattttttcaaatgactgagtctatataaaactatttgggtgaaacagtggatacgcttattgaacgctttcatggaagaggctcgttgg 24080328  T
301 ttgaatt 307  Q
    |||||||    
24080329 ttgaatt 24080335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 305 - 392
Target Start/End: Complemental strand, 24071751 - 24071665
Alignment:
305 attgattttgcgagtagccntgaactctatgaagttgcncttgccattccgcttgctgagacaaggnggccnttacgtaaatgcaggt 392  Q
    |||||||||| |||||||| |||||||||| ||||||| ||||| |||||||||||| |||||||| |||| ||| ||||||||||||    
24071751 attgattttgtgagtagccatgaactctatcaagttgcacttgc-attccgcttgctcagacaaggaggccattatgtaaatgcaggt 24071665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0870 (Bit Score: 65; Significance: 2e-28; HSPs: 1)
Name: scaffold0870
Description:

Target: scaffold0870; HSP #1
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 304 - 392
Target Start/End: Original strand, 4861 - 4948
Alignment:
304 aattgattttgcgagtagccntgaactctatgaagttgcncttgccattccgcttgctgagacaaggnggccnttacgtaaatgcaggt 392  Q
    ||||||||||| |||||||| |||||||||||||||||| ||||| ||||||||||||||||||||| |||| ||||||||||||||||    
4861 aattgattttgtgagtagccatgaactctatgaagttgcacttgc-attccgcttgctgagacaaggaggccattacgtaaatgcaggt 4948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0889 (Bit Score: 58; Significance: 3e-24; HSPs: 1)
Name: scaffold0889
Description:

Target: scaffold0889; HSP #1
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 304 - 385
Target Start/End: Original strand, 4657 - 4737
Alignment:
304 aattgattttgcgagtagccntgaactctatgaagttgcncttgccattccgcttgctgagacaaggnggccnttacgtaaa 385  Q
    ||||||||||| |||||||| |||||||||||||||||| |||| |||||||||||||||||||||| |||| |||||||||    
4657 aattgattttgtgagtagccatgaactctatgaagttgcacttg-cattccgcttgctgagacaaggaggccattacgtaaa 4737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 44; Significance: 6e-16; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 96 - 167
Target Start/End: Original strand, 2602442 - 2602513
Alignment:
96 accaataattttgctgaaatggtctacaaaaagcatggattcaaccctatagacacacttaaaaaatcggta 167  Q
    |||||| |||| ||||||| ||||||||||||||||||||| ||||||||  | ||||||||||||||||||    
2602442 accaatgatttcgctgaaaaggtctacaaaaagcatggattgaaccctatcaaaacacttaaaaaatcggta 2602513  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 310045 times since January 2019
Visitors: 444