View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 108_9_63 (Length: 787)

Name: 108_9_63
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 108_9_63
108_9_63
[»] chr3 (2 HSPs)
chr3 (1-560)||(41448791-41449349)
chr3 (553-787)||(41448548-41448795)


Alignment Details
Target: chr3 (Bit Score: 508; Significance: 0; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 508; E-Value: 0
Query Start/End: Original strand, 1 - 560
Target Start/End: Original strand, 41448791 - 41449349
Alignment:
1 tcttctttaactagcatggcaagaacattaagtgaactccatgttttcgtcacgttgctgttcgaatctcccaaagtaacagcaaagactgcatcatatc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
41448791 tcttctttaactagcatggcaagaacattaagtgaactccatgttttcgtcacgttgctgttcgaatctcccaaagtaacagcgaagactgcatcatatc 41448890  T
101 ctcctgctcctggaactccagctaacaatactccttccaagttcattgtagcgtctagaagatgtgtttgtgattctggttcaatctgtatacattgcaa 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
41448891 ctcctgctcctggaactccagctaacaatactccttccaagttcattgtagcatctagaagatgtgtttgtgattctggttcaatctgtatacattgcaa 41448990  T
201 cttatgagattgctgaaatcatgaactgtttaaatgatcgatcaatcaggaaagtaaatgtgagtttctaacaccaaaactctgactacacttcaataca 300  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41448991 cttatgagattgctgaaatcatgaacggtttaaatgatcgatcaatcaggaaagtaaatgtgagtttctaacaccaaaactctgactacacttcaataca 41449090  T
301 tattataaaagctgaacaacgtgtaagtatagcatttatgctaataggctctataaacacgatgtaagatggtatctgaacagtaaaaacggtcttatga 400  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
41449091 tattataaaagctgaacaccgtgtaagtatagcatttatgctaataggctctataaacacgatgt-agatggtatctgaacagtaaaaacggtcttatga 41449189  T
401 atgaatcatggcgttcataactaacaagtcagaacaaagcaagtcnnnnnnnnaactgaaccagagttttctttttcttttatggttactttatcaaatg 500  Q
    ||||| |||||||||||||||||||||||||||||||||||||||        |||||||||||||||||||||||||||||||||||||||||||||||    
41449190 atgaaccatggcgttcataactaacaagtcagaacaaagcaagtcttttttttaactgaaccagagttttctttttcttttatggttactttatcaaatg 41449289  T
501 gcctgatcaaaggtacaaaaagaaactgtccatacagcaggttcataggtagtcaattgt 560  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41449290 gcctgatcaaaggtacaaaaagaaactgtccatacagcaggttcataggtagtcaattgt 41449349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 196; E-Value: 1e-106
Query Start/End: Original strand, 553 - 787
Target Start/End: Original strand, 41448548 - 41448795
Alignment:
553 tcaattgtaaacccaaacactattggaggagaatac-------------aaaaaacccactcatttttccccctaaaatcggaaagaaacaaatgcctag 639  Q
    ||||||||||||||||||||||||||||||||||||             |||||||||||||||||||||||||||||||||||||||||||||||||||    
41448548 tcaattgtaaacccaaacactattggaggagaatacgaaaaaccaacacaaaaaacccactcatttttccccctaaaatcggaaagaaacaaatgcctag 41448647  T
640 tctaaaagctacattccacataatattttcgtggtgacttatttcattgatgaaaataaacttaatctatatgaatagaagacgcagctgatgtgatttc 739  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
41448648 tctaaaagctacattccacataatattttcgtggtgacttatttctttgatgaaaataaacttaatctatatgaatagaagacacagctgatgtgatttc 41448747  T
740 attggttcttgggtcagcactttctaatgaaactccacaaggatcttc 787  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
41448748 attggttcttgggtcagcactttctaatgaaactccacaaggatcttc 41448795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 105848 times since January 2019
Visitors: 1319