View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 108_9_85 (Length: 537)

Name: 108_9_85
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 108_9_85
108_9_85
[»] chr5 (59 HSPs)
chr5 (1-366)||(33806561-33806926)
chr5 (361-514)||(33816789-33816942)
chr5 (400-535)||(33818571-33818706)
chr5 (401-531)||(23423770-23423900)
chr5 (400-535)||(618288-618423)
chr5 (400-535)||(16121849-16121984)
chr5 (420-537)||(25397796-25397913)
chr5 (406-535)||(17039641-17039770)
chr5 (400-535)||(2472724-2472859)
chr5 (400-535)||(35620354-35620488)
chr5 (401-535)||(23975630-23975764)
chr5 (420-535)||(746878-746993)
chr5 (400-535)||(7888791-7888926)
chr5 (400-535)||(8108870-8109005)
chr5 (400-535)||(8886861-8886996)
chr5 (400-535)||(12045721-12045856)
chr5 (400-535)||(12328236-12328371)
chr5 (400-535)||(15060967-15061102)
chr5 (400-535)||(36196388-36196523)
chr5 (400-535)||(25652593-25652728)
chr5 (400-529)||(17986723-17986852)
chr5 (400-529)||(25673245-25673373)
chr5 (401-529)||(13620143-13620271)
chr5 (401-529)||(20959503-20959631)
chr5 (416-535)||(26708595-26708714)
chr5 (416-535)||(26978329-26978448)
chr5 (401-529)||(27428028-27428156)
chr5 (420-535)||(38837681-38837796)
chr5 (406-530)||(7003745-7003867)
chr5 (420-520)||(10494751-10494851)
chr5 (400-535)||(17036422-17036557)
chr5 (401-529)||(28265491-28265619)
chr5 (400-535)||(36831900-36832035)
chr5 (406-535)||(23408980-23409110)
chr5 (400-535)||(5982639-5982775)
chr5 (401-530)||(10420267-10420396)
chr5 (420-529)||(16631890-16631999)
chr5 (400-503)||(17079399-17079502)
chr5 (400-535)||(11927796-11927931)
chr5 (416-535)||(24138851-24138970)
chr5 (420-535)||(36597350-36597465)
chr5 (420-529)||(4125204-4125313)
chr5 (420-529)||(17771984-17772093)
chr5 (400-535)||(13974088-13974223)
chr5 (401-535)||(20187951-20188085)
chr5 (406-536)||(32726735-32726865)
chr5 (400-537)||(3080704-3080841)
chr5 (400-537)||(33734981-33735117)
chr5 (400-530)||(36716215-36716345)
chr5 (420-529)||(40484058-40484167)
chr5 (420-529)||(35778155-35778264)
chr5 (418-537)||(23974584-23974703)
chr5 (400-514)||(18413550-18413664)
chr5 (425-502)||(31853131-31853208)
chr5 (420-514)||(9024227-9024322)
chr5 (400-463)||(29727928-29727991)
chr5 (401-502)||(16472223-16472325)
chr5 (412-514)||(5043542-5043644)
chr5 (420-463)||(16464692-16464735)
[»] chr3 (87 HSPs)
chr3 (407-537)||(19610335-19610465)
chr3 (400-537)||(16299851-16299988)
chr3 (400-537)||(29215982-29216119)
chr3 (400-537)||(30219328-30219465)
chr3 (420-537)||(15064000-15064117)
chr3 (400-535)||(18104540-18104675)
chr3 (400-535)||(19269874-19270009)
chr3 (400-535)||(27449078-27449213)
chr3 (406-535)||(5260933-5261062)
chr3 (400-530)||(17762632-17762762)
chr3 (400-530)||(19063952-19064082)
chr3 (406-535)||(25882566-25882695)
chr3 (400-529)||(8428161-8428290)
chr3 (400-529)||(49915441-49915570)
chr3 (400-535)||(11915748-11915883)
chr3 (400-535)||(18091557-18091692)
chr3 (420-537)||(5744426-5744543)
chr3 (420-537)||(5781385-5781502)
chr3 (406-535)||(19223445-19223574)
chr3 (400-537)||(21020055-21020192)
chr3 (400-514)||(17582332-17582446)
chr3 (400-535)||(8110329-8110464)
chr3 (400-535)||(18539794-18539929)
chr3 (420-535)||(26098823-26098938)
chr3 (400-535)||(26390644-26390779)
chr3 (416-535)||(48404866-48404985)
chr3 (401-535)||(11007693-11007827)
chr3 (400-529)||(29956362-29956491)
chr3 (400-529)||(30005517-30005646)
chr3 (420-536)||(50665645-50665761)
chr3 (400-535)||(4393360-4393495)
chr3 (400-535)||(9652568-9652703)
chr3 (416-535)||(13921331-13921450)
chr3 (406-514)||(19545506-19545614)
chr3 (418-535)||(10941675-10941792)
chr3 (400-529)||(26830457-26830587)
chr3 (436-537)||(37283549-37283650)
chr3 (407-535)||(1310969-1311097)
chr3 (416-529)||(21816727-21816840)
chr3 (400-529)||(36543739-36543868)
chr3 (401-529)||(1628206-1628334)
chr3 (401-514)||(28389964-28390077)
chr3 (409-535)||(31250087-31250213)
chr3 (416-536)||(21088758-21088876)
chr3 (400-529)||(7623547-7623676)
chr3 (400-529)||(31433727-31433856)
chr3 (409-530)||(46942486-46942607)
chr3 (420-535)||(1745498-1745612)
chr3 (420-535)||(3461320-3461435)
chr3 (406-530)||(11219134-11219258)
chr3 (410-530)||(11837229-11837349)
chr3 (420-535)||(13905048-13905163)
chr3 (416-535)||(29236050-29236169)
chr3 (400-535)||(29704042-29704177)
chr3 (420-530)||(23773487-23773597)
chr3 (400-529)||(23217224-23217353)
chr3 (400-514)||(27212812-27212926)
chr3 (416-529)||(28859597-28859710)
chr3 (400-529)||(36564455-36564584)
chr3 (420-535)||(5565732-5565847)
chr3 (400-535)||(27968905-27969040)
chr3 (420-535)||(43329773-43329888)
chr3 (420-535)||(46012738-46012853)
chr3 (416-535)||(47263275-47263394)
chr3 (408-530)||(27182673-27182793)
chr3 (423-514)||(6718723-6718814)
chr3 (401-530)||(8543460-8543588)
chr3 (400-503)||(11085384-11085487)
chr3 (406-528)||(10803716-10803839)
chr3 (430-535)||(8546265-8546370)
chr3 (420-503)||(17269646-17269729)
chr3 (400-529)||(18380014-18380143)
chr3 (420-530)||(21490049-21490159)
chr3 (408-502)||(20088398-20088492)
chr3 (401-535)||(15490026-15490159)
chr3 (456-535)||(20761960-20762039)
chr3 (400-530)||(29451084-29451214)
chr3 (400-529)||(20615359-20615488)
chr3 (420-535)||(6088238-6088353)
chr3 (400-537)||(6447254-6447391)
chr3 (416-529)||(10772069-10772183)
chr3 (420-514)||(50240756-50240850)
chr3 (420-494)||(23233214-23233288)
chr3 (410-530)||(26963264-26963384)
chr3 (416-465)||(35579605-35579654)
chr3 (428-476)||(27711237-27711285)
chr3 (416-531)||(45304340-45304455)
[»] chr6 (74 HSPs)
chr6 (400-537)||(22083832-22083969)
chr6 (400-537)||(12951702-12951839)
chr6 (400-537)||(18033534-18033670)
chr6 (400-535)||(9892957-9893092)
chr6 (400-537)||(2992609-2992746)
chr6 (420-529)||(11077663-11077772)
chr6 (400-535)||(6598458-6598593)
chr6 (400-535)||(15364468-15364603)
chr6 (400-535)||(24661019-24661154)
chr6 (401-529)||(25397997-25398125)
chr6 (400-535)||(28364905-28365040)
chr6 (400-535)||(12200688-12200823)
chr6 (400-535)||(14886555-14886690)
chr6 (400-535)||(22579359-22579494)
chr6 (400-535)||(26224422-26224557)
chr6 (406-535)||(495637-495766)
chr6 (400-530)||(11049766-11049896)
chr6 (420-537)||(14872133-14872250)
chr6 (401-537)||(11530220-11530356)
chr6 (400-529)||(26939581-26939710)
chr6 (400-537)||(6978273-6978408)
chr6 (401-527)||(12844998-12845124)
chr6 (400-530)||(33250723-33250853)
chr6 (400-535)||(1939252-1939387)
chr6 (400-535)||(21140933-21141068)
chr6 (401-527)||(12351604-12351730)
chr6 (400-530)||(22055627-22055757)
chr6 (401-530)||(18048783-18048912)
chr6 (400-529)||(20182139-20182268)
chr6 (400-529)||(22153723-22153852)
chr6 (400-503)||(27705416-27705519)
chr6 (400-535)||(2669303-2669438)
chr6 (400-535)||(27796844-27796979)
chr6 (406-535)||(21990185-21990313)
chr6 (420-535)||(6605506-6605621)
chr6 (416-535)||(15448395-15448514)
chr6 (401-521)||(23281781-23281901)
chr6 (435-535)||(14772690-14772790)
chr6 (400-535)||(9885237-9885372)
chr6 (400-535)||(18492363-18492498)
chr6 (425-535)||(5360428-5360538)
chr6 (401-535)||(16250812-16250946)
chr6 (420-530)||(12499230-12499340)
chr6 (420-530)||(12506559-12506669)
chr6 (420-530)||(12509561-12509671)
chr6 (406-535)||(30833970-30834099)
chr6 (420-529)||(28668114-28668223)
chr6 (420-535)||(5192199-5192314)
chr6 (400-494)||(14036614-14036708)
chr6 (400-502)||(21691539-21691641)
chr6 (400-529)||(12160863-12160991)
chr6 (420-503)||(13145016-13145099)
chr6 (420-503)||(33547560-33547643)
chr6 (401-514)||(343594-343707)
chr6 (400-535)||(9060085-9060219)
chr6 (420-537)||(11350196-11350310)
chr6 (400-508)||(17919530-17919638)
chr6 (436-529)||(15509186-15509279)
chr6 (420-535)||(15961417-15961532)
chr6 (400-494)||(19175828-19175921)
chr6 (420-537)||(1954895-1955011)
chr6 (420-537)||(6065451-6065568)
chr6 (400-537)||(16118140-16118277)
chr6 (407-535)||(12157386-12157514)
chr6 (449-529)||(10458807-10458887)
chr6 (425-529)||(12205201-12205305)
chr6 (424-530)||(10929511-10929618)
chr6 (420-530)||(20692826-20692936)
chr6 (401-503)||(5270387-5270490)
chr6 (401-470)||(11431715-11431784)
chr6 (462-529)||(5250195-5250262)
chr6 (409-537)||(30745727-30745853)
chr6 (447-494)||(3673184-3673231)
chr6 (420-488)||(16764825-16764893)
[»] chr7 (64 HSPs)
chr7 (401-537)||(39979632-39979768)
chr7 (400-528)||(36636500-36636628)
chr7 (400-537)||(40847443-40847580)
chr7 (400-535)||(23232033-23232168)
chr7 (400-535)||(28800872-28801007)
chr7 (400-529)||(15014421-15014550)
chr7 (400-535)||(22486388-22486523)
chr7 (400-529)||(47523666-47523795)
chr7 (400-535)||(27806012-27806147)
chr7 (420-537)||(1824208-1824325)
chr7 (400-537)||(20174014-20174151)
chr7 (406-535)||(21917344-21917473)
chr7 (420-537)||(26577279-26577396)
chr7 (400-537)||(36993814-36993951)
chr7 (400-528)||(7733329-7733457)
chr7 (401-514)||(23577220-23577333)
chr7 (400-535)||(31425521-31425656)
chr7 (400-537)||(2457664-2457799)
chr7 (400-537)||(1907349-1907486)
chr7 (420-537)||(4514779-4514896)
chr7 (406-535)||(18217829-18217958)
chr7 (410-535)||(1842898-1843023)
chr7 (406-535)||(11036507-11036636)
chr7 (400-537)||(24140444-24140581)
chr7 (400-530)||(37135300-37135430)
chr7 (400-514)||(10050867-10050981)
chr7 (400-529)||(24605832-24605961)
chr7 (406-530)||(23750751-23750875)
chr7 (400-535)||(48933130-48933265)
chr7 (406-514)||(45664768-45664876)
chr7 (400-535)||(20429459-20429594)
chr7 (400-530)||(816206-816336)
chr7 (406-535)||(6849221-6849350)
chr7 (406-535)||(9698548-9698677)
chr7 (400-529)||(42926435-42926565)
chr7 (400-503)||(31042245-31042348)
chr7 (400-503)||(38057626-38057729)
chr7 (420-535)||(3872197-3872312)
chr7 (420-535)||(3904488-3904603)
chr7 (419-535)||(11852021-11852137)
chr7 (400-529)||(20923974-20924103)
chr7 (400-529)||(23699841-23699970)
chr7 (416-520)||(21623031-21623135)
chr7 (400-535)||(22501588-22501723)
chr7 (406-530)||(27304872-27304994)
chr7 (409-535)||(32267350-32267475)
chr7 (412-530)||(14786650-14786768)
chr7 (422-535)||(23539248-23539361)
chr7 (420-530)||(33427704-33427813)
chr7 (400-514)||(11890178-11890292)
chr7 (424-529)||(2650844-2650949)
chr7 (418-494)||(15969796-15969872)
chr7 (400-530)||(21871566-21871692)
chr7 (420-536)||(1822005-1822118)
chr7 (400-529)||(25777128-25777257)
chr7 (400-529)||(26415418-26415547)
chr7 (401-503)||(27130329-27130429)
chr7 (401-494)||(15330256-15330349)
chr7 (400-483)||(687871-687954)
chr7 (438-536)||(1841792-1841889)
chr7 (401-527)||(10222648-10222773)
chr7 (420-529)||(2093378-2093487)
chr7 (400-529)||(27132737-27132866)
chr7 (479-531)||(38090336-38090388)
[»] chr2 (55 HSPs)
chr2 (400-535)||(41637608-41637743)
chr2 (400-537)||(30783328-30783465)
chr2 (400-537)||(31266344-31266481)
chr2 (400-535)||(29749413-29749548)
chr2 (400-537)||(27327606-27327743)
chr2 (400-537)||(28841350-28841487)
chr2 (400-535)||(32300441-32300576)
chr2 (411-535)||(28319589-28319713)
chr2 (400-535)||(1141526-1141661)
chr2 (400-535)||(15636745-15636880)
chr2 (400-535)||(18551263-18551398)
chr2 (401-530)||(23388393-23388522)
chr2 (400-535)||(13788065-13788200)
chr2 (400-535)||(20065084-20065219)
chr2 (400-535)||(22140374-22140509)
chr2 (400-535)||(41736162-41736297)
chr2 (406-535)||(32008948-32009078)
chr2 (400-530)||(21293726-21293856)
chr2 (400-530)||(32185822-32185952)
chr2 (400-530)||(44366012-44366142)
chr2 (400-535)||(14757131-14757266)
chr2 (400-531)||(26687704-26687836)
chr2 (401-529)||(37724008-37724136)
chr2 (420-535)||(43408521-43408636)
chr2 (400-530)||(8430286-8430416)
chr2 (400-536)||(18916410-18916545)
chr2 (400-483)||(27523001-27523084)
chr2 (416-535)||(12779606-12779725)
chr2 (401-529)||(28262355-28262483)
chr2 (416-535)||(37552233-37552352)
chr2 (408-535)||(44722930-44723057)
chr2 (412-529)||(13613109-13613226)
chr2 (416-535)||(23857968-23858086)
chr2 (420-535)||(44476385-44476500)
chr2 (420-535)||(7093578-7093693)
chr2 (400-519)||(40018792-40018911)
chr2 (453-535)||(27039918-27040000)
chr2 (430-528)||(35697475-35697573)
chr2 (406-537)||(18609510-18609641)
chr2 (420-535)||(26243331-26243446)
chr2 (418-530)||(36550844-36550955)
chr2 (406-537)||(37802387-37802517)
chr2 (420-535)||(38362281-38362396)
chr2 (400-529)||(2556085-2556214)
chr2 (416-531)||(8763640-8763755)
chr2 (400-530)||(36373890-36374018)
chr2 (401-519)||(13134646-13134764)
chr2 (400-494)||(9004359-9004453)
chr2 (400-451)||(22192182-22192233)
chr2 (401-471)||(29998633-29998703)
chr2 (422-514)||(31966556-31966647)
chr2 (400-451)||(27058410-27058461)
chr2 (401-528)||(9590461-9590588)
chr2 (463-530)||(16098932-16098999)
chr2 (406-497)||(13436685-13436776)
[»] scaffold0047 (1 HSPs)
scaffold0047 (401-537)||(58577-58713)
[»] chr1 (74 HSPs)
chr1 (400-535)||(50845340-50845475)
chr1 (400-537)||(13102310-13102447)
chr1 (401-535)||(12720804-12720938)
chr1 (400-535)||(14760861-14760996)
chr1 (401-537)||(7830026-7830162)
chr1 (400-528)||(6459211-6459339)
chr1 (400-535)||(9109985-9110120)
chr1 (400-535)||(45839286-45839421)
chr1 (400-535)||(41752427-41752562)
chr1 (400-529)||(22158796-22158925)
chr1 (400-535)||(6412063-6412198)
chr1 (406-537)||(16913585-16913716)
chr1 (400-529)||(9464097-9464226)
chr1 (400-514)||(15243079-15243193)
chr1 (400-529)||(22789607-22789736)
chr1 (400-535)||(20408170-20408305)
chr1 (401-529)||(38531186-38531314)
chr1 (400-535)||(52183672-52183807)
chr1 (400-537)||(18894908-18895045)
chr1 (408-514)||(12174797-12174903)
chr1 (416-535)||(4340417-4340536)
chr1 (400-520)||(41071860-41071980)
chr1 (410-535)||(46339455-46339580)
chr1 (400-529)||(12161808-12161937)
chr1 (400-529)||(19081722-19081851)
chr1 (400-529)||(19129610-19129739)
chr1 (420-529)||(19865258-19865367)
chr1 (400-529)||(23457891-23458020)
chr1 (400-535)||(17661044-17661179)
chr1 (400-535)||(22603542-22603677)
chr1 (420-535)||(28229465-28229580)
chr1 (416-535)||(41120747-41120866)
chr1 (420-535)||(46790014-46790129)
chr1 (401-535)||(48522513-48522647)
chr1 (406-535)||(29549418-29549547)
chr1 (400-535)||(12989846-12989981)
chr1 (416-535)||(46785968-46786087)
chr1 (401-535)||(18890559-18890693)
chr1 (406-535)||(7181565-7181694)
chr1 (400-530)||(9985342-9985472)
chr1 (400-530)||(17200025-17200155)
chr1 (400-537)||(30928386-30928523)
chr1 (415-529)||(50092314-50092428)
chr1 (400-503)||(13523003-13523106)
chr1 (400-529)||(46865237-46865366)
chr1 (406-530)||(9259198-9259322)
chr1 (400-537)||(17733961-17734099)
chr1 (406-514)||(32046876-32046984)
chr1 (420-530)||(13308835-13308945)
chr1 (400-514)||(41063191-41063305)
chr1 (437-535)||(25788007-25788105)
chr1 (416-530)||(9177110-9177224)
chr1 (400-483)||(12370003-12370086)
chr1 (420-535)||(8941004-8941119)
chr1 (400-535)||(13195577-13195712)
chr1 (420-509)||(41359001-41359091)
chr1 (400-537)||(11917780-11917916)
chr1 (410-535)||(51973428-51973553)
chr1 (400-529)||(20290337-20290465)
chr1 (420-537)||(12806844-12806963)
chr1 (447-529)||(27253871-27253953)
chr1 (401-529)||(20580904-20581033)
chr1 (400-497)||(16258534-16258631)
chr1 (400-535)||(18787923-18788055)
chr1 (412-514)||(26825246-26825348)
chr1 (401-503)||(29093596-29093698)
chr1 (420-514)||(9882071-9882162)
chr1 (416-537)||(39748943-39749064)
chr1 (420-537)||(49881058-49881174)
chr1 (400-535)||(6775881-6776015)
chr1 (421-494)||(45918955-45919028)
chr1 (416-497)||(30673504-30673585)
chr1 (400-468)||(52621148-52621216)
chr1 (415-470)||(25687355-25687410)
[»] chr8 (63 HSPs)
chr8 (401-535)||(17824626-17824760)
chr8 (400-530)||(17103880-17104010)
chr8 (400-535)||(33652559-33652694)
chr8 (400-535)||(24576034-24576169)
chr8 (406-535)||(8555314-8555443)
chr8 (400-535)||(3823125-3823260)
chr8 (400-535)||(4330970-4331105)
chr8 (400-535)||(17810290-17810425)
chr8 (400-535)||(18010070-18010205)
chr8 (400-535)||(19240859-19240994)
chr8 (400-535)||(19314043-19314178)
chr8 (400-535)||(27910774-27910909)
chr8 (400-535)||(27957193-27957328)
chr8 (400-537)||(37992091-37992228)
chr8 (400-535)||(29350915-29351051)
chr8 (400-535)||(22939305-22939440)
chr8 (400-535)||(24193206-24193341)
chr8 (400-535)||(27869230-27869365)
chr8 (406-529)||(43431575-43431698)
chr8 (400-537)||(6816391-6816528)
chr8 (401-537)||(18844552-18844688)
chr8 (416-535)||(11938753-11938871)
chr8 (416-535)||(19256220-19256339)
chr8 (420-535)||(19488071-19488186)
chr8 (400-535)||(21350470-21350605)
chr8 (400-535)||(32961651-32961786)
chr8 (441-537)||(8789873-8789969)
chr8 (420-535)||(10917839-10917954)
chr8 (420-535)||(13060941-13061056)
chr8 (400-530)||(4647770-4647900)
chr8 (400-529)||(40289437-40289565)
chr8 (416-520)||(5670194-5670298)
chr8 (400-535)||(9915051-9915185)
chr8 (420-524)||(26399028-26399132)
chr8 (416-535)||(30687944-30688063)
chr8 (420-535)||(32247921-32248036)
chr8 (416-531)||(24636660-24636775)
chr8 (400-503)||(5879196-5879299)
chr8 (423-535)||(25655868-25655980)
chr8 (400-535)||(6817046-6817181)
chr8 (401-529)||(16061955-16062083)
chr8 (409-529)||(29345072-29345192)
chr8 (416-535)||(30466964-30467083)
chr8 (416-529)||(25000447-25000560)
chr8 (420-535)||(23752296-23752411)
chr8 (420-530)||(31399523-31399633)
chr8 (420-535)||(8824837-8824952)
chr8 (420-509)||(19493691-19493781)
chr8 (420-535)||(25273338-25273452)
chr8 (400-535)||(15251595-15251728)
chr8 (400-535)||(9631395-9631531)
chr8 (406-529)||(31344188-31344311)
chr8 (420-529)||(33412992-33413095)
chr8 (465-535)||(25274654-25274724)
chr8 (400-514)||(21219271-21219383)
chr8 (420-514)||(41527731-41527825)
chr8 (400-502)||(3692214-3692316)
chr8 (438-535)||(6084256-6084351)
chr8 (459-529)||(42700673-42700743)
chr8 (424-497)||(15289660-15289731)
chr8 (424-497)||(15470029-15470100)
chr8 (416-535)||(17003270-17003389)
chr8 (456-537)||(2265387-2265467)
[»] scaffold0058 (1 HSPs)
scaffold0058 (400-537)||(74549-74686)
[»] chr4 (61 HSPs)
chr4 (400-537)||(5399601-5399738)
chr4 (400-536)||(25147713-25147849)
chr4 (400-537)||(33914051-33914188)
chr4 (400-529)||(2275694-2275823)
chr4 (423-537)||(9058960-9059074)
chr4 (400-530)||(22128327-22128457)
chr4 (406-535)||(32175747-32175876)
chr4 (400-535)||(55309222-55309358)
chr4 (400-535)||(22168260-22168395)
chr4 (400-535)||(37378633-37378768)
chr4 (400-535)||(46286239-46286374)
chr4 (400-530)||(1638439-1638569)
chr4 (406-535)||(27040035-27040164)
chr4 (400-535)||(19839171-19839306)
chr4 (400-535)||(8878875-8879010)
chr4 (400-535)||(18051831-18051966)
chr4 (400-494)||(22156652-22156746)
chr4 (406-535)||(5473847-5473976)
chr4 (406-535)||(45532589-45532718)
chr4 (400-529)||(38223502-38223631)
chr4 (416-535)||(4586768-4586887)
chr4 (406-535)||(13564925-13565054)
chr4 (420-529)||(9670495-9670604)
chr4 (400-529)||(19680440-19680569)
chr4 (420-535)||(29625337-29625452)
chr4 (420-535)||(38645762-38645877)
chr4 (401-535)||(44783475-44783610)
chr4 (401-535)||(12071955-12072089)
chr4 (400-529)||(24682343-24682470)
chr4 (400-529)||(9913250-9913379)
chr4 (416-529)||(25026565-25026678)
chr4 (416-535)||(13028826-13028945)
chr4 (416-535)||(18714910-18715029)
chr4 (400-535)||(30268998-30269133)
chr4 (400-535)||(30283056-30283191)
chr4 (420-535)||(30507999-30508114)
chr4 (423-535)||(9238635-9238747)
chr4 (420-529)||(9239297-9239406)
chr4 (400-514)||(18744101-18744215)
chr4 (401-530)||(36689670-36689799)
chr4 (420-535)||(7111956-7112071)
chr4 (400-535)||(16915361-16915496)
chr4 (420-535)||(38619859-38619974)
chr4 (400-530)||(30568014-30568144)
chr4 (420-514)||(14944758-14944852)
chr4 (416-535)||(54539294-54539413)
chr4 (420-537)||(4606837-4606954)
chr4 (400-530)||(29238415-29238545)
chr4 (420-529)||(12105995-12106103)
chr4 (401-535)||(3612988-3613123)
chr4 (416-535)||(4627088-4627207)
chr4 (400-535)||(30420043-30420178)
chr4 (410-480)||(37761907-37761977)
chr4 (420-514)||(6553816-6553910)
chr4 (400-530)||(39234934-39235063)
chr4 (448-535)||(42055437-42055524)
chr4 (424-514)||(313603-313693)
chr4 (416-529)||(34557191-34557304)
chr4 (416-472)||(45091282-45091338)
chr4 (431-502)||(23104371-23104442)
chr4 (401-529)||(25225092-25225218)
[»] scaffold0069 (1 HSPs)
scaffold0069 (401-537)||(10153-10289)
[»] scaffold0219 (1 HSPs)
scaffold0219 (400-535)||(19597-19732)
[»] scaffold0576 (1 HSPs)
scaffold0576 (400-535)||(9239-9374)
[»] scaffold0001 (3 HSPs)
scaffold0001 (400-535)||(8120-8255)
scaffold0001 (400-535)||(21852-21987)
scaffold0001 (400-535)||(84297-84432)
[»] scaffold0603 (1 HSPs)
scaffold0603 (400-530)||(5994-6124)
[»] scaffold0717 (1 HSPs)
scaffold0717 (400-535)||(928-1064)
[»] scaffold0599 (1 HSPs)
scaffold0599 (400-535)||(7499-7634)
[»] scaffold0502 (1 HSPs)
scaffold0502 (400-537)||(10886-11023)
[»] scaffold0007 (3 HSPs)
scaffold0007 (410-535)||(3746-3871)
scaffold0007 (401-529)||(202769-202897)
scaffold0007 (400-472)||(276207-276279)
[»] scaffold0087 (1 HSPs)
scaffold0087 (400-518)||(37814-37932)
[»] scaffold0076 (1 HSPs)
scaffold0076 (406-535)||(26483-26612)
[»] scaffold0006 (2 HSPs)
scaffold0006 (420-535)||(84684-84799)
scaffold0006 (408-529)||(121003-121124)
[»] scaffold0240 (1 HSPs)
scaffold0240 (416-535)||(15000-15119)
[»] scaffold0128 (1 HSPs)
scaffold0128 (416-535)||(10673-10792)
[»] scaffold0108 (1 HSPs)
scaffold0108 (400-535)||(12647-12781)
[»] scaffold0014 (1 HSPs)
scaffold0014 (416-535)||(22221-22340)
[»] scaffold0009 (3 HSPs)
scaffold0009 (400-535)||(219630-219765)
scaffold0009 (420-529)||(182544-182653)
scaffold0009 (420-535)||(215673-215781)
[»] scaffold0655 (1 HSPs)
scaffold0655 (400-529)||(3178-3305)
[»] scaffold0161 (1 HSPs)
scaffold0161 (400-535)||(6789-6924)
[»] scaffold0023 (1 HSPs)
scaffold0023 (400-535)||(39713-39848)
[»] scaffold0035 (1 HSPs)
scaffold0035 (400-535)||(74727-74863)
[»] scaffold0184 (1 HSPs)
scaffold0184 (401-514)||(7451-7564)
[»] scaffold0062 (1 HSPs)
scaffold0062 (406-529)||(43917-44040)
[»] scaffold0019 (1 HSPs)
scaffold0019 (401-535)||(173439-173574)
[»] scaffold0002 (1 HSPs)
scaffold0002 (420-513)||(439977-440070)
[»] scaffold0284 (1 HSPs)
scaffold0284 (420-514)||(1550-1644)
[»] scaffold0011 (1 HSPs)
scaffold0011 (457-530)||(17632-17705)
[»] scaffold0114 (1 HSPs)
scaffold0114 (420-514)||(36316-36410)
[»] scaffold0211 (1 HSPs)
scaffold0211 (420-508)||(19175-19263)


Alignment Details
Target: chr5 (Bit Score: 330; Significance: 0; HSPs: 59)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 330; E-Value: 0
Query Start/End: Original strand, 1 - 366
Target Start/End: Complemental strand, 33806926 - 33806561
Alignment:
1 tattttgcgcatctggagattttaggatagaatgaacatgggacaaccaactacattaaaattccaggttgaggttacaatgtttctatagtctgtatgc 100  Q
    ||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||     
33806926 tattttgagcatctggagcttttaggatagaatgaacatgggacaaccaactacattaaaattctaggttgaggttacaatgtttctatagtctgtatgt 33806827  T
101 agggtccacatttattgaaatttaaactaggtaacaaacttgttttgagtggcttcaaaatcaagcaaaaatgggtgatagtctgagttagttcttaata 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||| |||| |||||||||||||||    
33806826 agggtccacatttattgaaatttaaactaggtaacaaacttgttttgagtggcttcaaaatcaaggaaaattgggtgatggtctaagttagttcttaata 33806727  T
201 gggttgaacaggttacacaggtacacatttcaagccaaaggtgtttgcaaatgaatctgtccagtcttctttcagtgtatcttcttccacttctaccatt 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33806726 gggttgaacaggttacacaggtacacatttcaagccaaaggtgtttgcaaatgaatctgtccagtcttctttcagtgtatcttcttccacttctaccatt 33806627  T
301 ttgccaagcgaatgttgcacctttggtggtaaggtgtatcaggttatttctattagtccacaattg 366  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
33806626 ttgccaagcgaatgttgcacctttggtgggaaggtgtatcaggttatttctattagtccacaattg 33806561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 361 - 514
Target Start/End: Complemental strand, 33816942 - 33816789
Alignment:
361 caattggtctaaactgactcattatcactactnnnnnnncaaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcac 460  Q
    ||||||||||||||||||||||| ||||||||       |||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||    
33816942 caattggtctaaactgactcattgtcactactaaaaaaacaaaagttagtgagggaaatttagtgagggaaaacatgaaattcctttctaattccgtcac 33816843  T
461 taaattttgcgaccaaggaatttgtgaggaattttatgttttctgtcacnaatt 514  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
33816842 taaattttgcgaccaaggaatttgtgaggaattttatgttttctgtcacaaatt 33816789  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 108; E-Value: 5e-54
Query Start/End: Original strand, 400 - 535
Target Start/End: Complemental strand, 33818706 - 33818571
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| |||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||    
33818706 caaaaattagtgagggaaatttagtgagggaaaacatgaaatccctctctaattccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 33818607  T
500 tttctgtcacnaattnccctccctaattttgcnttt 535  Q
    |||| ||||| |||| ||||||| |||||||| |||    
33818606 tttccgtcacaaatttccctccccaattttgctttt 33818571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 98; E-Value: 5e-48
Query Start/End: Original strand, 401 - 531
Target Start/End: Complemental strand, 23423900 - 23423770
Alignment:
401 aaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgtt 500  Q
    |||| |||||||| ||||||||||||||||||||||||||||||| ||||| |||||||||||||||||| |||||||||||||||||||||||||||||    
23423900 aaaaattagtgagtgaaatttagtgagggaaaacatgaaatccctctctaattccgtcactaaattttgcaaccaaggaatttgtgaggaattttatgtt 23423801  T
501 ttctgtcacnaattnccctccctaattttgc 531  Q
    ||  ||||| |||| ||||||||||||||||    
23423800 tttcgtcacaaatttccctccctaattttgc 23423770  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 96; E-Value: 8e-47
Query Start/End: Original strand, 400 - 535
Target Start/End: Original strand, 618288 - 618423
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| ||||||||||| |||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||| || |    
618288 caaaaattagtgagggatatttagtgagggaaaacatgaaatccctctctaattccgtcactaaattttgcgaccaaggaatttgtgaggaatttcattt 618387  T
500 tttctgtcacnaattnccctccctaattttgcnttt 535  Q
    |||| ||||| |||| ||||| |||||||||| |||    
618388 tttccgtcactaatttccctcgctaattttgctttt 618423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 96; E-Value: 8e-47
Query Start/End: Original strand, 400 - 535
Target Start/End: Complemental strand, 16121984 - 16121849
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| ||||||||||| |||||||||||||||||||||||||||| ||||| ||||||||||||||||| ||||||||||||||||||||||||||| |    
16121984 caaaaattagtgagggatatttagtgagggaaaacatgaaatccctctctaattccgtcactaaattttgtgaccaaggaatttgtgaggaattttattt 16121885  T
500 tttctgtcacnaattnccctccctaattttgcnttt 535  Q
    |||| ||||| |||| ||||| |||||||||| |||    
16121884 tttccgtcactaatttccctcgctaattttgctttt 16121849  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 90; E-Value: 3e-43
Query Start/End: Original strand, 420 - 537
Target Start/End: Complemental strand, 25397913 - 25397796
Alignment:
420 ttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgttttctgtcacnaattnccct 519  Q
    |||||||||||||||||||||||||| ||||| |||||||||||||||||||||||| |||||||||| ||||||||||||||| ||||| |||| ||||    
25397913 ttagtgagggaaaacatgaaatccctctctaattccgtcactaaattttgcgaccaaagaatttgtgacgaattttatgttttccgtcacaaatttccct 25397814  T
520 ccctaattttgcntttcc 537  Q
    |||||||||||| |||||    
25397813 ccctaattttgcttttcc 25397796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 86; E-Value: 7e-41
Query Start/End: Original strand, 406 - 535
Target Start/End: Complemental strand, 17039770 - 17039641
Alignment:
406 ttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgttttctg 505  Q
    |||||||||||||| |||||||||||||| |||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||| || ||||| |    
17039770 ttagtgagggaaatatagtgagggaaaacgtgaaatccctctctaattccgtcactaaattttgcgaccaaggaatttgtgaggaatttcattttttccg 17039671  T
506 tcacnaattnccctccctaattttgcnttt 535  Q
    |||| ||||  |||| |||||||||| |||    
17039670 tcactaattttcctcactaattttgctttt 17039641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 84; E-Value: 1e-39
Query Start/End: Original strand, 400 - 535
Target Start/End: Complemental strand, 2472859 - 2472724
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| ||| ||||||| |||||||||||||||||||||||||||| ||||| ||||||| |||||||||||||||||||||||||||||||||| || |    
2472859 caaaaattaatgagggatatttagtgagggaaaacatgaaatccctctctaattccgtcattaaattttgcgaccaaggaatttgtgaggaatttcattt 2472760  T
500 tttctgtcacnaattnccctccctaattttgcnttt 535  Q
    |||| ||||| |||| || || |||||||||| |||    
2472759 tttccgtcactaatttccttcactaattttgctttt 2472724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 84; E-Value: 1e-39
Query Start/End: Original strand, 400 - 535
Target Start/End: Complemental strand, 35620488 - 35620354
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| ||| ||||||| |||||||||||||||||||||||||| | ||||| ||||||||||||||||||||||||||||||||||||||| ||||| |    
35620488 caaaaattaatgagggatatttagtgagggaaaacatgaaatccttctctaattccgtcactaaattttgcgaccaaggaatttgtgaggaa-tttattt 35620390  T
500 tttctgtcacnaattnccctccctaattttgcnttt 535  Q
    |||| ||||| |||| ||||| |||||||||| |||    
35620389 tttccgtcactaatttccctcgctaattttgctttt 35620354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 83; E-Value: 4e-39
Query Start/End: Original strand, 401 - 535
Target Start/End: Original strand, 23975630 - 23975764
Alignment:
401 aaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgtt 500  Q
    |||| |||||||||||||||| |||||||||||| |||||||||| ||||| ||||||||||||||||||||||| | |||||||||||||||| || ||    
23975630 aaaaattagtgagggaaattttgtgagggaaaacgtgaaatccctctctaattccgtcactaaattttgcgaccatgaaatttgtgaggaatttcatttt 23975729  T
501 ttctgtcacnaattnccctccctaattttgcnttt 535  Q
    ||| ||||| |||| ||||| |||||||||| |||    
23975730 ttccgtcactaatttccctcgctaattttgctttt 23975764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 80; E-Value: 3e-37
Query Start/End: Original strand, 420 - 535
Target Start/End: Complemental strand, 746993 - 746878
Alignment:
420 ttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgttttctgtcacnaattnccct 519  Q
    ||||||||||||||| |||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||| || ||||| ||||| |||| ||||    
746993 ttagtgagggaaaacgtgaaatccctctctaattccgtcactaaattttgcgaccaaggaatttgtgaggaatttcattttttccgtcactaatttccct 746894  T
520 ccctaattttgcnttt 535  Q
    | |||||||||| |||    
746893 cgctaattttgctttt 746878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 80; E-Value: 3e-37
Query Start/End: Original strand, 400 - 535
Target Start/End: Original strand, 7888791 - 7888926
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| ||||||||| ||||||||||||||||||| | |||||||| ||||| |||||||||||||||| ||||||||||||||||||||||||| || |    
7888791 caaaaattagtgaggaaaatttagtgagggaaaacgtaaaatccctctctaactccgtcactaaattttacgaccaaggaatttgtgaggaatttcattt 7888890  T
500 tttctgtcacnaattnccctccctaattttgcnttt 535  Q
    |||| ||||  |||| ||||| |||||||||| |||    
7888891 tttccgtcaataatttccctcgctaattttgctttt 7888926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 80; E-Value: 3e-37
Query Start/End: Original strand, 400 - 535
Target Start/End: Complemental strand, 8109005 - 8108870
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| |||||||| ||||||| ||||||||||||||||||| ||| ||||| ||||||||||||||||||||||| | |||||||||||||||| || |    
8109005 caaaaattagtgagagaaattttgtgagggaaaacatgaaattcctctctaattccgtcactaaattttgcgaccatgaaatttgtgaggaatttcattt 8108906  T
500 tttctgtcacnaattnccctccctaattttgcnttt 535  Q
    |||| ||||| |||| ||||| |||||||||| |||    
8108905 tttccgtcactaatttccctctctaattttgctttt 8108870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 80; E-Value: 3e-37
Query Start/End: Original strand, 400 - 535
Target Start/End: Complemental strand, 8886996 - 8886861
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| ||||||||||||||||||||||||||||  | |||||||| ||||| |||||||||||||||||||||||||||||||||||||||||| || |    
8886996 caaaaattagtgagggaaatttagtgagggaaaatgtaaaatccctctctaattccgtcactaaattttgcgaccaaggaatttgtgaggaatttcattt 8886897  T
500 tttctgtcacnaattnccctccctaattttgcnttt 535  Q
    |||  ||||| ||||  |||| |||||||||| |||    
8886896 ttttcgtcacaaattttcctcgctaattttgctttt 8886861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 80; E-Value: 3e-37
Query Start/End: Original strand, 400 - 535
Target Start/End: Original strand, 12045721 - 12045856
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| ||||||||||||||||||||||||||||| | |||||| | ||||| |||||||||||||||| |||||||| |||||||||||||||| || |    
12045721 caaaaattagtgagggaaatttagtgagggaaaacgtaaaatccttctctaattccgtcactaaattttacgaccaagaaatttgtgaggaatttcattt 12045820  T
500 tttctgtcacnaattnccctccctaattttgcnttt 535  Q
    |||| ||||| |||| ||||| |||||||||| |||    
12045821 tttccgtcactaatttccctcgctaattttgctttt 12045856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 80; E-Value: 3e-37
Query Start/End: Original strand, 400 - 535
Target Start/End: Complemental strand, 12328371 - 12328236
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| ||||||||||| |||||||||||||||||||||||| ||| ||||| |||||||||||||||||||| |||| |||||||||||||||| || |    
12328371 caaaaattagtgagggatatttagtgagggaaaacatgaaattcctctctaattccgtcactaaattttgcgatcaagaaatttgtgaggaatttcattt 12328272  T
500 tttctgtcacnaattnccctccctaattttgcnttt 535  Q
    |||| || || |||| ||||| |||||||||| |||    
12328271 tttccgttactaatttccctcactaattttgctttt 12328236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 80; E-Value: 3e-37
Query Start/End: Original strand, 400 - 535
Target Start/End: Original strand, 15060967 - 15061102
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| |||||||||||||||| |||||| ||||| |||||||||| ||||| ||||||||||||||||||||||| | |||||||||||||||| || |    
15060967 caaaaattagtgagggaaattttgtgaggaaaaacgtgaaatccctctctaattccgtcactaaattttgcgaccatgaaatttgtgaggaatttcattt 15061066  T
500 tttctgtcacnaattnccctccctaattttgcnttt 535  Q
    |||| ||||| |||| ||||| |||||||||| |||    
15061067 tttcggtcactaatttccctcgctaattttgctttt 15061102  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 80; E-Value: 3e-37
Query Start/End: Original strand, 400 - 535
Target Start/End: Original strand, 36196388 - 36196523
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| |||||||||||||||| |||||||||||  |||||||||| ||||| ||||||||||||||||||||||| ||| |||||||||||||| || |    
36196388 caaaaattagtgagggaaattttgtgagggaaaatgtgaaatccctctctaattccgtcactaaattttgcgaccatggattttgtgaggaatttcattt 36196487  T
500 tttctgtcacnaattnccctccctaattttgcnttt 535  Q
    |||| ||||| |||| ||||| |||||||||| |||    
36196488 tttccgtcactaatttccctcgctaattttgctttt 36196523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 76; E-Value: 7e-35
Query Start/End: Original strand, 400 - 535
Target Start/End: Complemental strand, 25652728 - 25652593
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| || |||||||||||||||||||||||||  | |||||||| ||||| |||||||| |||||||||||| |||||||||||||||||||| || |    
25652728 caaaatttggtgagggaaatttagtgagggaaaatgtaaaatccctctctaattccgtcacaaaattttgcgactaaggaatttgtgaggaatttcattt 25652629  T
500 tttctgtcacnaattnccctccctaattttgcnttt 535  Q
    ||||||||||  ||| ||||| |||||||||| |||    
25652628 tttctgtcactgatttccctcgctaattttgctttt 25652593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 73; E-Value: 4e-33
Query Start/End: Original strand, 400 - 529
Target Start/End: Original strand, 17986723 - 17986852
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| ||||||||||| |||||||||||||||||||||||| | | ||||| ||||||||||||||||||||| ||||||||||||| |||||| || |    
17986723 caaaaattagtgagggatatttagtgagggaaaacatgaaattcttctctaattccgtcactaaattttgcgacgaaggaatttgtgaagaatttcattt 17986822  T
500 tttctgtcacnaattnccctccctaatttt 529  Q
    |||| ||||| |||| | ||| ||||||||    
17986823 tttccgtcactaatttctctcactaatttt 17986852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 73; E-Value: 4e-33
Query Start/End: Original strand, 400 - 529
Target Start/End: Complemental strand, 25673373 - 25673245
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| |||||||||||||||||||||  ||||||||||||||||| ||||| ||||||||| |||||||||||||| |||||||| |||| |||||| |    
25673373 caaaatttagtgagggaaatttagtgacagaaaacatgaaatccctctctaattccgtcactgaattttgcgaccaaagaatttgt-aggagttttattt 25673275  T
500 tttctgtcacnaattnccctccctaatttt 529  Q
    |||| ||||| ||||  |||||||||||||    
25673274 tttccgtcactaattttcctccctaatttt 25673245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 401 - 529
Target Start/End: Complemental strand, 13620271 - 13620143
Alignment:
401 aaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgtt 500  Q
    |||| ||||||| |||||||||||||||||||||||||||||||| ||||| || ||||| |||||||||||||||  ||||||||||  ||||||| ||    
13620271 aaaaattagtgacggaaatttagtgagggaaaacatgaaatccctctctaattctgtcacaaaattttgcgaccaacaaatttgtgagagattttatttt 13620172  T
501 ttctgtcacnaattnccctccctaatttt 529  Q
    ||| ||||| |||| |||||||| |||||    
13620171 ttccgtcactaatttccctccctgatttt 13620143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 401 - 529
Target Start/End: Original strand, 20959503 - 20959631
Alignment:
401 aaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgtt 500  Q
    |||| |||||||||||||||||| |||||||||| ||||||| || ||||| |||||||||||||||| |||| ||||||||||||||||||||||| ||    
20959503 aaaaattagtgagggaaatttagagagggaaaacgtgaaatctctctctaattccgtcactaaattttacgactaaggaatttgtgaggaattttatttt 20959602  T
501 ttctgtcacnaattnccctccctaatttt 529  Q
    ||| ||||   |||  |||||||||||||    
20959603 ttccgtcagtgattttcctccctaatttt 20959631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #25
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 416 - 535
Target Start/End: Complemental strand, 26708714 - 26708595
Alignment:
416 aaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgttttctgtcacnaattn 515  Q
    ||||||||||||||||||| | |||| ||| ||||| |||||||||||||||||||||||||||||||||||||||||| || ||||| | ||| ||||     
26708714 aaatttagtgagggaaaacgtaaaattcctctctaattccgtcactaaattttgcgaccaaggaatttgtgaggaatttcattttttccggcactaattt 26708615  T
516 ccctccctaattttgcnttt 535  Q
    ||||| |||||||||| |||    
26708614 ccctcgctaattttgcattt 26708595  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #26
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 416 - 535
Target Start/End: Complemental strand, 26978448 - 26978329
Alignment:
416 aaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgttttctgtcacnaattn 515  Q
    ||||||||||||||||||| | |||| ||| ||||| |||||||||||||||||||||||||||||||||||||||||| || ||||| | ||| ||||     
26978448 aaatttagtgagggaaaacgtaaaattcctctctaattccgtcactaaattttgcgaccaaggaatttgtgaggaatttcattttttccggcactaattt 26978349  T
516 ccctccctaattttgcnttt 535  Q
    ||||| |||||||||| |||    
26978348 ccctcgctaattttgcattt 26978329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #27
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 401 - 529
Target Start/End: Complemental strand, 27428156 - 27428028
Alignment:
401 aaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgtt 500  Q
    |||| ||||||||| |||||||| |||||||||| |||||||||| ||||| |||||||||||||||||||||||| |||||| | || |||||||| ||    
27428156 aaaaattagtgaggaaaatttagagagggaaaacgtgaaatccctctctaattccgtcactaaattttgcgaccaaagaatttattagcaattttatttt 27428057  T
501 ttctgtcacnaattnccctccctaatttt 529  Q
    ||  ||||| |||| ||||||||||||||    
27428056 tttcgtcactaatttccctccctaatttt 27428028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #28
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 420 - 535
Target Start/End: Complemental strand, 38837796 - 38837681
Alignment:
420 ttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgttttctgtcacnaattnccct 519  Q
    ||||||||||||||| | |||||||| ||||| ||| |||||||||||||||||||||||||||||||||||||| || ||||| ||||| |||| ||||    
38837796 ttagtgagggaaaacgtaaaatccctctctaattccatcactaaattttgcgaccaaggaatttgtgaggaatttcattttttccgtcactaatttccct 38837697  T
520 ccctaattttgcnttt 535  Q
    | |||||||||| |||    
38837696 cgctaattttgctttt 38837681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #29
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 406 - 530
Target Start/End: Complemental strand, 7003867 - 7003745
Alignment:
406 ttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgttttctg 505  Q
    |||||||||||||||| |||||||||||| ||||||| ||  |||| |||||||||||||||||||| || ||||||||||||||||||| | ||||| |    
7003867 ttagtgagggaaattttgtgagggaaaacgtgaaatctct--ctaattccgtcactaaattttgcgatcatggaatttgtgaggaattttcttttttccg 7003770  T
506 tcacnaattnccctccctaattttg 530  Q
    |||| |||| ||||| |||||||||    
7003769 tcactaatttccctcgctaattttg 7003745  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #30
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 420 - 520
Target Start/End: Original strand, 10494751 - 10494851
Alignment:
420 ttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgttttctgtcacnaattnccct 519  Q
    ||||||||||||||| | |||||||| ||||| |||||||||||||||||||||||||||||||||||||||||| || ||||| ||||| |||| ||||    
10494751 ttagtgagggaaaacgtaaaatccctctctaattccgtcactaaattttgcgaccaaggaatttgtgaggaatttcattttttccgtcactaatttccct 10494850  T
520 c 520  Q
    |    
10494851 c 10494851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #31
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 400 - 535
Target Start/End: Complemental strand, 17036557 - 17036422
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| || ||||||| ||||||| ||||||||||   |||||||| ||||| || |||||||||||||||||||||||||||||||||||||||||| |    
17036557 caaaaatttgtgagggtaatttagagagggaaaacgcaaaatccctctctaattctgtcactaaattttgcgaccaaggaatttgtgaggaattttattt 17036458  T
500 tttctgtcacnaattnccctccctaattttgcnttt 535  Q
     ||| ||||| |||  | |||||||||||||| |||    
17036457 cttccgtcactaatctcgctccctaattttgcattt 17036422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #32
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 401 - 529
Target Start/End: Complemental strand, 28265619 - 28265491
Alignment:
401 aaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgtt 500  Q
    |||| ||| |||||||||||| ||||||||| || | |||||||| ||||| ||||||||||||||||||||||| |||||||||||||||||| || ||    
28265619 aaaaattaatgagggaaattttgtgagggaagacgtaaaatccctctctaattccgtcactaaattttgcgaccatggaatttgtgaggaatttcatttt 28265520  T
501 ttctgtcacnaattnccctccctaatttt 529  Q
    ||| ||||| ||||  |||| ||||||||    
28265519 ttccgtcactaattttcctcgctaatttt 28265491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #33
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 400 - 535
Target Start/End: Complemental strand, 36832035 - 36831900
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| ||||||||||||||||||||||||||||  | |||||||| ||||| ||| ||||||||||||| ||||||||||||| |||||||||| || |    
36832035 caaaaattagtgagggaaatttagtgagggaaaatgtaaaatccctctctaattccatcactaaattttgtgaccaaggaatttatgaggaatttcattt 36831936  T
500 tttctgtcacnaattnccctccctaattttgcnttt 535  Q
    |||  ||| | |||| ||||| |||||||||| |||    
36831935 ttttcgtccctaatttccctcactaattttgctttt 36831900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #34
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 406 - 535
Target Start/End: Original strand, 23408980 - 23409110
Alignment:
406 ttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaatttta-tgttttct 504  Q
    ||||||||||||||||||||||||||||| | |||||||| ||||| |||||||||||||||||||| |||| |||||||||||||||| | | |||||     
23408980 ttagtgagggaaatttagtgagggaaaacgtaaaatccctctctaattccgtcactaaattttgcgatcaagaaatttgtgaggaatttcatttttttcc 23409079  T
505 gtcacnaattnccctccctaattttgcnttt 535  Q
    ||||| ||||   ||| |||||||||| |||    
23409080 gtcactaatttttctcgctaattttgctttt 23409110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #35
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 400 - 535
Target Start/End: Original strand, 5982639 - 5982775
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaatttta-tg 498  Q
    ||||| ||| ||||| ||||||||||||||||||| | |||||||| ||||| |||||||||||| ||||||||||||||||||||||||||||  | |     
5982639 caaaaattaatgaggaaaatttagtgagggaaaacctaaaatccctctctaattccgtcactaaactttgcgaccaaggaatttgtgaggaattccattt 5982738  T
499 ttttctgtcacnaattnccctccctaattttgcnttt 535  Q
    ||||| ||||| |||| ||||| || ||||||| |||    
5982739 ttttccgtcactaatttccctcgctgattttgctttt 5982775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #36
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 401 - 530
Target Start/End: Complemental strand, 10420396 - 10420267
Alignment:
401 aaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgtt 500  Q
    |||| ||||||||| || ||||| ||||||||||||||||||||| ||||| |  |||||||||||||||||||||  || |||||||| ||||||| ||    
10420396 aaaaattagtgaggaaattttagagagggaaaacatgaaatccctctctaattttgtcactaaattttgcgaccaacaaaattgtgagggattttatttt 10420297  T
501 ttctgtcacnaattnccctccctaattttg 530  Q
    ||| ||||| |||| ||||| |||||||||    
10420296 ttccgtcactaatttccctctctaattttg 10420267  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #37
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 420 - 529
Target Start/End: Complemental strand, 16631999 - 16631890
Alignment:
420 ttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgttttctgtcacnaattnccct 519  Q
    ||||||| ||||||| | |||||||| ||||| ||||||||||||||||| |||||||||||||||||||||||| || ||||| ||||| |||| ||||    
16631999 ttagtgaaggaaaacgtaaaatccctctctaattccgtcactaaattttgtgaccaaggaatttgtgaggaatttcattttttccgtcactaatttccct 16631900  T
520 ccctaatttt 529  Q
    | ||||||||    
16631899 cgctaatttt 16631890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #38
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 400 - 503
Target Start/End: Original strand, 17079399 - 17079502
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| ||||||||||||||||||  ||||||||||| |||||||| ||||| ||||||||||||||||||||||||| ||||||| ||| ||||||| |    
17079399 caaaaattagtgagggaaatttagaaagggaaaacatcaaatccctctctaattccgtcactaaattttgcgaccaagaaatttgtaagggattttattt 17079498  T
500 tttc 503  Q
    ||||    
17079499 tttc 17079502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #39
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 400 - 535
Target Start/End: Complemental strand, 11927931 - 11927796
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| |||||||||||| ||||| || ||||||| |||||||||| ||||| ||||||||||||||||||||| ||| ||||||||||| ||||||| |    
11927931 caaaaattagtgagggaattttagagacggaaaacgtgaaatccctctctaattccgtcactaaattttgcgacgaagtaatttgtgagggattttattt 11927832  T
500 tttctgtcacnaattnccctccctaattttgcnttt 535  Q
    ||||  || | ||||   |||||||||||||| |||    
11927831 tttccatctctaatttatctccctaattttgctttt 11927796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #40
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 416 - 535
Target Start/End: Complemental strand, 24138970 - 24138851
Alignment:
416 aaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgttttctgtcacnaattn 515  Q
    ||||||||||||||||||| | ||||| || ||||| ||||||||||||||||||||||||| |||||||||| ||||| || ||||| ||||| ||||     
24138970 aaatttagtgagggaaaacgtaaaatctctctctaattccgtcactaaattttgcgaccaagcaatttgtgagaaatttcattttttccgtcaccaattt 24138871  T
516 ccctccctaattttgcnttt 535  Q
     |||| |||||||||| |||    
24138870 tcctcgctaattttgctttt 24138851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #41
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 420 - 535
Target Start/End: Complemental strand, 36597465 - 36597350
Alignment:
420 ttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgttttctgtcacnaattnccct 519  Q
    ||||||||||||||||| |||| ||| ||||| || ||||||||||||| |||||||||||||||||||||||||||||||||| ||||  ||||   ||    
36597465 ttagtgagggaaaacataaaattcctctctaattctgtcactaaattttacgaccaaggaatttgtgaggaattttatgttttccgtcataaatttttct 36597366  T
520 ccctaattttgcnttt 535  Q
    ||| |||||||| |||    
36597365 cccaaattttgctttt 36597350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #42
Raw Score: 61; E-Value: 6e-26
Query Start/End: Original strand, 420 - 529
Target Start/End: Complemental strand, 4125313 - 4125204
Alignment:
420 ttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgttttctgtcacnaattnccct 519  Q
    ||||||||||||||  ||||||| || ||||| ||||||||||||||||||||||| | |||||||||||||||| || ||||| ||||| |||| ||||    
4125313 ttagtgagggaaaatgtgaaatctctctctaattccgtcactaaattttgcgaccatgaaatttgtgaggaatttcattttttccgtcactaatttccct 4125214  T
520 ccctaatttt 529  Q
    | ||||||||    
4125213 cgctaatttt 4125204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #43
Raw Score: 61; E-Value: 6e-26
Query Start/End: Original strand, 420 - 529
Target Start/End: Complemental strand, 17772093 - 17771984
Alignment:
420 ttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgttttctgtcacnaattnccct 519  Q
    ||||||||||||||||| ||||| || ||||| |||||||||||||||||||| |||||||||| |||||||||| || ||||| ||||| |||| ||||    
17772093 ttagtgagggaaaacataaaatctctctctaattccgtcactaaattttgcgatcaaggaatttttgaggaatttcattttttccgtcactaatttccct 17771994  T
520 ccctaatttt 529  Q
    | || |||||    
17771993 cgctgatttt 17771984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #44
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 400 - 535
Target Start/End: Complemental strand, 13974223 - 13974088
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| |||||||||||||||| |||||||||||| |||||||||| ||| | |||||||||||||||  |||||| | ||||||||| |||||| || |    
13974223 caaaaattagtgagggaaattttgtgagggaaaacgtgaaatccctctctgattccgtcactaaatttcacgaccatgaaatttgtgaagaatttcattt 13974124  T
500 tttctgtcacnaattnccctccctaattttgcnttt 535  Q
    |||  ||| | |||| ||||| |||||||||| |||    
13974123 ttttcgtcgctaatttccctcgctaattttgctttt 13974088  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #45
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 401 - 535
Target Start/End: Complemental strand, 20188085 - 20187951
Alignment:
401 aaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgtt 500  Q
    |||| ||||||||  |||||||||||| |||||| |  |||| || ||||| || |||| |||||||||||| |||||||||||||||||||||||| ||    
20188085 aaaaattagtgagaaaaatttagtgagagaaaacgtagaatcactctctaattctgtcattaaattttgcgatcaaggaatttgtgaggaattttatttt 20187986  T
501 ttctgtcacnaattnccctccctaattttgcnttt 535  Q
    ||| ||||| |||| || || |||||||||| |||    
20187985 ttccgtcactaatttccttcgctaattttgctttt 20187951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #46
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 406 - 536
Target Start/End: Complemental strand, 32726865 - 32726735
Alignment:
406 ttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgttttctg 505  Q
    ||||||| |||||||||| |||||||||  ||||||  || ||||| ||||||||||||||||||||||||||||||||| | |  |||||| |||||      
32726865 ttagtgaaggaaatttagagagggaaaatgtgaaatttctctctaattccgtcactaaattttgcgaccaaggaatttgtcaagggttttatattttcca 32726766  T
506 tcacnaattnccctccctaattttgcntttc 536  Q
    |||| |||| | |||||||||||||| ||||    
32726765 tcactaatttcgctccctaattttgcttttc 32726735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #47
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 400 - 537
Target Start/End: Complemental strand, 3080841 - 3080704
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| ||||||| | |||||||||||||||||||||||||||||| || || | | ||||||| ||||| ||| || |||||||||||  ||||||| |    
3080841 caaaaattagtgaagaaaatttagtgagggaaaacatgaaatccctctcaaatttcatcactaagttttgtgactaaagaatttgtgagagattttattt 3080742  T
500 tttctgtcacnaattnccctccctaattttgcntttcc 537  Q
    ||||  |||| |||| |||| ||||||||||| |||||    
3080741 tttccatcacgaatttccctacctaattttgcttttcc 3080704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #48
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 400 - 537
Target Start/End: Complemental strand, 33735117 - 33734981
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| |||||| ||||||||||  |||  ||||||||||| |||| | ||| ||||||||||||||||||||||||||||||| ||||| ||||||| |    
33735117 caaaaattagtgggggaaatttatagaga-aaaacatgaaacccctctttaattccgtcactaaattttgcgaccaaggaatttatgagggattttattt 33735019  T
500 tttctgtcacnaattnccctccctaattttgcntttcc 537  Q
    ||||  |||  ||||  ||||||||||||||| |||||    
33735018 tttccctcattaattttcctccctaattttgcttttcc 33734981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #49
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 400 - 530
Target Start/End: Complemental strand, 36716345 - 36716215
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| ||||||||| |||||| |||||||||||| |||||||| | ||||| ||| ||| |||||||| ||||||  ||||||||||||||||| || |    
36716345 caaaaattagtgaggaaaattttgtgagggaaaacgtgaaatccttctctaattccttcattaaattttacgaccatagaatttgtgaggaatttcattt 36716246  T
500 tttctgtcacnaattnccctccctaattttg 530  Q
    ||||  |||| |||| ||||| |||||||||    
36716245 tttccatcactaatttccctcgctaattttg 36716215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #50
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 420 - 529
Target Start/End: Original strand, 40484058 - 40484167
Alignment:
420 ttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgttttctgtcacnaattnccct 519  Q
    ||||||||||||||| | |||||||| ||||| ||||||||||||||||||||||||||||||| | || ||||| ||  |||| ||||| |||| ||||    
40484058 ttagtgagggaaaacgtaaaatccctctctaattccgtcactaaattttgcgaccaaggaatttataagaaatttcattatttccgtcactaatttccct 40484157  T
520 ccctaatttt 529  Q
    | ||||||||    
40484158 cgctaatttt 40484167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #51
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 420 - 529
Target Start/End: Original strand, 35778155 - 35778264
Alignment:
420 ttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgttttctgtcacnaattnccct 519  Q
    |||||||||||||||||||||||||| ||| | || || | |||||||||||||||| |||||||||||  ||||||| |||||  |||| |||| ||||    
35778155 ttagtgagggaaaacatgaaatccctatctcattctgtgattaaattttgcgaccaatgaatttgtgagagattttattttttccatcactaatttccct 35778254  T
520 ccctaatttt 529  Q
    ||| ||||||    
35778255 cccaaatttt 35778264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #52
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 418 - 537
Target Start/End: Complemental strand, 23974703 - 23974584
Alignment:
418 atttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgttttctgtcacnaattncc 517  Q
    ||||||||||||||| |||  ||||||| ||||| | ||||| |||||||| |||| ||||||||||||||  ||||||| ||||| ||||| ||||  |    
23974703 atttagtgagggaaagcattcaatccctctctaatttcgtcattaaattttacgacaaaggaatttgtgagagattttattttttccgtcactaattttc 23974604  T
518 ctccctaattttgcntttcc 537  Q
    || ||||||||| | |||||    
23974603 cttcctaatttttcttttcc 23974584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #53
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 400 - 514
Target Start/End: Original strand, 18413550 - 18413664
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| |||||||||||||||||| |||||||||| |||| ||||||| ||| ||||||  |||||||| |||| ||| || |||||||  ||||||| |    
18413550 caaaaattagtgagggaaatttagagagggaaaacgtgaattccctttttaattccgtcgttaaattttacgactaagaaacttgtgagtgattttattt 18413649  T
500 tttctgtcacnaatt 514  Q
    |||  ||||| ||||    
18413650 tttaagtcactaatt 18413664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #54
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 425 - 502
Target Start/End: Complemental strand, 31853208 - 31853131
Alignment:
425 gagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgtttt 502  Q
    |||| ||||||||||||| || ||||| |||||||||||||||||||||||   ||||| ||||| ||||||| ||||    
31853208 gaggaaaaacatgaaatctctctctaattccgtcactaaattttgcgaccataaaatttatgagggattttatttttt 31853131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #55
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 420 - 514
Target Start/End: Original strand, 9024227 - 9024322
Alignment:
420 ttagtgagggaaaacatgaaatccctttctaantcc-gtcactaaattttgcgaccaaggaatttgtgaggaattttatgttttctgtcacnaatt 514  Q
    ||||||||||| ||||||||||| || ||||| |   || |||||||||||||||||||||||||  |||| ||||||| ||||| ||||| ||||    
9024227 ttagtgagggataacatgaaatctctctctaaattatgttactaaattttgcgaccaaggaatttacgagggattttattttttccgtcactaatt 9024322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #56
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 400 - 463
Target Start/End: Complemental strand, 29727991 - 29727928
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaa 463  Q
    ||||| ||||||||| |||||| | |||||||||| |||||| ||| ||||| |||||||||||    
29727991 caaaaattagtgaggcaaattttgcgagggaaaacgtgaaattcctctctaattccgtcactaa 29727928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #57
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 401 - 502
Target Start/End: Complemental strand, 16472325 - 16472223
Alignment:
401 aaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaa-ttttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    |||| ||||||| |||||||||| |||| ||||  || |||| || ||||| || ||||||||| |||||||||||| |||||| ||| | ||||||| |    
16472325 aaaaattagtgacggaaatttagagaggaaaaaagtggaatcgctctctaattctgtcactaaacttttgcgaccaacgaatttttgaaggattttattt 16472226  T
500 ttt 502  Q
    |||    
16472225 ttt 16472223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #58
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 412 - 514
Target Start/End: Complemental strand, 5043644 - 5043542
Alignment:
412 agggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgttttctgtcacna 511  Q
    |||||||||||| |||| |||||  ||||| ||  ||||| |||| |||||||||||  ||| |   |||||||||| ||||| || ||||||||||| |    
5043644 agggaaatttagagaggaaaaacgcgaaattcccctctaattccgccactaaattttatgacgataaaatttgtgagaaatttcattttttctgtcacta 5043545  T
512 att 514  Q
    |||    
5043544 att 5043542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #59
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 420 - 463
Target Start/End: Original strand, 16464692 - 16464735
Alignment:
420 ttagtgagggaaaacatgaaatccctttctaantccgtcactaa 463  Q
    |||||||||||||||||||||| ||| ||||  |||||||||||    
16464692 ttagtgagggaaaacatgaaattcctctctatttccgtcactaa 16464735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 111; Significance: 9e-56; HSPs: 87)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 111; E-Value: 9e-56
Query Start/End: Original strand, 407 - 537
Target Start/End: Original strand, 19610335 - 19610465
Alignment:
407 tagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgttttctgt 506  Q
    ||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
19610335 tagtgagggaaatttagtgagggaaaacatgaaatccctctctaattccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgttttccgt 19610434  T
507 cacnaattnccctccctaattttgcntttcc 537  Q
    ||| |||| |||||||||||||||| |||||    
19610435 cacaaatttccctccctaattttgcttttcc 19610465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 106; E-Value: 8e-53
Query Start/End: Original strand, 400 - 537
Target Start/End: Original strand, 16299851 - 16299988
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| |||||||||||||||| ||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||    
16299851 caaaaattagtgagggaaatttggtgagggaaaacatgaaatccctctctaattccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 16299950  T
500 tttctgtcacnaattnccctccctaattttgcntttcc 537  Q
    |||| ||||| |||| | |||||||||||||| |||||    
16299951 tttccgtcacaaatttcgctccctaattttgcttttcc 16299988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 102; E-Value: 2e-50
Query Start/End: Original strand, 400 - 537
Target Start/End: Original strand, 29215982 - 29216119
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| |||||||||||||||||||||||||||||||||||||||| ||||| ||| |||||||||||||||||||||||||||||||||||||||||||    
29215982 caaaaattagtgagggaaatttagtgagggaaaacatgaaatccctctctaattccatcactaaattttgcgaccaaggaatttgtgaggaattttatgt 29216081  T
500 tttctgtcacnaattnccctccctaattttgcntttcc 537  Q
    |||| ||||| ||||  ||||| ||||||||| |||||    
29216082 tttccgtcacaaattttcctccataattttgcttttcc 29216119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 98; E-Value: 5e-48
Query Start/End: Original strand, 400 - 537
Target Start/End: Original strand, 30219328 - 30219465
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| ||||||||||||||||||||||| |||||||||||||||| ||||| ||||||||||||||||||||||||  ||||| |||||||||||||||    
30219328 caaaaattagtgagggaaatttagtgaggaaaaacatgaaatccctctctaattccgtcactaaattttgcgaccaaaaaatttatgaggaattttatgt 30219427  T
500 tttctgtcacnaattnccctccctaattttgcntttcc 537  Q
    |||| ||||| |||| |||||||||||||||| |||||    
30219428 tttccgtcacaaatttccctccctaattttgcttttcc 30219465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 94; E-Value: 1e-45
Query Start/End: Original strand, 420 - 537
Target Start/End: Complemental strand, 15064117 - 15064000
Alignment:
420 ttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgttttctgtcacnaattnccct 519  Q
    ||||||||||||||||||||||| || ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||| ||||    
15064117 ttagtgagggaaaacatgaaatctctctctaattccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgttttccgtcacaaatttccct 15064018  T
520 ccctaattttgcntttcc 537  Q
    |||||||||||| |||||    
15064017 ccctaattttgcttttcc 15064000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 88; E-Value: 5e-42
Query Start/End: Original strand, 400 - 535
Target Start/End: Complemental strand, 18104675 - 18104540
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| |||||||||||||||| ||||||||||||||||||||||| ||||| ||||||||||||||||||||||| |||||||||||||||||| || |    
18104675 caaaaattagtgagggaaattttgtgagggaaaacatgaaatccctctctaattccgtcactaaattttgcgaccatggaatttgtgaggaatttaattt 18104576  T
500 tttctgtcacnaattnccctccctaattttgcnttt 535  Q
    |||| ||||  |||| ||||| |||||||||| |||    
18104575 tttccgtcaataatttccctcgctaattttgctttt 18104540  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 88; E-Value: 5e-42
Query Start/End: Original strand, 400 - 535
Target Start/End: Complemental strand, 19270009 - 19269874
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| ||||||||||||||||||||||||||||| | |||||||| | ||| |||||||||||||||||||||||||||||||||||||||||| || |    
19270009 caaaaattagtgagggaaatttagtgagggaaaacgtaaaatccctctttaattccgtcactaaattttgcgaccaaggaatttgtgaggaatttcattt 19269910  T
500 tttctgtcacnaattnccctccctaattttgcnttt 535  Q
    |||| ||||| |||| ||||| |||||||||| |||    
19269909 tttccgtcactaatttccctcgctaattttgctttt 19269874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 88; E-Value: 5e-42
Query Start/End: Original strand, 400 - 535
Target Start/End: Original strand, 27449078 - 27449213
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| ||||||||||||||||||||||||||||| | |||||||| ||||| |||||||||||||||||||||||| ||||||||||||||||| || |    
27449078 caaaaattagtgagggaaatttagtgagggaaaacgtaaaatccctctctaattccgtcactaaattttgcgaccaaagaatttgtgaggaatttcattt 27449177  T
500 tttctgtcacnaattnccctccctaattttgcnttt 535  Q
    |||| ||||| |||| ||||| |||||||||| |||    
27449178 tttccgtcactaatttccctcgctaattttgctttt 27449213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 86; E-Value: 7e-41
Query Start/End: Original strand, 406 - 535
Target Start/End: Original strand, 5260933 - 5261062
Alignment:
406 ttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgttttctg 505  Q
    |||||||||||||| |||||||||||||| | |||||||| ||||| |||||||||||||||||||||||||||||||||||||||||| || ||||| |    
5260933 ttagtgagggaaatatagtgagggaaaacgtaaaatccctctctaattccgtcactaaattttgcgaccaaggaatttgtgaggaatttcattttttccg 5261032  T
506 tcacnaattnccctccctaattttgcnttt 535  Q
    |||| |||| ||||| |||||||||| |||    
5261033 tcactaatttccctcactaattttgctttt 5261062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 86; E-Value: 7e-41
Query Start/End: Original strand, 400 - 530
Target Start/End: Original strand, 17762632 - 17762762
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| ||||||||||| ||||||||||||||||||||||||| || ||||| ||||||||||||||||| |||||||||||||||||||||||| || |    
17762632 caaaaattagtgagggatatttagtgagggaaaacatgaaatcgctctctaattccgtcactaaattttgtgaccaaggaatttgtgaggaatttcattt 17762731  T
500 tttctgtcacnaattnccctccctaattttg 530  Q
    |||| ||||| |||| ||||| |||||||||    
17762732 tttccgtcactaatttccctcgctaattttg 17762762  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 86; E-Value: 7e-41
Query Start/End: Original strand, 400 - 530
Target Start/End: Original strand, 19063952 - 19064082
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| ||||||||||| ||||||||||||||||||||||||| || ||||| ||||||||||||||||| |||||||||||||||||||||||| || |    
19063952 caaaaattagtgagggatatttagtgagggaaaacatgaaatcgctctctaattccgtcactaaattttgtgaccaaggaatttgtgaggaatttcattt 19064051  T
500 tttctgtcacnaattnccctccctaattttg 530  Q
    |||| ||||| |||| ||||| |||||||||    
19064052 tttccgtcactaatttccctcgctaattttg 19064082  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 86; E-Value: 7e-41
Query Start/End: Original strand, 406 - 535
Target Start/End: Original strand, 25882566 - 25882695
Alignment:
406 ttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgttttctg 505  Q
    ||||||||||| |||||||||||||||||||||||||||| ||||| |||||||||||||||| ||||||| ||||||||||||||||| || ||||| |    
25882566 ttagtgagggatatttagtgagggaaaacatgaaatccctctctaattccgtcactaaattttacgaccaaagaatttgtgaggaatttcattttttccg 25882665  T
506 tcacnaattnccctccctaattttgcnttt 535  Q
    |||| |||| ||||| |||||||||| |||    
25882666 tcactaatttccctcgctaattttgctttt 25882695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 85; E-Value: 3e-40
Query Start/End: Original strand, 400 - 529
Target Start/End: Original strand, 8428161 - 8428290
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| ||||||||||| ||||||||||||||||||||||||| || ||||| |||||||||||||||| ||||||||||||||||||||||||| || |    
8428161 caaaaattagtgagggatatttagtgagggaaaacatgaaatctctctctaattccgtcactaaattttacgaccaaggaatttgtgaggaatttcattt 8428260  T
500 tttctgtcacnaattnccctccctaatttt 529  Q
    |||| ||||| |||| ||||| ||||||||    
8428261 tttccgtcactaatttccctcgctaatttt 8428290  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 85; E-Value: 3e-40
Query Start/End: Original strand, 400 - 529
Target Start/End: Original strand, 49915441 - 49915570
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| |||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||| ||| ||||||| ||| |||||||||    
49915441 caaaaattagtgagggaaatttagtgagggaaaacatgaaatccctctctaattccgtcactaaattttgcgactaagaaatttgttagggattttatgt 49915540  T
500 tttctgtcacnaattnccctccctaatttt 529  Q
    |||| ||||| |||| |||||  |||||||    
49915541 tttccgtcacaaatttccctctttaatttt 49915570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 84; E-Value: 1e-39
Query Start/End: Original strand, 400 - 535
Target Start/End: Original strand, 11915748 - 11915883
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| ||||||||||||||||||||||||||||| | |||||||| ||||| ||||||||||||||||||||||||| ||||| |||||||||| || |    
11915748 caaaatttagtgagggaaatttagtgagggaaaacgtaaaatccctctctaattccgtcactaaattttgcgaccaagaaatttatgaggaatttcatat 11915847  T
500 tttctgtcacnaattnccctccctaattttgcnttt 535  Q
    |||| ||||| |||| ||||| |||||||||| |||    
11915848 tttccgtcactaatttccctcgctaattttgctttt 11915883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 84; E-Value: 1e-39
Query Start/End: Original strand, 400 - 535
Target Start/End: Complemental strand, 18091692 - 18091557
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| ||||||||||| ||||||||||||||||||| |||||||| ||||| ||||||||||||||||||||||||  |||||||||||||||| || |    
18091692 caaaaattagtgagggatatttagtgagggaaaacataaaatccctctctaattccgtcactaaattttgcgaccaaaaaatttgtgaggaatttcattt 18091593  T
500 tttctgtcacnaattnccctccctaattttgcnttt 535  Q
    |||| ||||| |||| ||||| |||||||||| |||    
18091592 tttccgtcactaatttccctcgctaattttgctttt 18091557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 82; E-Value: 2e-38
Query Start/End: Original strand, 420 - 537
Target Start/End: Original strand, 5744426 - 5744543
Alignment:
420 ttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgttttctgtcacnaattnccct 519  Q
    ||||||||||||||||||||||| || ||||| ||||||||||||||||||||| ||||||||||||||| ||||||||||||| ||||| ||||  |||    
5744426 ttagtgagggaaaacatgaaatctctctctaattccgtcactaaattttgcgactaaggaatttgtgaggcattttatgttttccgtcacaaattttcct 5744525  T
520 ccctaattttgcntttcc 537  Q
    |||||||||||| |||||    
5744526 ccctaattttgcttttcc 5744543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 82; E-Value: 2e-38
Query Start/End: Original strand, 420 - 537
Target Start/End: Original strand, 5781385 - 5781502
Alignment:
420 ttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgttttctgtcacnaattnccct 519  Q
    ||||||||||||||||||||||| || ||||| ||||||||||||||||||||| ||||||||||||||| ||||||||||||| ||||| ||||  |||    
5781385 ttagtgagggaaaacatgaaatctctctctaattccgtcactaaattttgcgactaaggaatttgtgaggcattttatgttttccgtcacaaattttcct 5781484  T
520 ccctaattttgcntttcc 537  Q
    |||||||||||| |||||    
5781485 ccctaattttgcttttcc 5781502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 82; E-Value: 2e-38
Query Start/End: Original strand, 406 - 535
Target Start/End: Original strand, 19223445 - 19223574
Alignment:
406 ttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgttttctg 505  Q
    |||||||||||||||||||| |||||||| | |||||||| ||||| |||||||||||||||| ||||||||||||||||||||||||| || ||||| |    
19223445 ttagtgagggaaatttagtgggggaaaacgtaaaatccctctctaattccgtcactaaattttacgaccaaggaatttgtgaggaatttcattttttccg 19223544  T
506 tcacnaattnccctccctaattttgcnttt 535  Q
    |||| |||| ||||| |||||||||| |||    
19223545 tcaccaatttccctcgctaattttgctttt 19223574  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 82; E-Value: 2e-38
Query Start/End: Original strand, 400 - 537
Target Start/End: Original strand, 21020055 - 21020192
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| |||||||||| | |||||||||||||||||| |||||| | ||||| |||||||||||||||||| |||||||||||||||||  ||||||| |    
21020055 caaaaattagtgagggcagtttagtgagggaaaacataaaatccttctctaattccgtcactaaattttgcaaccaaggaatttgtgagagattttattt 21020154  T
500 tttctgtcacnaattnccctccctaattttgcntttcc 537  Q
    |||| ||||| |||| |||||||||||||||| |||||    
21020155 tttccgtcactaatttccctccctaattttgcttttcc 21020192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 81; E-Value: 7e-38
Query Start/End: Original strand, 400 - 514
Target Start/End: Complemental strand, 17582446 - 17582332
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| |||||||||||||||| |||||||||||| |||||||||| ||||| ||||||||||||||||||||||| ||||||||||||||||||||| |    
17582446 caaaaattagtgagggaaattttgtgagggaaaacgtgaaatccctctctaattccgtcactaaattttgcgaccatggaatttgtgaggaattttattt 17582347  T
500 tttctgtcacnaatt 514  Q
    |||| ||||| ||||    
17582346 tttccgtcactaatt 17582332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 80; E-Value: 3e-37
Query Start/End: Original strand, 400 - 535
Target Start/End: Original strand, 8110329 - 8110464
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| ||||||||||||||||||||||||||||| | |||| ||| ||||| ||||||| |||||||| ||||||||||||||||||||||||| || |    
8110329 caaaaattagtgagggaaatttagtgagggaaaacgtaaaattcctctctaattccgtcattaaattttccgaccaaggaatttgtgaggaatttcattt 8110428  T
500 tttctgtcacnaattnccctccctaattttgcnttt 535  Q
    |||| ||||| |||| ||||| |||||||||| |||    
8110429 tttccgtcactaatttccctcactaattttgctttt 8110464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 80; E-Value: 3e-37
Query Start/End: Original strand, 400 - 535
Target Start/End: Original strand, 18539794 - 18539929
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| |||||||||||||||| |||||||||||| |||||||||| ||||| ||||||||||||||||||||||| | ||||| |||||||||| || |    
18539794 caaaaattagtgagggaaattttgtgagggaaaacgtgaaatccctctctaattccgtcactaaattttgcgaccatgaaatttttgaggaatttcattt 18539893  T
500 tttctgtcacnaattnccctccctaattttgcnttt 535  Q
    |||| ||||| |||| ||||| |||||||||| |||    
18539894 tttccgtcactaatttccctctctaattttgctttt 18539929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 80; E-Value: 3e-37
Query Start/End: Original strand, 420 - 535
Target Start/End: Original strand, 26098823 - 26098938
Alignment:
420 ttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgttttctgtcacnaattnccct 519  Q
    |||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||| || |||||  |||| |||| ||||    
26098823 ttagtgagggaaaacatgaaatccctctctaattccgtcactaaattttgcgaccaaggaatttgtgaggaatttcattttttccatcactaatttccct 26098922  T
520 ccctaattttgcnttt 535  Q
    | |||||||||| |||    
26098923 cgctaattttgctttt 26098938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 80; E-Value: 3e-37
Query Start/End: Original strand, 400 - 535
Target Start/End: Complemental strand, 26390779 - 26390644
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| ||||||||||| |||| |||||||| |||||||||||||| ||||| ||||||||||||||||| |||||||||||||||||||||||| || |    
26390779 caaaaattagtgagggatattttgtgagggataacatgaaatccctctctaattccgtcactaaattttgtgaccaaggaatttgtgaggaatttcattt 26390680  T
500 tttctgtcacnaattnccctccctaattttgcnttt 535  Q
    |||| ||||| |||| | ||| |||||||||| |||    
26390679 tttccgtcactaatttctctcgctaattttgctttt 26390644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 80; E-Value: 3e-37
Query Start/End: Original strand, 416 - 535
Target Start/End: Original strand, 48404866 - 48404985
Alignment:
416 aaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgttttctgtcacnaattn 515  Q
    ||||||||||||||||||| | |||||||| ||||| |||||||||||||||||||||||||||||||||||||||||| || ||||| ||||| ||||     
48404866 aaatttagtgagggaaaacgtaaaatccctctctaattccgtcactaaattttgcgaccaaggaatttgtgaggaatttcattttttccgtcactaattt 48404965  T
516 ccctccctaattttgcnttt 535  Q
    ||||| |||||||||| |||    
48404966 ccctcgctaattttgctttt 48404985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 401 - 535
Target Start/End: Complemental strand, 11007827 - 11007693
Alignment:
401 aaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgtt 500  Q
    |||| ||||||||||||||||||||||||||||| | |||||||| ||||| ||||||||||||||||||||||||| ||||||||| |||||| || ||    
11007827 aaaaattagtgagggaaatttagtgagggaaaacgtaaaatccctctctaattccgtcactaaattttgcgaccaagaaatttgtgacgaatttcatttt 11007728  T
501 ttctgtcacnaattnccctccctaattttgcnttt 535  Q
    ||| ||||| |||| ||||  |||||||||| |||    
11007727 ttccgtcactaatttcccttactaattttgctttt 11007693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 400 - 529
Target Start/End: Original strand, 29956362 - 29956491
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| ||| |||||||||||| |||||||||||  |||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||| || |    
29956362 caaaaattaatgagggaaattttgtgagggaaaatgtgaaatccctttctaattccgtcactaaattttgcgaccatggaatttgtgaggaatttcattt 29956461  T
500 tttctgtcacnaattnccctccctaatttt 529  Q
    ||||  |||| |||| ||||| ||||||||    
29956462 tttccatcactaatttccctcgctaatttt 29956491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 400 - 529
Target Start/End: Original strand, 30005517 - 30005646
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| ||| |||||||||||| |||||||||||  |||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||| || |    
30005517 caaaaattaatgagggaaattttgtgagggaaaatgtgaaatccctttctaattccgtcactaaattttgcgaccatggaatttgtgaggaatttcattt 30005616  T
500 tttctgtcacnaattnccctccctaatttt 529  Q
    ||||  |||| |||| ||||| ||||||||    
30005617 tttccatcactaatttccctcgctaatttt 30005646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 420 - 536
Target Start/End: Complemental strand, 50665761 - 50665645
Alignment:
420 ttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgttttctgtcacnaattnccct 519  Q
    |||||||||||||||||||||||||| ||||| | |||||||||||||||||| ||| |||||||||||||||||||||||||| ||||  |||| ||||    
50665761 ttagtgagggaaaacatgaaatccctctctaatttcgtcactaaattttgcgatcaaagaatttgtgaggaattttatgttttccgtcataaatttccct 50665662  T
520 ccctaattttgcntttc 536  Q
    | |||||||||| ||||    
50665661 ctctaattttgcttttc 50665645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 76; E-Value: 7e-35
Query Start/End: Original strand, 400 - 535
Target Start/End: Complemental strand, 4393495 - 4393360
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| |||||||||||||||| |||||||||||| |||||||||| ||||| ||||||||||||||||||||||  | |||||||||| ||||| || |    
4393495 caaaaattagtgagggaaattttgtgagggaaaacgtgaaatccctctctaattccgtcactaaattttgcgaccgtgaaatttgtgagaaatttcattt 4393396  T
500 tttctgtcacnaattnccctccctaattttgcnttt 535  Q
    |||| ||||| |||| ||||| |||||||||| |||    
4393395 tttccgtcactaatttccctcactaattttgctttt 4393360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #32
Raw Score: 76; E-Value: 7e-35
Query Start/End: Original strand, 400 - 535
Target Start/End: Original strand, 9652568 - 9652703
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| |||||||||||||||| |||||||||||| |||||||||| ||||| ||||||||||||||||||||| | | |||||||||||||||| || |    
9652568 caaaaattagtgagggaaattttgtgagggaaaacgtgaaatccctctctaattccgtcactaaattttgcgactatgaaatttgtgaggaatttcattt 9652667  T
500 tttctgtcacnaattnccctccctaattttgcnttt 535  Q
    |||| ||||| |||| ||||| | |||||||| |||    
9652668 tttccgtcactaatttccctcgccaattttgctttt 9652703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #33
Raw Score: 76; E-Value: 7e-35
Query Start/End: Original strand, 416 - 535
Target Start/End: Original strand, 13921331 - 13921450
Alignment:
416 aaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgttttctgtcacnaattn 515  Q
    ||||||||||||||||||| | |||||||| ||||| |||||||||||||||||||||||||||||||||||||||||| || ||||| ||||| ||||     
13921331 aaatttagtgagggaaaacgtaaaatccctctctaattccgtcactaaattttgcgaccaaggaatttgtgaggaatttcattttttccgtcactaattt 13921430  T
516 ccctccctaattttgcnttt 535  Q
     |||| |||||||||| |||    
13921431 tcctcgctaattttgctttt 13921450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #34
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 406 - 514
Target Start/End: Original strand, 19545506 - 19545614
Alignment:
406 ttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgttttctg 505  Q
    ||||||||||||||||||||||| ||||| | |||||||| ||||| |||||||||||||||||||||||||||||||||||||||||| || ||||| |    
19545506 ttagtgagggaaatttagtgaggaaaaacgtaaaatccctctctaattccgtcactaaattttgcgaccaaggaatttgtgaggaatttcattttttccg 19545605  T
506 tcacnaatt 514  Q
    |||| ||||    
19545606 tcactaatt 19545614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #35
Raw Score: 74; E-Value: 1e-33
Query Start/End: Original strand, 418 - 535
Target Start/End: Complemental strand, 10941792 - 10941675
Alignment:
418 atttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgttttctgtcacnaattncc 517  Q
    ||||| |||||||||||||||||||||| ||||| ||| |||||||||||||||||||||||||||||||||||||| || ||||| ||||| |||| ||    
10941792 atttaatgagggaaaacatgaaatccctctctaattccatcactaaattttgcgaccaaggaatttgtgaggaatttcattttttccgtcactaatttcc 10941693  T
518 ctccctaattttgcnttt 535  Q
    ||  |||||||||| |||    
10941692 cttactaattttgctttt 10941675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #36
Raw Score: 74; E-Value: 1e-33
Query Start/End: Original strand, 400 - 529
Target Start/End: Complemental strand, 26830587 - 26830457
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaatttta-tg 498  Q
    ||||| |||||||||||||||||| |||||||||| |||||||||| ||||| |||||||| |||||||||||||| |||||||||||||||||||| |     
26830587 caaaaattagtgagggaaatttagagagggaaaacgtgaaatccctctctaattccgtcacaaaattttgcgaccatggaatttgtgaggaattttattt 26830488  T
499 ttttctgtcacnaattnccctccctaatttt 529  Q
    ||||| ||||  ||||  |||||||||||||    
26830487 ttttccgtcattaattttcctccctaatttt 26830457  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #37
Raw Score: 74; E-Value: 1e-33
Query Start/End: Original strand, 436 - 537
Target Start/End: Original strand, 37283549 - 37283650
Alignment:
436 tgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgttttctgtcacnaattnccctccctaattttgcnttt 535  Q
    |||||||||| ||||| ||||||||||||||||  ||||||||||||||||||||||||||||||||| ||||| |||| |||||||||||||||| |||    
37283549 tgaaatccctctctaattccgtcactaaattttatgaccaaggaatttgtgaggaattttatgttttccgtcacaaatttccctccctaattttgctttt 37283648  T
536 cc 537  Q
    ||    
37283649 cc 37283650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #38
Raw Score: 73; E-Value: 4e-33
Query Start/End: Original strand, 407 - 535
Target Start/End: Complemental strand, 1311097 - 1310969
Alignment:
407 tagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgttttctgt 506  Q
    |||||||||||||||||||| ||||||| | |||||||| ||||| |||||||||||||||||||||||||||||||||||||| ||| || ||||| ||    
1311097 tagtgagggaaatttagtgatggaaaacgtaaaatccctctctaattccgtcactaaattttgcgaccaaggaatttgtgaggattttcattttttccgt 1310998  T
507 cacnaattnccctccctaattttgcnttt 535  Q
    ||| ||||  |||  |||||||||| |||    
1310997 cactaattttccttgctaattttgctttt 1310969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #39
Raw Score: 73; E-Value: 4e-33
Query Start/End: Original strand, 416 - 529
Target Start/End: Original strand, 21816727 - 21816840
Alignment:
416 aaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgttttctgtcacnaattn 515  Q
    ||||||||||||||||||| | |||| ||| ||||| |||||||||||||||||||||||||||||||||||||||||| || ||||| ||||| ||||     
21816727 aaatttagtgagggaaaacgtaaaattcctctctaattccgtcactaaattttgcgaccaaggaatttgtgaggaatttcattttttccgtcactaattt 21816826  T
516 ccctccctaatttt 529  Q
    ||||| ||||||||    
21816827 ccctcgctaatttt 21816840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #40
Raw Score: 73; E-Value: 4e-33
Query Start/End: Original strand, 400 - 529
Target Start/End: Original strand, 36543739 - 36543868
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| |||||||||||||||| ||||||||||||||||||||||| ||||| | |||||||||||||||||||||| |||| ||||||  ||||||| |    
36543739 caaaaattagtgagggaaattttgtgagggaaaacatgaaatccctctctaatttcgtcactaaattttgcgaccaaagaatctgtgagagattttattt 36543838  T
500 tttctgtcacnaattnccctccctaatttt 529  Q
    ||||  |||| ||||  |||||||||||||    
36543839 tttccatcactaattttcctccctaatttt 36543868  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #41
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 401 - 529
Target Start/End: Original strand, 1628206 - 1628334
Alignment:
401 aaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgtt 500  Q
    |||| |||||||||||||||||| |||||||||| |||||||||| ||||| | |||||||||||||| |||| ||||||||| ||||||||||||| ||    
1628206 aaaaattagtgagggaaatttagagagggaaaacgtgaaatccctctctaatttcgtcactaaattttacgactaaggaatttatgaggaattttatttt 1628305  T
501 ttctgtcacnaattnccctccctaatttt 529  Q
    |||  |||  |||| ||||||||||||||    
1628306 ttccatcattaatttccctccctaatttt 1628334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #42
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 401 - 514
Target Start/End: Original strand, 28389964 - 28390077
Alignment:
401 aaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgtt 500  Q
    |||| ||||||||||||||||||||||||||||| |||||||| | ||||| |||||||||||||||||||||||| |||||||||||  ||||||| ||    
28389964 aaaaattagtgagggaaatttagtgagggaaaacgtgaaatccttctctaattccgtcactaaattttgcgaccaacgaatttgtgagagattttatttt 28390063  T
501 ttctgtcacnaatt 514  Q
    ||| ||||| ||||    
28390064 ttccgtcactaatt 28390077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #43
Raw Score: 71; E-Value: 6e-32
Query Start/End: Original strand, 409 - 535
Target Start/End: Original strand, 31250087 - 31250213
Alignment:
409 gtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgttttctgtca 508  Q
    ||||||||||||||| |||||||||||  |||||||| ||||| || |||||||||||||||||||||| ||||||| ||||||||||| ||||| ||||    
31250087 gtgagggaaatttagagagggaaaacacaaaatccctctctaattctgtcactaaattttgcgaccaagaaatttgtaaggaattttattttttccgtca 31250186  T
509 cnaattnccctccctaattttgcnttt 535  Q
    | |||   ||||||||||||||| |||    
31250187 ctaatcttcctccctaattttgcattt 31250213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #44
Raw Score: 70; E-Value: 3e-31
Query Start/End: Original strand, 416 - 536
Target Start/End: Original strand, 21088758 - 21088876
Alignment:
416 aaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgttttctgtcacnaattn 515  Q
    |||||||||||||||||||||||||||||| || || |||||||  |||||||||||||||||||||||||||  ||||||| ||||| ||||| ||||     
21088758 aaatttagtgagggaaaacatgaaatccctctcgaattccgtcatcaaattttgcgaccaaggaatttgtgag--attttattttttccgtcactaattt 21088855  T
516 ccctccctaattttgcntttc 536  Q
    |||||||||| ||||| ||||    
21088856 ccctccctaactttgcttttc 21088876  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #45
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 400 - 529
Target Start/End: Complemental strand, 7623676 - 7623547
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| |||||||||||||||| |||||||||||  |||||||||| ||||| |||||||||||||||||||||||| |||| |||||| ||||| || |    
7623676 caaaaattagtgagggaaattttgtgagggaaaatgtgaaatccctctctaattccgtcactaaattttgcgaccaaagaatctgtgagaaatttcattt 7623577  T
500 tttctgtcacnaattnccctccctaatttt 529  Q
    |||| ||||| |||| ||||| || |||||    
7623576 tttccgtcactaatttccctcgctgatttt 7623547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #46
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 400 - 529
Target Start/End: Original strand, 31433727 - 31433856
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| |||||||||||| |||||  ||||||||| |||||| ||| ||||| |||||||||||||||| ||||||||||||||||||| |||||||| |    
31433727 caaaaattagtgagggaattttagaaagggaaaacgtgaaattcctctctaattccgtcactaaattttacgaccaaggaatttgtgagaaattttattt 31433826  T
500 tttctgtcacnaattnccctccctaatttt 529  Q
    ||||| |||| |||| ||||  ||||||||    
31433827 tttctatcactaatttccctatctaatttt 31433856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #47
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 409 - 530
Target Start/End: Original strand, 46942486 - 46942607
Alignment:
409 gtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgttttctgtca 508  Q
    ||||||||| ||||| |||||||||| |||||||||| ||||| || |||||||||||||||||||||| || |||||||| |||| || ||||||||||    
46942486 gtgagggaattttagagagggaaaacgtgaaatccctctctaattctgtcactaaattttgcgaccaagaaaattgtgagggatttaattttttctgtca 46942585  T
509 cnaattnccctccctaattttg 530  Q
    | |||| || ||||||||||||    
46942586 ctaatttccttccctaattttg 46942607  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #48
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 420 - 535
Target Start/End: Complemental strand, 1745612 - 1745498
Alignment:
420 ttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgttttctgtcacnaattnccct 519  Q
    ||||||||||||||| | ||||| || ||||| |||||||||||||||||||||||||||||||||||||||||| || ||||| ||||| |||| ||||    
1745612 ttagtgagggaaaacgtaaaatctctctctaattccgtcactaaattttgcgaccaaggaatttgtgaggaatttcat-ttttccgtcactaatttccct 1745514  T
520 ccctaattttgcnttt 535  Q
    | |||||||||| |||    
1745513 cgctaattttgctttt 1745498  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #49
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 420 - 535
Target Start/End: Complemental strand, 3461435 - 3461320
Alignment:
420 ttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgttttctgtcacnaattnccct 519  Q
    ||||||||||||||| | |||||||| ||||| ||||||| |||||||||||| |||| ||||||||||||||||||| ||||||||||| |||| || |    
3461435 ttagtgagggaaaacgtaaaatccctctctaattccgtcattaaattttgcgatcaagaaatttgtgaggaattttattttttctgtcactaatttcctt 3461336  T
520 ccctaattttgcnttt 535  Q
    | |||||||||| |||    
3461335 cgctaattttgctttt 3461320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #50
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 406 - 530
Target Start/End: Original strand, 11219134 - 11219258
Alignment:
406 ttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgttttctg 505  Q
    ||||||||| |||||| |||||||||||| |||||||||| ||||| ||||||| ||||||||||||| | |||||||||||| ||||| || ||||| |    
11219134 ttagtgaggaaaattttgtgagggaaaacgtgaaatccctctctaattccgtcattaaattttgcgactatggaatttgtgagaaatttcattttttccg 11219233  T
506 tcacnaattnccctccctaattttg 530  Q
    |||| |||| ||||| |||||||||    
11219234 tcactaatttccctcgctaattttg 11219258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #51
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 410 - 530
Target Start/End: Complemental strand, 11837349 - 11837229
Alignment:
410 tgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgttttctgtcac 509  Q
    ||||||| | |||||||||||||||||||||| ||| ||||| |||||||||||||||| ||||||| ||||||||||||||||| || |||||  ||||    
11837349 tgagggatacttagtgagggaaaacatgaaattcctctctaattccgtcactaaattttacgaccaaagaatttgtgaggaatttcattttttccatcac 11837250  T
510 naattnccctccctaattttg 530  Q
     |||| ||||| |||||||||    
11837249 gaatttccctcgctaattttg 11837229  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #52
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 420 - 535
Target Start/End: Complemental strand, 13905163 - 13905048
Alignment:
420 ttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgttttctgtcacnaattnccct 519  Q
    ||||||||||||||| | |||||||| ||||| ||||||||||||||||||||||||| |||||||||||||||| || ||||| ||||| |||| | ||    
13905163 ttagtgagggaaaacgtaaaatccctctctaattccgtcactaaattttgcgaccaagaaatttgtgaggaatttcattttttccgtcactaatttcgct 13905064  T
520 ccctaattttgcnttt 535  Q
    | |||||||||| |||    
13905063 ctctaattttgctttt 13905048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #53
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 416 - 535
Target Start/End: Original strand, 29236050 - 29236169
Alignment:
416 aaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgttttctgtcacnaattn 515  Q
    ||||||||||||||||||| | |||||||| ||||| ||||||||||||||||||||||||| | |||||||| ||||| || ||||| ||||| ||||     
29236050 aaatttagtgagggaaaacgtaaaatccctctctaattccgtcactaaattttgcgaccaagaattttgtgagaaatttcattttttccgtcactaattt 29236149  T
516 ccctccctaattttgcnttt 535  Q
    ||||| |||||||||| |||    
29236150 ccctcgctaattttgctttt 29236169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #54
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 400 - 535
Target Start/End: Complemental strand, 29704177 - 29704042
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| |||||||||||||||| ||||| |||||| |||||||||| | ||| |||||||||||||||||||| ||   |||||||||||||||| || |    
29704177 caaaaattagtgagggaaattttgtgagagaaaacgtgaaatccctctttaattccgtcactaaattttgcgatcataaaatttgtgaggaatttcattt 29704078  T
500 tttctgtcacnaattnccctccctaattttgcnttt 535  Q
    |||| ||||| |||| ||||| |||||||||| |||    
29704077 tttccgtcactaatttccctcgctaattttgctttt 29704042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #55
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 420 - 530
Target Start/End: Original strand, 23773487 - 23773597
Alignment:
420 ttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgttttctgtcacnaattnccct 519  Q
    ||||||||||||||| | |||||||| ||||| |||||||||||||||||||||||||||||||||||||||||| || | ||| ||||| |||| ||||    
23773487 ttagtgagggaaaacgtaaaatccctctctaattccgtcactaaattttgcgaccaaggaatttgtgaggaatttcatttcttccgtcactaatttccct 23773586  T
520 ccctaattttg 530  Q
      |||||||||    
23773587 tactaattttg 23773597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #56
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 400 - 529
Target Start/End: Complemental strand, 23217353 - 23217224
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| || |||||| |||||||| |||||||||| |||||||||| ||||| ||||||||||||||||| |||||  ||||||||||||||||| || |    
23217353 caaaaattggtgaggaaaatttagagagggaaaacgtgaaatccctctctaattccgtcactaaattttgggaccatagaatttgtgaggaatttgattt 23217254  T
500 tttctgtcacnaattnccctccctaatttt 529  Q
    ||||  |||  |||| ||||||||||||||    
23217253 tttccctcattaatttccctccctaatttt 23217224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #57
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 400 - 514
Target Start/End: Complemental strand, 27212926 - 27212812
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| |||||||||||||||||| |||| ||||| |||||||||| | ||| ||||||||||||||||||||| || |||||||||||| ||||||| |    
27212926 caaaaattagtgagggaaatttagagaggaaaaacgtgaaatccctctttaattccgtcactaaattttgcgactaaagaatttgtgagggattttattt 27212827  T
500 tttctgtcacnaatt 514  Q
    ||||| |||| ||||    
27212826 tttctatcactaatt 27212812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #58
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 416 - 529
Target Start/End: Original strand, 28859597 - 28859710
Alignment:
416 aaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgttttctgtcacnaattn 515  Q
    ||||||||||||| ||||| | |||||||| ||||| |||||||||||||||||| ||||||||||||||||||||||| || ||||| ||||| ||||     
28859597 aaatttagtgaggtaaaacgtaaaatccctctctaattccgtcactaaattttgcaaccaaggaatttgtgaggaatttcattttttccgtcactaattt 28859696  T
516 ccctccctaatttt 529  Q
     |||| ||||||||    
28859697 tcctcgctaatttt 28859710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #59
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 400 - 529
Target Start/End: Complemental strand, 36564584 - 36564455
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| |||||||||||||||| |||||||||| |||||||||||| ||||| | |||||||||||| ||||||||| |||| ||| ||| ||||||| |    
36564584 caaaaattagtgagggaaattttgtgagggaaagcatgaaatccctctctaatttcgtcactaaattctgcgaccaaagaatctgtcagggattttattt 36564485  T
500 tttctgtcacnaattnccctccctaatttt 529  Q
    ||||  |||| ||||  |||||||||||||    
36564484 tttccatcactaattttcctccctaatttt 36564455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #60
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 420 - 535
Target Start/End: Original strand, 5565732 - 5565847
Alignment:
420 ttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgttttctgtcacnaattnccct 519  Q
    ||||||||||||||| |||||||||| ||||| |  |||||||||||||||||||||| ||||||||||  ||||||| ||||| ||||| |||| ||||    
5565732 ttagtgagggaaaacgtgaaatccctctctaattatgtcactaaattttgcgaccaagaaatttgtgagagattttattttttccgtcactaatttccct 5565831  T
520 ccctaattttgcnttt 535  Q
    |||| ||||||| |||    
5565832 ccctgattttgctttt 5565847  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #61
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 400 - 535
Target Start/End: Original strand, 27968905 - 27969040
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| ||||||| |||||||||||||||||||||||||||||||| ||||| || |||| ||||||||||||||||  ||  ||||||  ||||||| |    
27968905 caaaaattagtgacggaaatttagtgagggaaaacatgaaatccctctctaattctgtcattaaattttgcgaccaacaaaggtgtgagagattttattt 27969004  T
500 tttctgtcacnaattnccctccctaattttgcnttt 535  Q
     ||| ||||| |||| |||||||| ||||||| |||    
27969005 gttccgtcactaatttccctccctgattttgctttt 27969040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #62
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 420 - 535
Target Start/End: Complemental strand, 43329888 - 43329773
Alignment:
420 ttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgttttctgtcacnaattnccct 519  Q
    ||||||||||||||  | |||||| | ||||| |||||||||||||||| ||||||||||||||||||||||||| || ||||| ||||| |||| ||||    
43329888 ttagtgagggaaaatgtaaaatccttctctaattccgtcactaaattttacgaccaaggaatttgtgaggaatttcattttttccgtcactaatttccct 43329789  T
520 ccctaattttgcnttt 535  Q
    | |||||||||| |||    
43329788 cgctaattttgctttt 43329773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #63
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 420 - 535
Target Start/End: Complemental strand, 46012853 - 46012738
Alignment:
420 ttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgttttctgtcacnaattnccct 519  Q
    |||||||||||||||||||||||||| ||||| |  ||||||||||||||||| |||||||||||||||  ||||||| ||||| ||||| ||||  |||    
46012853 ttagtgagggaaaacatgaaatccctctctaattttgtcactaaattttgcgatcaaggaatttgtgagagattttattttttccgtcactaattttcct 46012754  T
520 ccctaattttgcnttt 535  Q
    |||| ||||||| |||    
46012753 ccctgattttgctttt 46012738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #64
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 416 - 535
Target Start/End: Complemental strand, 47263394 - 47263275
Alignment:
416 aaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgttttctgtcacnaattn 515  Q
    ||||||||||||||||||| | ||||  || ||||| || ||||||||||||||||||||||||||||||||||||||| || ||||||||||| ||||     
47263394 aaatttagtgagggaaaacgtaaaatttctatctaactctgtcactaaattttgcgaccaaggaatttgtgaggaatttaattttttctgtcaccaattt 47263295  T
516 ccctccctaattttgcnttt 535  Q
    || ||  ||||||||| |||    
47263294 ccttcgttaattttgctttt 47263275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #65
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 408 - 530
Target Start/End: Complemental strand, 27182793 - 27182673
Alignment:
408 agtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgttttctgtc 507  Q
    |||||| ||||||||||||||||||||| |||||| || ||||| | ||||||||||| ||| |||||||| |||||||||| ||||||  |||| ||||    
27182793 agtgagagaaatttagtgagggaaaacaagaaatctctctctaatttcgtcactaaatcttgtgaccaagggatttgtgagggatttta--ttttttgtc 27182696  T
508 acnaattnccctccctaattttg 530  Q
    || |||| |||||||||||||||    
27182695 actaatttccctccctaattttg 27182673  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #66
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 423 - 514
Target Start/End: Original strand, 6718723 - 6718814
Alignment:
423 gtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgttttctgtcacnaatt 514  Q
    |||||||||||| |||||||||||||||| ||||||||||||||||||||||| | |||||||||||||||| || ||||| ||||| ||||    
6718723 gtgagggaaaacgtgaaatccctttctaattccgtcactaaattttgcgaccatgaaatttgtgaggaatttcattttttccgtcactaatt 6718814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #67
Raw Score: 61; E-Value: 6e-26
Query Start/End: Original strand, 401 - 530
Target Start/End: Original strand, 8543460 - 8543588
Alignment:
401 aaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgtt 500  Q
    |||| |||||||||||||||| |||||||||||| |||||||||| ||||| ||||||| ||||||||||||||| | || |||| |||||||| || ||    
8543460 aaaaattagtgagggaaattttgtgagggaaaacgtgaaatccctctctaattccgtcattaaattttgcgaccatgaaacttgttaggaatttcat-tt 8543558  T
501 ttctgtcacnaattnccctccctaattttg 530  Q
    |||  |||| |||| ||||| |||||||||    
8543559 ttccatcactaatttccctcgctaattttg 8543588  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #68
Raw Score: 61; E-Value: 6e-26
Query Start/End: Original strand, 400 - 503
Target Start/End: Complemental strand, 11085487 - 11085384
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| |||||||| ||||||||||||||||||   |||||||||| ||||| |||||||||||||||||||||||| |||||| |||||||||| || |    
11085487 caaaaattagtgagagaaatttagtgagggaaattgtgaaatccctctctaattccgtcactaaattttgcgaccaaagaatttatgaggaatttcattt 11085388  T
500 tttc 503  Q
    ||||    
11085387 tttc 11085384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #69
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 406 - 528
Target Start/End: Original strand, 10803716 - 10803839
Alignment:
406 ttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaatttta-tgttttct 504  Q
    |||| |||||||||||||||||||||||| | |||| ||| | ||| ||||||| ||||||||||||||||| |||||||||||||||| | | |||||     
10803716 ttagcgagggaaatttagtgagggaaaacgtaaaattcctctttaattccgtcattaaattttgcgaccaagaaatttgtgaggaatttcatttttttcc 10803815  T
505 gtcacnaattnccctccctaattt 528  Q
    ||||  |||| |||||||||||||    
10803816 gtcattaatttccctccctaattt 10803839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #70
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 430 - 535
Target Start/End: Original strand, 8546265 - 8546370
Alignment:
430 aaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgttttctgtcacnaattnccctccctaatttt 529  Q
    ||||| |||||||||| ||||| |||||||||||||||||||| || |||||||||||||||||| || ||||| ||||| ||||  |||| ||||||||    
8546265 aaaacgtgaaatccctctctaattccgtcactaaattttgcgatcatggaatttgtgaggaatttcattttttccgtcactaattttcctcgctaatttt 8546364  T
530 gcnttt 535  Q
    || |||    
8546365 gctttt 8546370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #71
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 420 - 503
Target Start/End: Complemental strand, 17269729 - 17269646
Alignment:
420 ttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgttttc 503  Q
    ||||||||| |||| ||||||||||| ||||| |||||||||||||||||||| ||| |||||||||||||||||||| |||||    
17269729 ttagtgaggaaaaatatgaaatccctctctaattccgtcactaaattttgcgatcaaagaatttgtgaggaattttattttttc 17269646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #72
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 400 - 529
Target Start/End: Original strand, 18380014 - 18380143
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| ||||||||||||||||| ||||||||||  | |||||||| | ||| |||||||||||||||| ||| |||| ||||||||| |||||| || |    
18380014 caaaaattagtgagggaaatttaatgagggaaaatgtaaaatccctctttaattccgtcactaaattttacgatcaagaaatttgtgaagaatttcattt 18380113  T
500 tttctgtcacnaattnccctccctaatttt 529  Q
    |||| |||||  ||| ||||| ||||||||    
18380114 tttccgtcactgatttccctcgctaatttt 18380143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #73
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 420 - 530
Target Start/End: Complemental strand, 21490159 - 21490049
Alignment:
420 ttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgttttctgtcacnaattnccct 519  Q
    ||||||||||||||  | |||||||| ||||| || ||||||||||||||||||||||||||||||||| ||||| || ||||| ||||   ||| ||||    
21490159 ttagtgagggaaaatgtaaaatccctctctaattctgtcactaaattttgcgaccaaggaatttgtgagaaatttcattttttccgtcattgatttccct 21490060  T
520 ccctaattttg 530  Q
    | |||||||||    
21490059 cactaattttg 21490049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #74
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 408 - 502
Target Start/End: Original strand, 20088398 - 20088492
Alignment:
408 agtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgtttt 502  Q
    |||||| |||||||||||||| |||||||||||||| | ||||| ||| ||||||||||||| |||||| |||||| |||| |||||||| ||||    
20088398 agtgagagaaatttagtgaggcaaaacatgaaatccttctctaattccatcactaaattttgtgaccaaagaatttatgagaaattttatttttt 20088492  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #75
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 401 - 535
Target Start/End: Original strand, 15490026 - 15490159
Alignment:
401 aaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgtt 500  Q
    |||| |||||||||||||||||||||| |||||| |||||||||| | ||| |  |||||||||||||||||||||  ||||||||||  ||||||| ||    
15490026 aaaaattagtgagggaaatttagtgagagaaaacgtgaaatccctctttaatt-tgtcactaaattttgcgaccaaaaaatttgtgagagattttatttt 15490124  T
501 ttctgtcacnaattnccctccctaattttgcnttt 535  Q
    ||  ||||| ||||   |||||| ||||||| |||    
15490125 tttcgtcactaatttttctccctgattttgctttt 15490159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #76
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 456 - 535
Target Start/End: Complemental strand, 20762039 - 20761960
Alignment:
456 gtcactaaattttgcgaccaaggaatttgtgaggaattttatgttttctgtcacnaattnccctccctaattttgcnttt 535  Q
    |||||||||||||||||||||||||||||||||  ||||||| ||||| ||||| |||| |||||||| ||||||| |||    
20762039 gtcactaaattttgcgaccaaggaatttgtgagagattttattttttccgtcactaatttccctccctgattttgctttt 20761960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #77
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 400 - 530
Target Start/End: Original strand, 29451084 - 29451214
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| |||| ||| |||||||||||||||||||| | |||||||| ||||| |||||| | ||||||||| ||  |||||||| |||| ||||| || |    
29451084 caaaaattagcgagagaaatttagtgagggaaaacgtaaaatccctctctaattccgtcccaaaattttgcaactgaggaatttatgagaaatttcattt 29451183  T
500 tttctgtcacnaattnccctccctaattttg 530  Q
    |||| ||||| |||| |||||  ||||||||    
29451184 tttccgtcactaatttccctcgttaattttg 29451214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #78
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 400 - 529
Target Start/End: Complemental strand, 20615488 - 20615359
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| |||||||||||||||||| || ||||||| |||||| ||| ||||| || |||| |||||||| |||||||  ||||||||||  ||||||| |    
20615488 caaaaattagtgagggaaatttagagaaggaaaacgtgaaattcctctctaattctgtcattaaattttacgaccaaaaaatttgtgagatattttattt 20615389  T
500 tttctgtcacnaattnccctccctaatttt 529  Q
    |||| ||| | ||||  ||||| |||||||    
20615388 tttccgtctctaattttcctccttaatttt 20615359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #79
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 420 - 535
Target Start/End: Complemental strand, 6088353 - 6088238
Alignment:
420 ttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgttttctgtcacnaattnccct 519  Q
    ||||||||||||||| | |||||| | ||||| ||||| | ||||||||| ||||||||||||| |||||||||| || ||||| ||||| |||| ||||    
6088353 ttagtgagggaaaacgtaaaatccatctctaattccgttattaaattttgtgaccaaggaatttctgaggaatttcattttttccgtcactaatttccct 6088254  T
520 ccctaattttgcnttt 535  Q
      || ||||||| |||    
6088253 tacttattttgctttt 6088238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #80
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 400 - 537
Target Start/End: Complemental strand, 6447391 - 6447254
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| |||| ||| |||||||| ||||  |||| |  |||||  ||||||| || ||||||||| |||| |||||| |||| || |||||||||||| |    
6447391 caaaaattagcgagagaaatttaatgagttaaaatagtaaatctttttctaattctgtcactaaactttgagaccaaagaatctgcgaggaattttattt 6447292  T
500 tttctgtcacnaattnccctccctaattttgcntttcc 537  Q
    ||||  |||| |||| |||||||||||||||| |||||    
6447291 tttccatcactaatttccctccctaattttgcttttcc 6447254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #81
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 416 - 529
Target Start/End: Complemental strand, 10772183 - 10772069
Alignment:
416 aaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaatttta-tgttttctgtcacnaatt 514  Q
    |||||||||||||||||| ||||||||||| ||||| | ||||| ||||||||||||| ||  ||||||||| |||||  | | ||||||||||| ||||    
10772183 aaatttagtgagggaaaatatgaaatccctctctaatttcgtcattaaattttgcgactaaaaaatttgtgaagaattccatttttttctgtcactaatt 10772084  T
515 nccctccctaatttt 529  Q
     |||||  |||||||    
10772083 tccctcgttaatttt 10772069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #82
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 420 - 514
Target Start/End: Original strand, 50240756 - 50240850
Alignment:
420 ttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgttttctgtcacnaatt 514  Q
    ||||||||||| ||||||||||| || ||||| |  || ||||||||||||| ||||||||||| ||||  ||||||| ||||| ||||| ||||    
50240756 ttagtgagggataacatgaaatctctctctaattatgttactaaattttgcgtccaaggaatttatgagagattttattttttccgtcactaatt 50240850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #83
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 420 - 494
Target Start/End: Complemental strand, 23233288 - 23233214
Alignment:
420 ttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattt 494  Q
    ||||||||||||||| |||||| ||| || || ||| |||||||||||||||||||| | ||||||||| |||||    
23233288 ttagtgagggaaaacgtgaaattcctctcaaattccttcactaaattttgcgaccaaagtatttgtgagaaattt 23233214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #84
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 410 - 530
Target Start/End: Complemental strand, 26963384 - 26963264
Alignment:
410 tgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgttttctgtcac 509  Q
    ||||||||||||||||||||||||  | |||| ||| ||||| ||||| |||||||||| | ||||| | |||||| |  ||||| || ||||  |||||    
26963384 tgagggaaatttagtgagggaaaatgtaaaattcctctctaattccgttactaaattttacaaccaaagtatttgtaaaaaatttcattttttacgtcac 26963285  T
510 naattnccctccctaattttg 530  Q
     |||| |||||  ||||||||    
26963284 taatttccctcgttaattttg 26963264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #85
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 416 - 465
Target Start/End: Complemental strand, 35579654 - 35579605
Alignment:
416 aaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaat 465  Q
    ||||||||||||||||||| | |||||||| ||||| |||||||||||||    
35579654 aaatttagtgagggaaaacgtaaaatccctctctaattccgtcactaaat 35579605  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #86
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 428 - 476
Target Start/End: Complemental strand, 27711285 - 27711237
Alignment:
428 ggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaa 476  Q
    ||||||||||||||  || ||||| ||||||||||||||||||||||||    
27711285 ggaaaacatgaaatttctctctaattccgtcactaaattttgcgaccaa 27711237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #87
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 416 - 531
Target Start/End: Original strand, 45304340 - 45304455
Alignment:
416 aaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgttttctgtcacnaattn 515  Q
    ||||||||||||| |||| |||||||  ||||  || ||||||| |||||||||  || || ||| |||| ||||||||||| ||||| ||||  ||||     
45304340 aaatttagtgaggaaaaatatgaaatttcttttaaattccgtcattaaattttgtaactaaagaaattgttaggaattttattttttccgtcattaattt 45304439  T
516 ccctccctaattttgc 531  Q
    | |||| | |||||||    
45304440 ctctccttgattttgc 45304455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 110; Significance: 3e-55; HSPs: 74)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 110; E-Value: 3e-55
Query Start/End: Original strand, 400 - 537
Target Start/End: Original strand, 22083832 - 22083969
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| |||||||||||||||||||||||||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||||||||||||||||||    
22083832 caaaaattagtgagggaaatttagtgagggaaaacatgaaatccctctctaattccgtcacaaaattttgcgaccaaggaatttgtgaggaattttatgt 22083931  T
500 tttctgtcacnaattnccctccctaattttgcntttcc 537  Q
    |||| ||||| |||| |||||||||||||||| |||||    
22083932 tttccgtcacaaatttccctccctaattttgcttttcc 22083969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 102; E-Value: 2e-50
Query Start/End: Original strand, 400 - 537
Target Start/End: Original strand, 12951702 - 12951839
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| |||||||||||||||||||||||||||||||||||||||| ||||| ||||||| |||||||||||||||||||||||||||| ||||||||||    
12951702 caaaaattagtgagggaaatttagtgagggaaaacatgaaatccctctctaattccgtcattaaattttgcgaccaaggaatttgtgagaaattttatgt 12951801  T
500 tttctgtcacnaattnccctccctaattttgcntttcc 537  Q
    |||| ||||| |||| ||||| |||||||||| |||||    
12951802 tttccgtcacaaatttccctctctaattttgcttttcc 12951839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 98; E-Value: 5e-48
Query Start/End: Original strand, 400 - 537
Target Start/End: Complemental strand, 18033670 - 18033534
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| ||||||||||||||||| |||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||| |||     
18033670 caaaaattagtgagggaaatttaatgagggaaaacatgaaatccctctctaattccgtcactaaattttgcgaccaaggaatttgtgaggaatttaatg- 18033572  T
500 tttctgtcacnaattnccctccctaattttgcntttcc 537  Q
    |||| ||||| |||| |||||||||||||||| |||||    
18033571 tttccgtcacaaatttccctccctaattttgcttttcc 18033534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 96; E-Value: 8e-47
Query Start/End: Original strand, 400 - 535
Target Start/End: Original strand, 9892957 - 9893092
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| ||||||||||||||||||||||||||||| |||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||| || |    
9892957 caaaaattagtgagggaaatttagtgagggaaaacgtgaaatccctctctaattccgtcactaaattttgcgaccaaggaatttgtgaggaatttcattt 9893056  T
500 tttctgtcacnaattnccctccctaattttgcnttt 535  Q
    |||| ||||| |||| ||||| |||||||||| |||    
9893057 tttccgtcactaatttccctcgctaattttgctttt 9893092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 94; E-Value: 1e-45
Query Start/End: Original strand, 400 - 537
Target Start/End: Original strand, 2992609 - 2992746
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| ||||||||||| |||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||| |    
2992609 caaaaattagtgagggatatttagtgagggaaaacatgaaatccctctctaattccgtcactaaattttgcgaccaaggaatttgtgaggaattttattt 2992708  T
500 tttctgtcacnaattnccctccctaattttgcntttcc 537  Q
    ||||  |||| |||| ||||| |||||| ||| |||||    
2992709 tttccatcactaatttccctcgctaattatgcttttcc 2992746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 89; E-Value: 1e-42
Query Start/End: Original strand, 420 - 529
Target Start/End: Original strand, 11077663 - 11077772
Alignment:
420 ttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgttttctgtcacnaattnccct 519  Q
    |||||||||||||||||||||||||| |||||  |||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||| ||||    
11077663 ttagtgagggaaaacatgaaatccctctctaataccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgttttccgtcacaaatttccct 11077762  T
520 ccctaatttt 529  Q
    ||||||||||    
11077763 ccctaatttt 11077772  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 88; E-Value: 5e-42
Query Start/End: Original strand, 400 - 535
Target Start/End: Original strand, 6598458 - 6598593
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| ||||||||||| ||||||||||||||||| |||||||||| ||||| ||||||||||||||||||||||||| |||||||||||||||| || |    
6598458 caaaaattagtgagggatatttagtgagggaaaacttgaaatccctctctaattccgtcactaaattttgcgaccaagtaatttgtgaggaatttcattt 6598557  T
500 tttctgtcacnaattnccctccctaattttgcnttt 535  Q
    |||| ||||| |||| ||||| |||||||||| |||    
6598558 tttccgtcactaatttccctcgctaattttgctttt 6598593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 88; E-Value: 5e-42
Query Start/End: Original strand, 400 - 535
Target Start/End: Complemental strand, 15364603 - 15364468
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| ||||||||||||||||||||||||||||| | |||||| | ||||| |||||||||||||||||||||||||||||||||||||||||| || |    
15364603 caaaaattagtgagggaaatttagtgagggaaaacgtaaaatccttctctaattccgtcactaaattttgcgaccaaggaatttgtgaggaatttcattt 15364504  T
500 tttctgtcacnaattnccctccctaattttgcnttt 535  Q
    |||| ||||| |||| ||||| |||||||||| |||    
15364503 tttccgtcactaatttccctcactaattttgctttt 15364468  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 88; E-Value: 5e-42
Query Start/End: Original strand, 400 - 535
Target Start/End: Complemental strand, 24661154 - 24661019
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| ||||||||||| ||||||||||||||||||||||||| || ||||| ||||||| |||||||||||||||||||||||||||||||||| || |    
24661154 caaaaattagtgagggatatttagtgagggaaaacatgaaatctctctctaattccgtcattaaattttgcgaccaaggaatttgtgaggaatttcattt 24661055  T
500 tttctgtcacnaattnccctccctaattttgcnttt 535  Q
    |||| ||||| |||| ||||| |||||||||| |||    
24661054 tttccgtcactaatttccctcgctaattttgctttt 24661019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 88; E-Value: 5e-42
Query Start/End: Original strand, 401 - 529
Target Start/End: Original strand, 25397997 - 25398125
Alignment:
401 aaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgtt 500  Q
    |||| ||||||||||||||||||||||||||||| | |||||||| ||||| |||||||||||||||||||||||||||||||||||||||||| || ||    
25397997 aaaaattagtgagggaaatttagtgagggaaaacgtaaaatccctctctaattccgtcactaaattttgcgaccaaggaatttgtgaggaatttcatttt 25398096  T
501 ttctgtcacnaattnccctccctaatttt 529  Q
    ||| ||||| |||| ||||| ||||||||    
25398097 ttccgtcactaatttccctcgctaatttt 25398125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 88; E-Value: 5e-42
Query Start/End: Original strand, 400 - 535
Target Start/End: Original strand, 28364905 - 28365040
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| ||||||||||||||||||||||||||||| | |||||||| ||||| |||||||||||||||||||||||| ||||||||||||||||| || |    
28364905 caaaaattagtgagggaaatttagtgagggaaaacgtaaaatccctctctaattccgtcactaaattttgcgaccaaagaatttgtgaggaatttcattt 28365004  T
500 tttctgtcacnaattnccctccctaattttgcnttt 535  Q
    |||| ||||| |||| ||||| |||||||||| |||    
28365005 tttccgtcactaatttccctcgctaattttgctttt 28365040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 84; E-Value: 1e-39
Query Start/End: Original strand, 400 - 535
Target Start/End: Original strand, 12200688 - 12200823
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| ||||||||||| |||||||||||||||| ||||||||||| ||||| ||| |||||||||||| ||||||||||||||||||||||||| || |    
12200688 caaaaattagtgagggatatttagtgagggaaaatatgaaatccctctctaattccctcactaaattttacgaccaaggaatttgtgaggaatttcattt 12200787  T
500 tttctgtcacnaattnccctccctaattttgcnttt 535  Q
    |||| ||||| |||| ||||| |||||||||| |||    
12200788 tttccgtcactaatttccctcactaattttgctttt 12200823  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 84; E-Value: 1e-39
Query Start/End: Original strand, 400 - 535
Target Start/End: Original strand, 14886555 - 14886690
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| ||||||||| ||||||||||||||||||||| |||||||| ||||| |||||||||||||||| ||||||| |||| ||||||| ||||||| |    
14886555 caaaaattagtgaggaaaatttagtgagggaaaacatcaaatccctctctaattccgtcactaaattttacgaccaaagaatatgtgagggattttattt 14886654  T
500 tttctgtcacnaattnccctccctaattttgcnttt 535  Q
    |||||||||| ||||  ||||||||||||||| |||    
14886655 tttctgtcactaattttcctccctaattttgctttt 14886690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 84; E-Value: 1e-39
Query Start/End: Original strand, 400 - 535
Target Start/End: Complemental strand, 22579494 - 22579359
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| |||||||||||||||| |||||||||||| |||||||||| ||||| |||||||||||||||||||||||  ||||||||||||||||| || |    
22579494 caaaaattagtgagggaaattttgtgagggaaaacgtgaaatccctctctaattccgtcactaaattttgcgaccatagaatttgtgaggaatttcattt 22579395  T
500 tttctgtcacnaattnccctccctaattttgcnttt 535  Q
    |||| ||||| |||| ||||| |||||||||| |||    
22579394 tttccgtcactaatttccctcgctaattttgctttt 22579359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 84; E-Value: 1e-39
Query Start/End: Original strand, 400 - 535
Target Start/End: Original strand, 26224422 - 26224557
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| |||| |||||| |||||||||||||||||||||||||||| ||||| ||||||||||||||||| ||||||| |||||||||||||||| || |    
26224422 caaaaattagcgagggatatttagtgagggaaaacatgaaatccctctctaattccgtcactaaattttgtgaccaagaaatttgtgaggaatttcattt 26224521  T
500 tttctgtcacnaattnccctccctaattttgcnttt 535  Q
    |||| ||||| |||| ||||| |||||||||| |||    
26224522 tttccgtcactaatttccctcgctaattttgctttt 26224557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 82; E-Value: 2e-38
Query Start/End: Original strand, 406 - 535
Target Start/End: Complemental strand, 495766 - 495637
Alignment:
406 ttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgttttctg 505  Q
    ||||||||||||||||||||||||||||| | ||||| || ||||| |||||||||||||||||||||||||||||||||||||||||| || ||||| |    
495766 ttagtgagggaaatttagtgagggaaaacgtaaaatcactctctaattccgtcactaaattttgcgaccaaggaatttgtgaggaatttcattttttccg 495667  T
506 tcacnaattnccctccctaattttgcnttt 535  Q
    |||| |||| ||||  |||||||||| |||    
495666 tcactaatttcccttgctaattttgctttt 495637  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 82; E-Value: 2e-38
Query Start/End: Original strand, 400 - 530
Target Start/End: Complemental strand, 11049896 - 11049766
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| |||||||| || ||||||||||||||||||||||||| || ||||| |||||||||||||||||||||||||||||||||||||||||| || |    
11049896 caaaaattagtgagagatatttagtgagggaaaacatgaaatctctctctaattccgtcactaaattttgcgaccaaggaatttgtgaggaatttcattt 11049797  T
500 tttctgtcacnaattnccctccctaattttg 530  Q
    |||| ||||| |||| ||||  |||||||||    
11049796 tttccgtcactaatttcccttgctaattttg 11049766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 82; E-Value: 2e-38
Query Start/End: Original strand, 420 - 537
Target Start/End: Original strand, 14872133 - 14872250
Alignment:
420 ttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgttttctgtcacnaattnccct 519  Q
    |||||||||||||||||||||||||| ||||| |||||||||||||||||  |||||||||||||||||||||||||||||||| ||||| |||| ||||    
14872133 ttagtgagggaaaacatgaaatccctctctaattccgtcactaaattttggaaccaaggaatttgtgaggaattttatgttttccgtcacaaatttccct 14872232  T
520 ccctaattttgcntttcc 537  Q
    | |||||||| | |||||    
14872233 ctctaatttttcttttcc 14872250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 81; E-Value: 7e-38
Query Start/End: Original strand, 401 - 537
Target Start/End: Original strand, 11530220 - 11530356
Alignment:
401 aaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgtt 500  Q
    |||| ||||||||| |||||||||||||||||||||||||||| | ||||| |||||||||||||||| |||  ||| ||||| |||| |||||||||||    
11530220 aaaaattagtgaggaaaatttagtgagggaaaacatgaaatccatctctaattccgtcactaaattttacgattaagaaatttatgagaaattttatgtt 11530319  T
501 ttctgtcacnaattnccctccctaattttgcntttcc 537  Q
    ||| ||||| |||| |||||||||||||||| |||||    
11530320 ttccgtcacaaatttccctccctaattttgcttttcc 11530356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 81; E-Value: 7e-38
Query Start/End: Original strand, 400 - 529
Target Start/End: Original strand, 26939581 - 26939710
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| |||||||| || |||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||| |||||||||||||||| || |    
26939581 caaaaattagtgagagatatttagtgagggaaaacatgaaatccctctctaattccgtcactaaattttgcgaccaagaaatttgtgaggaatttcattt 26939680  T
500 tttctgtcacnaattnccctccctaatttt 529  Q
    ||| |||||| |||| |||||  |||||||    
26939681 tttttgtcactaatttccctcagtaatttt 26939710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 400 - 537
Target Start/End: Original strand, 6978273 - 6978408
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| ||||||||||| ||||||||||  |||||||||||| ||| ||||| |||||||||||||||||||||||||||||||||||||||||| || |    
6978273 caaaaattagtgagggatatttagtgag--aaaacatgaaattcctctctaattccgtcactaaattttgcgaccaaggaatttgtgaggaatttcattt 6978370  T
500 tttctgtcacnaattnccctccctaattttgcntttcc 537  Q
    |||| || || |||| ||||| |||||||||| |||||    
6978371 tttccgtaactaatttccctcgctaattttgcttttcc 6978408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #22
Raw Score: 78; E-Value: 4e-36
Query Start/End: Original strand, 401 - 527
Target Start/End: Original strand, 12844998 - 12845124
Alignment:
401 aaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgtt 500  Q
    |||| ||||||||| |||||||| |||||||||| ||||||| || ||||| |||||||||||||||||||||||| ||||||||||| |||||||| ||    
12844998 aaaaattagtgaggaaaatttagagagggaaaacgtgaaatctctctctaattccgtcactaaattttgcgaccaaagaatttgtgagcaattttatttt 12845097  T
501 ttctgtcacnaattnccctccctaatt 527  Q
    ||| ||||| |||| ||||||||||||    
12845098 ttccgtcactaatttccctccctaatt 12845124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #23
Raw Score: 78; E-Value: 4e-36
Query Start/End: Original strand, 400 - 530
Target Start/End: Complemental strand, 33250853 - 33250723
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| |||||||| || |||||||||||||||||||||||| ||| ||||| ||| |||||||||||||||||||||||||||||||||||||| || |    
33250853 caaaaattagtgagagatatttagtgagggaaaacatgaaattcctctctaattccatcactaaattttgcgaccaaggaatttgtgaggaatttcattt 33250754  T
500 tttctgtcacnaattnccctccctaattttg 530  Q
    |||| ||||| |||| |||||  ||||||||    
33250753 tttccgtcactaatttccctcgttaattttg 33250723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #24
Raw Score: 76; E-Value: 7e-35
Query Start/End: Original strand, 400 - 535
Target Start/End: Complemental strand, 1939387 - 1939252
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| ||||||||||| ||| |||||| ||||||||||||||||| ||||| ||||||| ||||||||||||||||  |||||||||||||||| || |    
1939387 caaaaattagtgagggatattcagtgagagaaaacatgaaatccctctctaattccgtcattaaattttgcgaccaaaaaatttgtgaggaatttcattt 1939288  T
500 tttctgtcacnaattnccctccctaattttgcnttt 535  Q
    |||| ||||| |||| ||||| |||||||||| |||    
1939287 tttcggtcactaatttccctcgctaattttgctttt 1939252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #25
Raw Score: 76; E-Value: 7e-35
Query Start/End: Original strand, 400 - 535
Target Start/End: Original strand, 21140933 - 21141068
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| |||||||||||||||| |||||||||||| |||||||||| ||||| ||||||||||||||||||||||| | |||||| ||||||||| || |    
21140933 caaaaattagtgagggaaattttgtgagggaaaacgtgaaatccctctctaattccgtcactaaattttgcgaccatgaaatttgggaggaatttcattt 21141032  T
500 tttctgtcacnaattnccctccctaattttgcnttt 535  Q
    |||| ||||| |||| |||||  ||||||||| |||    
21141033 tttccgtcactaatttccctcgttaattttgctttt 21141068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #26
Raw Score: 74; E-Value: 1e-33
Query Start/End: Original strand, 401 - 527
Target Start/End: Complemental strand, 12351730 - 12351604
Alignment:
401 aaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgtt 500  Q
    |||| |||||||||||||||||| |||||||||| ||||||  || ||||| ||||||| ||||||||||||| ||||||||||||||||||||||| ||    
12351730 aaaaattagtgagggaaatttagagagggaaaacgtgaaatttctctctaattccgtcattaaattttgcgactaaggaatttgtgaggaattttatttt 12351631  T
501 ttctgtcacnaattnccctccctaatt 527  Q
    ||| ||||| |||| |||||| |||||    
12351630 ttccgtcactaatttccctccttaatt 12351604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #27
Raw Score: 74; E-Value: 1e-33
Query Start/End: Original strand, 400 - 530
Target Start/End: Complemental strand, 22055757 - 22055627
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| |||||||||||| |||||||||| |||||||||||||||| ||||| ||| ||| | ||||||| |||||| |||||||||||||||||||| |    
22055757 caaaaattagtgagggaagtttagtgaggaaaaacatgaaatccctctctaattccctcattgaattttgtgaccaacgaatttgtgaggaattttattt 22055658  T
500 tttctgtcacnaattnccctccctaattttg 530  Q
    |||||||||  |||| ||||| |||||||||    
22055657 tttctgtcattaatttccctctctaattttg 22055627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #28
Raw Score: 73; E-Value: 4e-33
Query Start/End: Original strand, 401 - 530
Target Start/End: Original strand, 18048783 - 18048912
Alignment:
401 aaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgtt 500  Q
    |||| ||||||||||||||||||||||| ||||||||||||||||  |||| ||  |||||||||||||||||||| ||||||||||| |||||||| ||    
18048783 aaaaattagtgagggaaatttagtgaggaaaaacatgaaatccctccctaattctctcactaaattttgcgaccaacgaatttgtgagaaattttatttt 18048882  T
501 ttctgtcacnaattnccctccctaattttg 530  Q
    ||| ||||| ||||  |||| |||||||||    
18048883 ttccgtcactaattttcctctctaattttg 18048912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #29
Raw Score: 73; E-Value: 4e-33
Query Start/End: Original strand, 400 - 529
Target Start/End: Original strand, 20182139 - 20182268
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| ||||||||| |||||| |||||||||||| |||||||||| ||||| |||||||||||||||||||| || | |||||||||||||||| || |    
20182139 caaaaattagtgaggcaaattttgtgagggaaaacgtgaaatccctctctaattccgtcactaaattttgcgatcatgaaatttgtgaggaatttcattt 20182238  T
500 tttctgtcacnaattnccctccctaatttt 529  Q
    |||| ||||| |||| ||||| ||||||||    
20182239 tttccgtcactaatttccctcgctaatttt 20182268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #30
Raw Score: 73; E-Value: 4e-33
Query Start/End: Original strand, 400 - 529
Target Start/End: Complemental strand, 22153852 - 22153723
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| ||||||||| |||||| |||||||||||| |||||||||| ||||| |||||||||||||||||||| || | |||||||||||||||| || |    
22153852 caaaaattagtgaggcaaattttgtgagggaaaacgtgaaatccctctctaattccgtcactaaattttgcgatcatgaaatttgtgaggaatttcattt 22153753  T
500 tttctgtcacnaattnccctccctaatttt 529  Q
    |||| ||||| |||| ||||| ||||||||    
22153752 tttccgtcactaatttccctcgctaatttt 22153723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #31
Raw Score: 73; E-Value: 4e-33
Query Start/End: Original strand, 400 - 503
Target Start/End: Original strand, 27705416 - 27705519
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| |||||||||||||||| |||||||||||| |||||||||| ||||| ||||||||||||||||||||||| |||||||||||||||||| || |    
27705416 caaaaattagtgagggaaattttgtgagggaaaacgtgaaatccctctctaattccgtcactaaattttgcgaccatggaatttgtgaggaatttcattt 27705515  T
500 tttc 503  Q
    ||||    
27705516 tttc 27705519  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #32
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 400 - 535
Target Start/End: Original strand, 2669303 - 2669438
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| |||||||||||||||||||| || ||||| | |||| ||| ||||| |||||||||||||||||||||||||||||||||||||||||| || |    
2669303 caaaaattagtgagggaaatttagtgtggaaaaacgtaaaattcctctctaattccgtcactaaattttgcgaccaaggaatttgtgaggaatttcattt 2669402  T
500 tttctgtcacnaattnccctccctaattttgcnttt 535  Q
    |||  ||||| |||| |||||  ||||||||| |||    
2669403 ttttcgtcactaatttccctcgttaattttgctttt 2669438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #33
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 400 - 535
Target Start/End: Complemental strand, 27796979 - 27796844
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| ||||||||||| |||||||||||||||||||||||||||| ||||| |||||||||||||||||| | |||||||||| |||| ||| | || |    
27796979 caaaaattagtgagggatatttagtgagggaaaacatgaaatccctctctaattccgtcactaaattttgcaatcaaggaatttatgagaaatatcattt 27796880  T
500 tttctgtcacnaattnccctccctaattttgcnttt 535  Q
    |||  ||||| |||| ||||| |||||||||| |||    
27796879 ttttcgtcactaatttccctcgctaattttgctttt 27796844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #34
Raw Score: 70; E-Value: 3e-31
Query Start/End: Original strand, 406 - 535
Target Start/End: Complemental strand, 21990313 - 21990185
Alignment:
406 ttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgttttctg 505  Q
    ||||||||| ||||||||||||||||||| | |||||||| ||||| ||||||||||| ||||||||||||| |||||||||||||||| || ||||| |    
21990313 ttagtgaggaaaatttagtgagggaaaacgtaaaatccctctctaattccgtcactaatttttgcgaccaagaaatttgtgaggaatttcat-ttttccg 21990215  T
506 tcacnaattnccctccctaattttgcnttt 535  Q
    |||  |||| ||||| |||||||||| |||    
21990214 tcattaatttccctcgctaattttgctttt 21990185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #35
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 420 - 535
Target Start/End: Complemental strand, 6605621 - 6605506
Alignment:
420 ttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgttttctgtcacnaattnccct 519  Q
    ||||||||||||||||||||||| || ||||| |||||||||| |||||||||| ||| |||||||||||||||| || ||||| ||||| |||| ||||    
6605621 ttagtgagggaaaacatgaaatctctctctaattccgtcactatattttgcgactaagaaatttgtgaggaatttcattttttccgtcactaatttccct 6605522  T
520 ccctaattttgcnttt 535  Q
    | |||||||||| |||    
6605521 cgctaattttgctttt 6605506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #36
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 416 - 535
Target Start/End: Original strand, 15448395 - 15448514
Alignment:
416 aaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgttttctgtcacnaattn 515  Q
    ||||||||||||||||||| | |||||||| ||||| ||||||| ||||||||||||  |||||||||||||||||||| || ||||| ||||| ||||     
15448395 aaatttagtgagggaaaacgtaaaatccctctctaattccgtcattaaattttgcgattaaggaatttgtgaggaatttcattttttccgtcactaattt 15448494  T
516 ccctccctaattttgcnttt 535  Q
    ||||| |||||||||| |||    
15448495 ccctcgctaattttgctttt 15448514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #37
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 401 - 521
Target Start/End: Original strand, 23281781 - 23281901
Alignment:
401 aaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgtt 500  Q
    |||| |||| ||||||||||| |||||||||||| |||||||||| ||||| |||||||||||||||||||||||   ||||||||||||||||||| ||    
23281781 aaaaattagggagggaaattttgtgagggaaaacgtgaaatccctctctaattccgtcactaaattttgcgaccataaaatttgtgaggaattttatttt 23281880  T
501 ttctgtcacnaattnccctcc 521  Q
    |||  |||| |||| ||||||    
23281881 ttccatcactaatttccctcc 23281901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #38
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 435 - 535
Target Start/End: Original strand, 14772690 - 14772790
Alignment:
435 atgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgttttctgtcacnaattnccctccctaattttgcntt 534  Q
    |||||||| || ||||| |||||||||||||||| |||||||||||||||||||||||||||||||||  ||||| |||| | |||||||||||||| ||    
14772690 atgaaatctctctctaattccgtcactaaattttacgaccaaggaatttgtgaggaattttatgtttttcgtcacaaatttctctccctaattttgcttt 14772789  T
535 t 535  Q
    |    
14772790 t 14772790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #39
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 400 - 535
Target Start/End: Original strand, 9885237 - 9885372
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| ||||||| | |||||||||||||||||||||||||||||| | ||| |  ||||||||||||||| |||||  ||||||||||  ||||||| |    
9885237 caaaaattagtgacgaaaatttagtgagggaaaacatgaaatccctctttaattttgtcactaaattttgcaaccaacaaatttgtgagagattttattt 9885336  T
500 tttctgtcacnaattnccctccctaattttgcnttt 535  Q
    |||| ||||| |||| |||||||| ||||||| |||    
9885337 tttccgtcactaatttccctccctgattttgctttt 9885372  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #40
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 400 - 535
Target Start/End: Original strand, 18492363 - 18492498
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| |||||||| ||||||| || ||||||||| |||||||||  ||||| ||||||||||||||||||||||| |||||||||||| ||||| || |    
18492363 caaaaattagtgagagaaattttgtaagggaaaacgtgaaatcccactctaattccgtcactaaattttgcgaccatggaatttgtgagaaatttcattt 18492462  T
500 tttctgtcacnaattnccctccctaattttgcnttt 535  Q
    |||| ||||| ||||  | || |||||||||| |||    
18492463 tttccgtcactaatttgcatcgctaattttgctttt 18492498  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #41
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 425 - 535
Target Start/End: Original strand, 5360428 - 5360538
Alignment:
425 gagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgttttctgtcacnaattnccctcccta 524  Q
    |||||||||| | ||||| || ||||| ||||||||||||||||||||||||  ||||||||||||||||||| ||||| ||||| |||| ||||| |||    
5360428 gagggaaaacgtaaaatctctctctaattccgtcactaaattttgcgaccaaaaaatttgtgaggaattttattttttccgtcactaatttccctcgcta 5360527  T
525 attttgcnttt 535  Q
    ||||||| |||    
5360528 attttgctttt 5360538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #42
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 401 - 535
Target Start/End: Complemental strand, 16250946 - 16250812
Alignment:
401 aaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgtt 500  Q
    |||| |||||||| ||||||| |||||||||||| ||||||| || ||||| || ||||||||||||||||| || | |||||||||||||||| || ||    
16250946 aaaaattagtgagagaaattttgtgagggaaaacgtgaaatctctctctaattctgtcactaaattttgcgatcatgaaatttgtgaggaatttcatttt 16250847  T
501 ttctgtcacnaattnccctccctaattttgcnttt 535  Q
    ||| ||||| |||| |||||  ||||||||| |||    
16250846 ttccgtcactaatttccctcgttaattttgctttt 16250812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #43
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 420 - 530
Target Start/End: Original strand, 12499230 - 12499340
Alignment:
420 ttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgttttctgtcacnaattnccct 519  Q
    ||||||||||||||| | |||||||| ||||| ||||||||||||||||||||||||  |||||||||||||||| || ||||| ||||| | || ||||    
12499230 ttagtgagggaaaacgtaaaatccctctctaactccgtcactaaattttgcgaccaaaaaatttgtgaggaatttcattttttccgtcactactttccct 12499329  T
520 ccctaattttg 530  Q
    | |||||||||    
12499330 cgctaattttg 12499340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #44
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 420 - 530
Target Start/End: Original strand, 12506559 - 12506669
Alignment:
420 ttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgttttctgtcacnaattnccct 519  Q
    ||||||||||||||| | |||||||| ||||| ||||||||||||||||||||||||  |||||||||||||||| || ||||| ||||| | || ||||    
12506559 ttagtgagggaaaacgtaaaatccctctctaactccgtcactaaattttgcgaccaaaaaatttgtgaggaatttcattttttccgtcactactttccct 12506658  T
520 ccctaattttg 530  Q
    | |||||||||    
12506659 cgctaattttg 12506669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #45
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 420 - 530
Target Start/End: Complemental strand, 12509671 - 12509561
Alignment:
420 ttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgttttctgtcacnaattnccct 519  Q
    ||||||||||||||| | |||||||| ||||| ||||||||||||||||||||||||  |||||||||||||||| || ||||| ||||| | || ||||    
12509671 ttagtgagggaaaacgtaaaatccctctctaactccgtcactaaattttgcgaccaaaaaatttgtgaggaatttcattttttccgtcactactttccct 12509572  T
520 ccctaattttg 530  Q
    | |||||||||    
12509571 cgctaattttg 12509561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #46
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 406 - 535
Target Start/End: Complemental strand, 30834099 - 30833970
Alignment:
406 ttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgttttctg 505  Q
    ||||||| ||||||||||||||||| ||| | |||||||| ||||| || |||| ||||||||||||||||  |||| ||||||||||| || ||||| |    
30834099 ttagtgaaggaaatttagtgagggagaacgtaaaatccctctctaattctgtcattaaattttgcgaccaaaaaattagtgaggaatttcattttttccg 30834000  T
506 tcacnaattnccctccctaattttgcnttt 535  Q
    |||| |||| ||||| |||||||||| |||    
30833999 tcactaatttccctcgctaattttgctttt 30833970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #47
Raw Score: 61; E-Value: 6e-26
Query Start/End: Original strand, 420 - 529
Target Start/End: Original strand, 28668114 - 28668223
Alignment:
420 ttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgttttctgtcacnaattnccct 519  Q
    |||||||||||||   | |||||||||||||| ||||||| |||||||||||| |||||||||||||||||||||||| ||||| |||||  ||| ||||    
28668114 ttagtgagggaaattgtaaaatccctttctaattccgtcattaaattttgcgatcaaggaatttgtgaggaattttattttttccgtcactgatttccct 28668213  T
520 ccctaatttt 529  Q
    | ||||||||    
28668214 cgctaatttt 28668223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #48
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 420 - 535
Target Start/End: Complemental strand, 5192314 - 5192199
Alignment:
420 ttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgttttctgtcacnaattnccct 519  Q
    ||||||||||||||| | |||||||| ||||| |||||||||||||||| ||||||| ||||||||||||||||| || |||||  |||| ||||  |||    
5192314 ttagtgagggaaaacgtaaaatccctctctaattccgtcactaaattttacgaccaaagaatttgtgaggaatttcattttttccttcactaattttcct 5192215  T
520 ccctaattttgcnttt 535  Q
    | |||||||||| |||    
5192214 cgctaattttgctttt 5192199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #49
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 400 - 494
Target Start/End: Original strand, 14036614 - 14036708
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattt 494  Q
    ||||| |||||||||||||||| |||||||||||| |||||||||| ||||| || |||| |||||||||||| || ||||||||||||||||||    
14036614 caaaaattagtgagggaaattttgtgagggaaaacgtgaaatccctctctaattctgtcattaaattttgcgatcatggaatttgtgaggaattt 14036708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #50
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 400 - 502
Target Start/End: Complemental strand, 21691641 - 21691539
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| |||||||||||| ||||| |||| ||||| |||||||||| ||||| | |||||||||||||||||||||| ||||||||||| |||||||| |    
21691641 caaaaattagtgagggaattttagagaggaaaaacgtgaaatccctctctaatttcgtcactaaattttgcgaccaaagaatttgtgagaaattttattt 21691542  T
500 ttt 502  Q
    |||    
21691541 ttt 21691539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #51
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 400 - 529
Target Start/End: Complemental strand, 12160991 - 12160863
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgt 499  Q
    ||||| ||||||||| | ||||||||||||||||||| |||||||| ||||| | |||||||||||||| ||| |||  |||||||||||||||| || |    
12160991 caaaaattagtgaggaatatttagtgagggaaaacataaaatccctctctaatttcgtcactaaatttt-cgatcaaaaaatttgtgaggaatttcattt 12160893  T
500 tttctgtcacnaattnccctccctaatttt 529  Q
    |||  ||||| |||| ||||| ||||||||    
12160892 tttacgtcactaatttccctcgctaatttt 12160863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #52
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 420 - 503
Target Start/End: Original strand, 13145016 - 13145099
Alignment:
420 ttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgttttc 503  Q
    ||||||||||||||| ||||||| || | ||| |||||||||||||||||||||||||||||||||||||||||| || |||||    
13145016 ttagtgagggaaaacgtgaaatctctctttaattccgtcactaaattttgcgaccaaggaatttgtgaggaatttcattttttc 13145099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #53
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 420 - 503
Target Start/End: Original strand, 33547560 - 33547643
Alignment:
420 ttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgttttc 503  Q
    |||||||||||||||||||||||||| ||||| |  ||||||||||||||||||||| |||||||||||| ||||||| |||||    
33547560 ttagtgagggaaaacatgaaatccctatctaattttgtcactaaattttgcgaccaaagaatttgtgagggattttattttttc 33547643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #54
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 401 - 514
Target Start/End: Complemental strand, 343707 - 343594
Alignment:
401 aaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttatgtt 500  Q
    |||| ||||||||||||||||| ||||||||||| | |||||||| ||||| || ||||||||| |||||||||||  |||||||||||||||| || ||    
343707 aaaaattagtgagggaaatttaatgagggaaaacgtaaaatccctctctaattctgtcactaaaatttgcgaccaaaaaatttgtgaggaatttcatttt 343608  T
501 ttctgtcacnaatt 514  Q
    ||  ||||| ||||    
343607 ttacgtcactaatt 343594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #55
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 400 - 535
Target Start/End: Original strand, 9060085 - 9060219
Alignment:
400 caaaagttagtgagggaaatttagtgagggaaaacatgaaatccctttctaantccgtcactaaattttgcgaccaaggaatttgtgaggaattttat