View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 108_9_90 (Length: 422)

Name: 108_9_90
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 108_9_90
108_9_90
[»] chr5 (1 HSPs)
chr5 (1-422)||(33806922-33807343)
[»] chr4 (1 HSPs)
chr4 (209-391)||(43233139-43233321)
[»] scaffold0006 (2 HSPs)
scaffold0006 (337-422)||(232414-232499)
scaffold0006 (196-266)||(232570-232640)
[»] chr3 (1 HSPs)
chr3 (211-251)||(11179415-11179455)


Alignment Details
Target: chr5 (Bit Score: 320; Significance: 1e-180; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 320; E-Value: 1e-180
Query Start/End: Original strand, 1 - 422
Target Start/End: Original strand, 33806922 - 33807343
Alignment:
1 aaataaaccttagaaactagaacaaagatggctttggtaatattcaccaagttgttaaagaagcacaagataaattacatgatatctgacaacaaattta 100  Q
    |||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |    
33806922 aaataaaccttagaaactggaacaaagatgtctttggtaatattcaccaagttgttaaagaagcagaagataaattacatgatatctgacaacaaattca 33807021  T
101 aacctctggctacttagaaaccaaaatacaacaagagaagctagcacnnnnnnnnccttgaagaagtcctcaacaaagaagaagtatttttgcaagaaaa 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||        ||||||||||| ||||||||||||||||| ||||| |||||||||    
33807022 aacctctggctacttagaaaccaaaatacaacaagagaagctagcacaaaaaaaaccttgaagaagccctcaacaaagaagaagcattttggcaagaaaa 33807121  T
201 atctaaactgaagtggcatttagaaggtggtaggaacacatcatattttcataaggtcaccaaaattagaaatnctacnaaacacattacatcaatcaaa 300  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||| |||||||||||||||||||||    
33807122 atctaaactgaagtggcatttagaaggtggtaggaacacatcatattttcataaggtcgccaaaattagaaatactacaaaacacattacatcaatcaaa 33807221  T
301 gatggtggaaacactttcattgatcccatactcattgctaatcatgcccttaatttttntaagtctcttttttgcactnncattgttttgcncgatagct 400  Q
    ||||| ||||||||| ||||||||||||||||||||| | |||||||||||||||||| ||||||||||||||| |||  |||||||||||  || ||||    
33807222 gatggaggaaacactatcattgatcccatactcattgttgatcatgcccttaatttttataagtctcttttttgtactaacattgttttgcaggacagct 33807321  T
401 tgcttatggaagaagtaattcc 422  Q
    ||||||||||||||||||||||    
33807322 tgcttatggaagaagtaattcc 33807343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 44; Significance: 7e-16; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 209 - 391
Target Start/End: Original strand, 43233139 - 43233321
Alignment:
209 tgaagtggcatttagaaggtggtaggaacacatcatattttcataaggtcaccaaaattagaaatnctacnaaacacattacatcaatcaaagatggtgg 308  Q
    ||||||||||||||||||||| ||| |||||  | ||||| | || ||| || ||||||||| || |||| || | ||| || |||||||||||||| |     
43233139 tgaagtggcatttagaaggtgatagaaacactgcctatttccgtagggttacaaaaattagacatactaccaatctcatcacttcaatcaaagatggcga 43233238  T
309 aaacactttcattgatcccatactcattgctaatcatgcccttaatttttntaagtctcttttttgcactnncattgttttgc 391  Q
    ||| | | ||| |||||  |  || ||||||||||||||| |||| |||| ||| ||| | |||||||||  |||||||||||    
43233239 aaatattatcactgatcaaaatcttattgctaatcatgccgttaacttttataaatctttattttgcactaacattgttttgc 43233321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0006 (Bit Score: 38; Significance: 0.000000000002; HSPs: 2)
Name: scaffold0006
Description:

Target: scaffold0006; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 337 - 422
Target Start/End: Complemental strand, 232499 - 232414
Alignment:
337 gctaatcatgcccttaatttttntaagtctcttttttgcactnncattgttttgcncgatagcttgcttatggaagaagtaattcc 422  Q
    |||||||||||  |||||| || ||| ||| | |||||||||  |||||||||||  |||||||||||| |||| |||||||||||    
232499 gctaatcatgctgttaattattttaaatctttattttgcactaacattgttttgcaggatagcttgcttgtggatgaagtaattcc 232414  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0006; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 196 - 266
Target Start/End: Complemental strand, 232640 - 232570
Alignment:
196 gaaaaatctaaactgaagtggcatttagaaggtggtaggaacacatcatattttcataaggtcaccaaaat 266  Q
    |||||||| ||| |||| |||||||||||| |||  ||||||||  |||||||||||| | ||||||||||    
232640 gaaaaatccaaagtgaaatggcatttagaaagtgacaggaacactgcatattttcataggatcaccaaaat 232570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 211 - 251
Target Start/End: Complemental strand, 11179455 - 11179415
Alignment:
211 aagtggcatttagaaggtggtaggaacacatcatattttca 251  Q
    ||||||||| | ||||||| |||||||||||||||||||||    
11179455 aagtggcatgtggaaggtgataggaacacatcatattttca 11179415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 108280 times since January 2019
Visitors: 1329