View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 11737_high_2 (Length: 462)

Name: 11737_high_2
Description: 11737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] 11737_high_2
[»] chr8 (1 HSPs)
chr8 (1-438)||(929795-930233)

Alignment Details
Target: chr8 (Bit Score: 373; Significance: 0; HSPs: 1)
Name: chr8

Target: chr8; HSP #1
Raw Score: 373; E-Value: 0
Query Start/End: Original strand, 1 - 438
Target Start/End: Complemental strand, 930233 - 929795
1 agtagtcgtggtgcaagcaagaccgtggcagaacagtacgtactataacagtcaaaaagtgttaaactagaaatcaacaacaaaaagcaagtctaaggtg 100  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
930233 agtagttgtggtgcaagcaagaccgtggcagaacagtacgtactataacagtcaaaaagtgttaaactagaaatcaacaacaaaaagcaagtctaaggtg 930134  T
101 taggatacaccaatataattgacttaggataaccaannnnnnnnnnnnnn-gaataaaagataagtaaaacacgccattgatatataatcatggtatata 199  Q
    |||||||||||||||||||||||| |||||||||||               ||||||||||| |||||||||||||||||||||||||||||||||||||    
930133 taggatacaccaatataattgactcaggataaccaattttttttgttttttgaataaaagattagtaaaacacgccattgatatataatcatggtatata 930034  T
200 ctatacagtggaatcatgtatttcaacacttccaaaactgatgaaaaatagcatatctatagttaatcacaattaacattcacaattaatatcaacaatg 299  Q
930033 ctatacagtggaatcatgtatttcaacacttccaaaactgatgaaaaatagcatatctatagttaatcacaattaacattcacaattaatatcaacaatg 929934  T
300 aacatcattaacaacaactaatacaacatgatttggagatgatcataaaataaagaaataatcgatataatcaagatgattattgaagagtatcaacaaa 399  Q
929933 aacatcattaacaacaactaatacaacatgatttggagatgatcataaaataaagaaataatcgatataatcaagatgattattgaagagtatcaacaaa 929834  T
400 ctcggtagcatcgacacccctgatcaaagatgtgttaga 438  Q
    |||||||||||||||||||||||||||||| ||||||||    
929833 ctcggtagcatcgacacccctgatcaaagacgtgttaga 929795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 84126 times since January 2019
Visitors: 2323