View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 11737_high_3 (Length: 398)

Name: 11737_high_3
Description: 11737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 11737_high_3
11737_high_3
[»] chr1 (1 HSPs)
chr1 (1-381)||(46586552-46586931)


Alignment Details
Target: chr1 (Bit Score: 337; Significance: 0; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 337; E-Value: 0
Query Start/End: Original strand, 1 - 381
Target Start/End: Complemental strand, 46586931 - 46586552
Alignment:
1 tctatttgatacaatggatagtatatcaaacgtgatttattgaaaatgattcttaactcaatccaaatcacctctgcttatgaatggttgtagatgatca 100  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
46586931 tctatttgatacaatgggtagtatatcaaacgtgatttattgaaaatgattcttaactcaatcaaaatcacctctgcttatgaatggttgtagatgatca 46586832  T
101 caacttataatttttatgaatatcattctcaaagttatatggtgaaatgttttgaaaaaagttgatgatgcatgggaaatttaatggacggtgggttgat 200  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||| |||||||||||||| |||||||||||||||||    
46586831 caacttataatttttatgaatatcattctcaaagttatatggtaaaatgttttgaaaaa-gttgatggtgcatgggaaatttgatggacggtgggttgat 46586733  T
201 gacaatatagatatgtggaaggtgtgactcccaatcatttgtggttcaattctttcacattcgaaggttgaatcatcgcaataaatcaatggcccatttc 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46586732 gacaatatagatatgtggaaggtgtgactcccaatcatttgtggttcaattctttcacattcgaaggttgaatcatcgcaataaatcaatggcccatttc 46586633  T
301 attaaattctccatatggatacagatcgccatcaatccactagtttcagctctagtttgtgtccaattaatatgtcacacc 381  Q
     |||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||    
46586632 tttaaattctccagatggatacagatcgccatcaatccattagtttcagctctagtttgtgtccaattaacatgtcacacc 46586552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 105600 times since January 2019
Visitors: 2328