View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 11737_high_4 (Length: 339)

Name: 11737_high_4
Description: 11737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] 11737_high_4
[»] chr8 (1 HSPs)
chr8 (1-339)||(930228-930566)

Alignment Details
Target: chr8 (Bit Score: 303; Significance: 1e-170; HSPs: 1)
Name: chr8

Target: chr8; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 1 - 339
Target Start/End: Complemental strand, 930566 - 930228
1 ccactcttatccaaaaatcagactttgaaataataatttagaaagatatatacaaagataaacggatttaaacaaatgttggcccctgttcgaggtggtt 100  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
930566 ccactcttatccaaaaatcagactttgaaacaataatttagaaagatatatacaaagataaacggatttaaacaaatgttggcccctgttcgaggtggtt 930467  T
101 tttgtgttatattttgaaattttcataatgtaacaacctcagatatagnnnnnnnngtcaaaattaacaagaaacataacagcagcaatattgattgcac 200  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||        ||||||||||||||||||||||||||||||||||||||||||||    
930466 tttgtgttatattttgaaattttcataatgtaacaacctcggatatagttttttttgtcaaaattaacaagaaacataacagcagcaatattgattgcac 930367  T
201 aaagctaaaaatcgtttgtggataatatgattacctgagaacaaacaacaatatgaactggattgatcacttggaatggccgatacacgaatggtgacgc 300  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
930366 aaagctaaaaaccgtttgtggataatatgattacctgagaacaaacaacaatatgaactggattgatcacttggaatggccgatacacgaatggtgacgc 930267  T
301 acacaggaacaacctcgtgagatgaaacttgaaagtagt 339  Q
930266 acacaggaacaacctcgtgagatgaaacttgaaagtagt 930228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC