View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 11737_low_2 (Length: 499)

Name: 11737_low_2
Description: 11737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] 11737_low_2
[»] chr5 (3 HSPs)
chr5 (16-493)||(41722195-41722672)
chr5 (88-493)||(34355795-34356200)
chr5 (7-92)||(34359375-34359460)
[»] chr4 (4 HSPs)
chr4 (16-493)||(30946238-30946715)
chr4 (16-493)||(42269688-42270165)
chr4 (16-493)||(48697876-48698353)
chr4 (7-493)||(2002668-2003154)
[»] chr8 (2 HSPs)
chr8 (16-493)||(9440146-9440623)
chr8 (7-493)||(24594537-24595023)
[»] chr6 (6 HSPs)
chr6 (16-493)||(27874764-27875241)
chr6 (7-493)||(26976939-26977425)
chr6 (7-493)||(1472511-1472996)
chr6 (19-493)||(21965178-21965640)
chr6 (139-261)||(18967120-18967241)
chr6 (5-90)||(18967256-18967341)
[»] chr3 (7 HSPs)
chr3 (7-493)||(5819321-5819807)
chr3 (7-493)||(54544930-54545416)
chr3 (7-493)||(42588733-42589219)
chr3 (93-493)||(25880628-25881030)
chr3 (366-493)||(25880440-25880567)
chr3 (222-331)||(25880239-25880348)
chr3 (416-493)||(25878084-25878161)
[»] chr2 (3 HSPs)
chr2 (7-493)||(829264-829750)
chr2 (7-493)||(28714868-28715344)
chr2 (16-493)||(13840984-13841450)
[»] scaffold0074 (1 HSPs)
scaffold0074 (7-493)||(28081-28567)
[»] chr7 (4 HSPs)
chr7 (45-455)||(2324197-2324601)
chr7 (7-408)||(7504809-7505210)
chr7 (20-362)||(22509836-22510175)
chr7 (401-493)||(7506016-7506108)
[»] chr1 (3 HSPs)
chr1 (282-492)||(34973320-34973530)
chr1 (16-164)||(41413635-41413783)
chr1 (16-168)||(34973589-34973743)

Alignment Details
Target: chr5 (Bit Score: 462; Significance: 0; HSPs: 3)
Name: chr5

Target: chr5; HSP #1
Raw Score: 462; E-Value: 0
Query Start/End: Original strand, 16 - 493
Target Start/End: Complemental strand, 41722672 - 41722195
16 atgatattgaacacctatgtgtttcgtccttgaatgaaaagctggattccttgcaatgtgcaaggcactctgactgtcacaatacacagtaatttgttct 115  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||     
41722672 atgatattgaacgcctatgtgtttcgtccttgaatgaaaagctggattccttgcaatatgcaaggcactctgactgtcacaatacacagtaatttgttcc 41722573  T
116 tgcttgtgcccgagttcctccattaacctttgcatccaaatagcttccttgcatgcttgagtagctgccatgtactccgcttctgtcgttgacagagcta 215  Q
41722572 tgcttgtgcccgagttcctccattaacctttgcatccaaatagcttccttgcatgcttgagtagctgccatgtactccgcttctgtcgttgacagagcta 41722473  T
216 caaccgtttgtaacttggacaaccaacttactgctcctcctgcaagcgtgaacacataaccagtagtagattttcttttatcatgatcacctgcaaaatc 315  Q
41722472 caaccgtttgtaacttggacaaccaacttactgctcctcctgcaagcgtgaacacataaccagtagtagattttcttttatcatgatcacctgcaaaatc 41722373  T
316 tgaatcaacataaccccagacagttaactctgatcctccgaaacataccgcaacacctgaggttcctttaatgtacctcatgattctcttaacagcattc 415  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41722372 tgaatcaacataacccctgacagttaactctgatcctccgaaacataccgcaacacctgaggttcctttaatgtacctcatgattctcttaacagcattc 41722273  T
416 caatgctctttacccggatccgccataaaccgactaaccactcccactgcttgtgcaatgtctggtcttgtacatatc 493  Q
41722272 caatgctctttacccggatccgccataaaccgactaaccactcccactgcttgtgcaatgtctggtcttgtacatatc 41722195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 374; E-Value: 0
Query Start/End: Original strand, 88 - 493
Target Start/End: Complemental strand, 34356200 - 34355795
88 actgtcacaatacacagtaatttgttcttgcttgtgcccgagttcctccattaacctttgcatccaaatagcttccttgcatgcttgagtagctgccatg 187  Q
    |||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
34356200 actgtcacaatacacagtaattttctcttgcttgtgcccgagttcctccattaacctttgcatccaaatagcttccttgcatgcttgggtagctgccatg 34356101  T
188 tactccgcttctgtcgttgacagagctacaaccgtttgtaacttggacaaccaacttactgctcctcctgcaagcgtgaacacataaccagtagtagatt 287  Q
    ||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34356100 tactcagcttctgtcgttgacagagctacaacagtttgtaacttggacaaccaacttactgctcctcctgcaagcgtgaacacataaccagtagtagatt 34356001  T
288 ttcttttatcatgatcacctgcaaaatctgaatcaacataaccccagacagttaactctgatcctccgaaacataccgcaacacctgaggttcctttaat 387  Q
    ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||| |||||||||||||    
34356000 ttcttttatcatgatcacctgcaaaatctgaatcaacataacccctgacagttaactctgatcctccgaaacatactgcaacacctaaggttcctttaat 34355901  T
388 gtacctcatgattctcttaacagcattccaatgctctttacccggatccgccataaaccgactaaccactcccactgcttgtgcaatgtctggtcttgta 487  Q
34355900 gtacctcatgattctcttaacagcattccaatgctctttacccggatccgccataaaccgactaaccactcccactgcttgtgcaatgtctggtcttgta 34355801  T
488 catatc 493  Q
34355800 catatc 34355795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 7 - 92
Target Start/End: Complemental strand, 34359460 - 34359375
7 tcgaagaatatgatattgaacacctatgtgtttcgtccttgaatgaaaagctggattccttgcaatgtgcaaggcactctgactgt 92  Q
    ||||| || |||||||||||| || ||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
34359460 tcgaacaaaatgatattgaacgccaatgtgcttcgtccttgaatgaaaagctggattccttgcaatgtgtaaggcactctgactgt 34359375  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 462; Significance: 0; HSPs: 4)
Name: chr4

Target: chr4; HSP #1
Raw Score: 462; E-Value: 0
Query Start/End: Original strand, 16 - 493
Target Start/End: Original strand, 30946238 - 30946715
16 atgatattgaacacctatgtgtttcgtccttgaatgaaaagctggattccttgcaatgtgcaaggcactctgactgtcacaatacacagtaatttgttct 115  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
30946238 atgatattgaacgcctatgtgtttcgtccttgaatgaaaagctggattccttgcaatgtgcaaggcactctgactgtcacaatacacagtaatttgttcc 30946337  T
116 tgcttgtgcccgagttcctccattaacctttgcatccaaatagcttccttgcatgcttgagtagctgccatgtactccgcttctgtcgttgacagagcta 215  Q
30946338 tgcttgtgcccgagttcctccattaacctttgcatccaaatagcttccttgcatgcttgagtagctgccatgtactccgcttctgtcgttgacagagcta 30946437  T
216 caaccgtttgtaacttggacaaccaacttactgctcctcctgcaagcgtgaacacataaccagtagtagattttcttttatcatgatcacctgcaaaatc 315  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30946438 caaccgtttgtaacttggacaaccaacttactgctcctcctgtaagcgtgaacacataaccagtagtagattttcttttatcatgatcacctgcaaaatc 30946537  T
316 tgaatcaacataaccccagacagttaactctgatcctccgaaacataccgcaacacctgaggttcctttaatgtacctcatgattctcttaacagcattc 415  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30946538 tgaatcaacataacccctgacagttaactctgatcctccgaaacataccgcaacacctgaggttcctttaatgtacctcatgattctcttaacagcattc 30946637  T
416 caatgctctttacccggatccgccataaaccgactaaccactcccactgcttgtgcaatgtctggtcttgtacatatc 493  Q
30946638 caatgctctttacccggatccgccataaaccgactaaccactcccactgcttgtgcaatgtctggtcttgtacatatc 30946715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 462; E-Value: 0
Query Start/End: Original strand, 16 - 493
Target Start/End: Complemental strand, 42270165 - 42269688
16 atgatattgaacacctatgtgtttcgtccttgaatgaaaagctggattccttgcaatgtgcaaggcactctgactgtcacaatacacagtaatttgttct 115  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||     
42270165 atgatattgaacgcctatgtgtttcgtccttgaatgaaaagctggattccttgcaatatgcaaggcactctgactgtcacaatacacagtaatttgttcc 42270066  T
116 tgcttgtgcccgagttcctccattaacctttgcatccaaatagcttccttgcatgcttgagtagctgccatgtactccgcttctgtcgttgacagagcta 215  Q
42270065 tgcttgtgcccgagttcctccattaacctttgcatccaaatagcttccttgcatgcttgagtagctgccatgtactccgcttctgtcgttgacagagcta 42269966  T
216 caaccgtttgtaacttggacaaccaacttactgctcctcctgcaagcgtgaacacataaccagtagtagattttcttttatcatgatcacctgcaaaatc 315  Q
42269965 caaccgtttgtaacttggacaaccaacttactgctcctcctgcaagcgtgaacacataaccagtagtagattttcttttatcatgatcacctgcaaaatc 42269866  T
316 tgaatcaacataaccccagacagttaactctgatcctccgaaacataccgcaacacctgaggttcctttaatgtacctcatgattctcttaacagcattc 415  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42269865 tgaatcaacataacccctgacagttaactctgatcctccgaaacataccgcaacacctgaggttcctttaatgtacctcatgattctcttaacagcattc 42269766  T
416 caatgctctttacccggatccgccataaaccgactaaccactcccactgcttgtgcaatgtctggtcttgtacatatc 493  Q
42269765 caatgctctttacccggatccgccataaaccgactaaccactcccactgcttgtgcaatgtctggtcttgtacatatc 42269688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 462; E-Value: 0
Query Start/End: Original strand, 16 - 493
Target Start/End: Original strand, 48697876 - 48698353
16 atgatattgaacacctatgtgtttcgtccttgaatgaaaagctggattccttgcaatgtgcaaggcactctgactgtcacaatacacagtaatttgttct 115  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||     
48697876 atgatattgaacgcctatgtgtttcgtccttgaatgaaaagctggattccttgcaatatgcaaggcactctgactgtcacaatacacagtaatttgttcc 48697975  T
116 tgcttgtgcccgagttcctccattaacctttgcatccaaatagcttccttgcatgcttgagtagctgccatgtactccgcttctgtcgttgacagagcta 215  Q
48697976 tgcttgtgcccgagttcctccattaacctttgcatccaaatagcttccttgcatgcttgagtagctgccatgtactccgcttctgtcgttgacagagcta 48698075  T
216 caaccgtttgtaacttggacaaccaacttactgctcctcctgcaagcgtgaacacataaccagtagtagattttcttttatcatgatcacctgcaaaatc 315  Q
48698076 caaccgtttgtaacttggacaaccaacttactgctcctcctgcaagcgtgaacacataaccagtagtagattttcttttatcatgatcacctgcaaaatc 48698175  T
316 tgaatcaacataaccccagacagttaactctgatcctccgaaacataccgcaacacctgaggttcctttaatgtacctcatgattctcttaacagcattc 415  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48698176 tgaatcaacataacccctgacagttaactctgatcctccgaaacataccgcaacacctgaggttcctttaatgtacctcatgattctcttaacagcattc 48698275  T
416 caatgctctttacccggatccgccataaaccgactaaccactcccactgcttgtgcaatgtctggtcttgtacatatc 493  Q
48698276 caatgctctttacccggatccgccataaaccgactaaccactcccactgcttgtgcaatgtctggtcttgtacatatc 48698353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 243; E-Value: 1e-134
Query Start/End: Original strand, 7 - 493
Target Start/End: Complemental strand, 2003154 - 2002668
7 tcgaagaatatgatattgaacacctatgtgtttcgtccttgaatgaaaagctggattccttgcaatgtgcaaggcactctgactgtcacaatacacagta 106  Q
    ||||| || ||| ||||||||| |||||||||| || || ||||||||   ||||||||||||||| ||||| ||||||| ||||||||||||||||  |    
2003154 tcgaacaaaatggtattgaacatctatgtgttttgttctcgaatgaaagaatggattccttgcaatatgcaatgcactctaactgtcacaatacacaaca 2003055  T
107 atttgttcttgcttgtgcccgagttcctccattaacctttgcatccaaatagcttccttgcatgcttgagtagctgccatgtactccgcttctgtcgttg 206  Q
    ||||||| |||  ||||||||||||| |||||||  ||||| |||||||||||||||||||| |||||  |||||||||| || || |||||||| || |    
2003054 atttgttgttgactgtgcccgagttcttccattagtctttgtatccaaatagcttccttgcaagcttgcatagctgccatatattcagcttctgtagtag 2002955  T
207 acagagctacaaccgtttgtaacttggacaaccaacttactgctcctcctgcaagcgtgaacacataaccagtagtagattttcttttatcatgatcacc 306  Q
    | |||||||| || | |||||| || ||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||| |||||||    
2002954 atagagctacgacagattgtaattttgacaaccaacttactgctcctcctgcaagtgtgaacacataaccagtagtagatcttcttttatcaagatcacc 2002855  T
307 tgcaaaatctgaatcaacataaccccagacagttaactctgatcctccgaaacataccgcaacacctgaggttcctttaatgtacctcatgattctctta 406  Q
    ||||||||||||||||||||||||   |||| | || ||  |||||| ||||||||  |||||| || |||||||||| || || |||| ||||||||||    
2002854 tgcaaaatctgaatcaacataacctttgacaataaattccaatcctctgaaacataatgcaacatctaaggttccttttatatatctcaggattctctta 2002755  T
407 acagcattccaatgctctttacccggatccgccataaaccgactaaccactcccactgcttgtgcaatgtctggtcttgtacatatc 493  Q
    ||||||| ||||||||||||||| |||||||||||||| ||||||||| ||||||||||||||||||||||||| ||||||||||||    
2002754 acagcatcccaatgctctttaccaggatccgccataaatcgactaaccgctcccactgcttgtgcaatgtctggccttgtacatatc 2002668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 458; Significance: 0; HSPs: 2)
Name: chr8

Target: chr8; HSP #1
Raw Score: 458; E-Value: 0
Query Start/End: Original strand, 16 - 493
Target Start/End: Original strand, 9440146 - 9440623
16 atgatattgaacacctatgtgtttcgtccttgaatgaaaagctggattccttgcaatgtgcaaggcactctgactgtcacaatacacagtaatttgttct 115  Q
    |||||||||||  |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||     
9440146 atgatattgaatgcctatgtgtttcgtccttgaatgaaaagctggattccttgcaatatgcaaggcactctgactgtcacaatacacagtaatttgttcc 9440245  T
116 tgcttgtgcccgagttcctccattaacctttgcatccaaatagcttccttgcatgcttgagtagctgccatgtactccgcttctgtcgttgacagagcta 215  Q
9440246 tgcttgtgcccgagttcctccattaacctttgcatccaaatagcttccttgcatgcttgagtagctgccatgtactccgcttctgtcgttgacagagcta 9440345  T
216 caaccgtttgtaacttggacaaccaacttactgctcctcctgcaagcgtgaacacataaccagtagtagattttcttttatcatgatcacctgcaaaatc 315  Q
9440346 caaccgtttgtaacttggacaaccaacttactgctcctcctgcaagcgtgaacacataaccagtagtagattttcttttatcatgatcacctgcaaaatc 9440445  T
316 tgaatcaacataaccccagacagttaactctgatcctccgaaacataccgcaacacctgaggttcctttaatgtacctcatgattctcttaacagcattc 415  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9440446 tgaatcaacataacccctgacagttaactctgatcctccgaaacataccgcaacacctgaggttcctttaatgtacctcatgattctcttaacagcattc 9440545  T
416 caatgctctttacccggatccgccataaaccgactaaccactcccactgcttgtgcaatgtctggtcttgtacatatc 493  Q
9440546 caatgctctttacccggatccgccataaaccgactaaccactcccactgcttgtgcaatgtctggtcttgtacatatc 9440623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 7 - 493
Target Start/End: Original strand, 24594537 - 24595023
7 tcgaagaatatgatattgaacacctatgtgtttcgtccttgaatgaaaagctggattccttgcaatgtgcaaggcactctgactgtcacaatacacagta 106  Q
    ||||| || ||| |||||||||||||||||||| || || ||||||||  |||||||||||||||||||||| ||||||||||||||||||||||||  |    
24594537 tcgaacaaaatggtattgaacacctatgtgttttgttctcgaatgaaagactggattccttgcaatgtgcaatgcactctgactgtcacaatacacaaca 24594636  T
107 atttgttcttgcttgtgcccgagttcctccattaacctttgcatccaaatagcttccttgcatgcttgagtagctgccatgtactccgcttctgtcgttg 206  Q
    ||||||| |||  |||| |||||||| |||||||  ||||| |||||||||||||||||||| ||||| ||||||||||| || || |||||||| || |    
24594637 atttgttgttgactgtggccgagttcttccattagtctttgtatccaaatagcttccttgcaagcttgtgtagctgccatatattcagcttctgtagtag 24594736  T
207 acagagctacaaccgtttgtaacttggacaaccaacttactgctcctcctgcaagcgtgaacacataaccagtagtagattttcttttatcatgatcacc 306  Q
    | |||||||| || | |||||| || ||||| |||||||  |||||||||||||| |||||||||||||||||||||||| ||||||||||| |||||||    
24594737 atagagctacgacagattgtaattttgacaatcaacttatcgctcctcctgcaagtgtgaacacataaccagtagtagatcttcttttatcaagatcacc 24594836  T
307 tgcaaaatctgaatcaacataaccccagacagttaactctgatcctccgaaacataccgcaacacctgaggttcctttaatgtacctcatgattctctta 406  Q
    ||||||||||||||||||||||||   |||| | || ||  |||||| ||||||||  |||||| || |||||||||| || || |||| ||||||||||    
24594837 tgcaaaatctgaatcaacataacctttgacaataaattccaatcctctgaaacataatgcaacatctaaggttccttttatatatctcaggattctctta 24594936  T
407 acagcattccaatgctctttacccggatccgccataaaccgactaaccactcccactgcttgtgcaatgtctggtcttgtacatatc 493  Q
    ||| ||| |||||| | |||||| |||||||||||||| ||||||||| ||||||||||||||||||||||||| |||||| |||||    
24594937 acaacatcccaatgttttttaccaggatccgccataaatcgactaaccgctcccactgcttgtgcaatgtctggccttgtaaatatc 24595023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 458; Significance: 0; HSPs: 6)
Name: chr6

Target: chr6; HSP #1
Raw Score: 458; E-Value: 0
Query Start/End: Original strand, 16 - 493
Target Start/End: Original strand, 27874764 - 27875241
16 atgatattgaacacctatgtgtttcgtccttgaatgaaaagctggattccttgcaatgtgcaaggcactctgactgtcacaatacacagtaatttgttct 115  Q
    |||||||||||  |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||     
27874764 atgatattgaatgcctatgtgtttcgtccttgaatgaaaagctggattccttgcaatatgcaaggcactctgactgtcacaatacacagtaatttgttcc 27874863  T
116 tgcttgtgcccgagttcctccattaacctttgcatccaaatagcttccttgcatgcttgagtagctgccatgtactccgcttctgtcgttgacagagcta 215  Q
27874864 tgcttgtgcccgagttcctccattaacctttgcatccaaatagcttccttgcatgcttgagtagctgccatgtactccgcttctgtcgttgacagagcta 27874963  T
216 caaccgtttgtaacttggacaaccaacttactgctcctcctgcaagcgtgaacacataaccagtagtagattttcttttatcatgatcacctgcaaaatc 315  Q
27874964 caaccgtttgtaacttggacaaccaacttactgctcctcctgcaagcgtgaacacataaccagtagtagattttcttttatcatgatcacctgcaaaatc 27875063  T
316 tgaatcaacataaccccagacagttaactctgatcctccgaaacataccgcaacacctgaggttcctttaatgtacctcatgattctcttaacagcattc 415  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27875064 tgaatcaacataacccctgacagttaactctgatcctccgaaacataccgcaacacctgaggttcctttaatgtacctcatgattctcttaacagcattc 27875163  T
416 caatgctctttacccggatccgccataaaccgactaaccactcccactgcttgtgcaatgtctggtcttgtacatatc 493  Q
27875164 caatgctctttacccggatccgccataaaccgactaaccactcccactgcttgtgcaatgtctggtcttgtacatatc 27875241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 439; E-Value: 0
Query Start/End: Original strand, 7 - 493
Target Start/End: Original strand, 26976939 - 26977425
7 tcgaagaatatgatattgaacacctatgtgtttcgtccttgaatgaaaagctggattccttgcaatgtgcaaggcactctgactgtcacaatacacagta 106  Q
    ||||| || ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26976939 tcgaacaaaatgatattgaacacctatgtgcttcgtccttgaatgaaaagctggattccttgcaatgtgcaaggcactctgactgtcacaatacacagta 26977038  T
107 atttgttcttgcttgtgcccgagttcctccattaacctttgcatccaaatagcttccttgcatgcttgagtagctgccatgtactccgcttctgtcgttg 206  Q
    ||||  || |||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||| ||||||||||||||||| |||||||||||||    
26977039 attttctcctgcttgtgcccgagttcctccattaacctttgcacccagatagcttccttgcatgcttgggtagctgccatgtactcagcttctgtcgttg 26977138  T
207 acagagctacaaccgtttgtaacttggacaaccaacttactgctcctcctgcaagcgtgaacacataaccagtagtagattttcttttatcatgatcacc 306  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26977139 acagagctacaacagtttgtaacttggacaaccaacttactgctcctcctgcaagcgtgaacacataaccagtagtagattttcttttatcatgatcacc 26977238  T
307 tgcaaaatctgaatcaacataaccccagacagttaactctgatcctccgaaacataccgcaacacctgaggttcctttaatgtacctcatgattctctta 406  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26977239 tgcaaaatctgaatcaacataacccctgacagttaactctgatcctccgaaacataccgcaacacctgaggttcctttaatgtacctcatgattctctta 26977338  T
407 acagcattccaatgctctttacccggatccgccataaaccgactaaccactcccactgcttgtgcaatgtctggtcttgtacatatc 493  Q
26977339 acagcattccaatgctctttacccggatccgccataaaccgactaaccactcccactgcttgtgcaatgtctggtcttgtacatatc 26977425  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 7 - 493
Target Start/End: Original strand, 1472511 - 1472996
7 tcgaagaatatgatattgaacacctatgtgtttcgtccttgaatgaaaagctggattccttgcaatgtgcaaggcactctgactgtcacaatacacagta 106  Q
    ||||| || ||| ||||||||| |||||||||| || || ||||||||  ||||||| | |||||||||||| ||||||||||||||||||||||||  |    
1472511 tcgaacaaaatggtattgaacatctatgtgttttgttctcgaatgaaagactggattacatgcaatgtgcaatgcactctgactgtcacaatacacaaca 1472610  T
107 atttgttcttgcttgtgcccgagttcctccattaacctttgcatccaaatagcttccttgcatgcttgagtagctgccatgtactccgcttctgtcgttg 206  Q
    ||||||| |||  ||||| ||||||| |||||||  ||||| |||||||||||||||||||| ||||| ||||||||||| || || |||||||| || |    
1472611 atttgttgttgactgtgcacgagttcttccattagtctttgtatccaaatagcttccttgcaagcttgcgtagctgccatatattcagcttctgtagtag 1472710  T
207 acagagctacaaccgtttgtaacttggacaaccaacttactgctcctcctgcaagcgtgaacacataaccagtagtagattttcttttatcatgatcacc 306  Q
    | |||||||| | |  |||||| || ||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||| |||||||    
1472711 agagagctacga-caattgtaattttgacaaccaacttactgctcctcctgcaagtgtgaacacataaccagtagtagatcttcttttatcaagatcacc 1472809  T
307 tgcaaaatctgaatcaacataaccccagacagttaactctgatcctccgaaacataccgcaacacctgaggttcctttaatgtacctcatgattctctta 406  Q
    ||||||||||||||||||||||||   |||  | || ||  |||||| ||||||||  |||||| || |||||||||| || || |||| ||||||||||    
1472810 tgcaaaatctgaatcaacataacctttgacgataaattccaatcctctgaaacataatgcaacatctaaggttccttttatatatctcaggattctctta 1472909  T
407 acagcattccaatgctctttacccggatccgccataaaccgactaaccactcccactgcttgtgcaatgtctggtcttgtacatatc 493  Q
    ||||||| ||||||||||||||| |||||||||||||| ||||||||| ||||||||||||||||||||||||  ||||||||||||    
1472910 acagcatcccaatgctctttaccaggatccgccataaatcgactaaccgctcccactgcttgtgcaatgtctgaccttgtacatatc 1472996  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 166; E-Value: 1e-88
Query Start/End: Original strand, 19 - 493
Target Start/End: Complemental strand, 21965640 - 21965178
19 atattgaacacctatgtgtttcgtccttgaatgaaaagctggattccttgcaatgtgcaaggcactctgactgtcacaatacacagtaatttgttcttgc 118  Q
    ||||||||| ||| |||| | ||| ||||||||||||| ||||||||||| ||||||||||| |||||||||||||  ||||||| ||||| |||  |||    
21965640 atattgaacgcctgtgtgctccgttcttgaatgaaaagttggattccttgaaatgtgcaaggtactctgactgtca--atacacaataattcgttgctgc 21965543  T
119 ttgtgcccgagttcctccattaacctttgcatccaaatagcttccttgcatgcttgagtagctgccatgtactccgcttctgtcgttgacagagctacaa 218  Q
    || ||||  |||| ||| ||||||||| |||||||||||| |||| ||||||||   ||||||| | |||||   |||| || |||||||||||||||||    
21965542 ttatgcctaagttgctcaattaaccttcgcatccaaatagtttccatgcatgctaaggtagctgtcttgtacgaagcttttgacgttgacagagctacaa 21965443  T
219 ccgtttgtaacttggacaaccaacttactgctcctcctgcaagcgtgaacacataaccagtagtagattttcttttatcatgatcacctgcaaaatctga 318  Q
      |||||||||||||  |||||||||||||||| || || ||||||||||||||| ||| |||| |||||||| ||||||||||||  ||||||||  ||    
21965442 tagtttgtaacttgggtaaccaacttactgctcatcttggaagcgtgaacacatatccaatagttgattttctattatcatgatcaagtgcaaaattcga 21965343  T
319 atcaacataaccccagacagttaactctgatcctccgaaacataccgcaacacctgaggttcctttaatgtacctcatgattctcttaacagcattccaa 418  Q
    ||||| |||||||| || |||||||| | ||||||||||| |||  |||       |||||||||||||||||||| || |||| ||| || |||||  |    
21965342 atcaatataacccctgatagttaactttaatcctccgaaa-atattgca-------aggttcctttaatgtacctcttg-ttcttttaccaacattctga 21965252  T
419 tgctctttacccggatccgccataaaccgactaaccactcccactgcttgtgcaatgtctggtcttgtacatatc 493  Q
    ||||||||| ||| ||| ||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||    
21965251 tgctcttta-ccgaatctgccataaaccgactaactactcccactgcttgtgcaatgtctggtcttttacatatc 21965178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 87; E-Value: 2e-41
Query Start/End: Original strand, 139 - 261
Target Start/End: Complemental strand, 18967241 - 18967120
139 taacctttgcatccaaatagcttccttgcatgcttgagtagctgccatgtactccgcttctgtcgttgacagagctacaaccgtttgtaacttggacaac 238  Q
    |||| ||||||||||||||||||| ||||||||||| |||||||| |||||||| |||||||||||||||||||||||||| | |||||||||||| |||    
18967241 taacgtttgcatccaaatagcttcattgcatgcttgggtagctgcaatgtactcagcttctgtcgttgacagagctacaacag-ttgtaacttggataac 18967143  T
239 caacttactgctcctcctgcaag 261  Q
18967142 caacttactgctcctcctgcaag 18967120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 5 - 90
Target Start/End: Complemental strand, 18967341 - 18967256
5 tgtcgaagaatatgatattgaacacctatgtgtttcgtccttgaatgaaaagctggattccttgcaatgtgcaaggcactctgact 90  Q
    ||||||| || |||||||| ||| |||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||    
18967341 tgtcgaacaaaatgatatttaacgcctatgtgtttcgtccttgaatgaaaagttggattccttgcaatgtgtaaggcactctgact 18967256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 439; Significance: 0; HSPs: 7)
Name: chr3

Target: chr3; HSP #1
Raw Score: 439; E-Value: 0
Query Start/End: Original strand, 7 - 493
Target Start/End: Original strand, 5819321 - 5819807
7 tcgaagaatatgatattgaacacctatgtgtttcgtccttgaatgaaaagctggattccttgcaatgtgcaaggcactctgactgtcacaatacacagta 106  Q
    ||||| || |||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5819321 tcgaacaaaatgatattgaacgcctatgtgcttcgtccttgaatgaaaagctggattccttgcaatgtgcaaggcactctgactgtcacaatacacagta 5819420  T
107 atttgttcttgcttgtgcccgagttcctccattaacctttgcatccaaatagcttccttgcatgcttgagtagctgccatgtactccgcttctgtcgttg 206  Q
    ||||  || |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||| |||||||||||||    
5819421 attttctcctgcttgtgcccgagttcctccattaacctttgcatccagatagcttccttgcatgcttgggtagctgccatgtactcagcttctgtcgttg 5819520  T
207 acagagctacaaccgtttgtaacttggacaaccaacttactgctcctcctgcaagcgtgaacacataaccagtagtagattttcttttatcatgatcacc 306  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5819521 acagagctacaacagtttgtaacttggacaaccaacttactgctcctcctgcaagcgtgaacacataaccagtagtagattttcttttatcatgatcacc 5819620  T
307 tgcaaaatctgaatcaacataaccccagacagttaactctgatcctccgaaacataccgcaacacctgaggttcctttaatgtacctcatgattctctta 406  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5819621 tgcaaaatctgaatcaacataacccctgacagttaactctgatcctccgaaacataccgcaacacctgaggttcctttaatgtacctcatgattctctta 5819720  T
407 acagcattccaatgctctttacccggatccgccataaaccgactaaccactcccactgcttgtgcaatgtctggtcttgtacatatc 493  Q
5819721 acagcattccaatgctctttacccggatccgccataaaccgactaaccactcccactgcttgtgcaatgtctggtcttgtacatatc 5819807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 427; E-Value: 0
Query Start/End: Original strand, 7 - 493
Target Start/End: Complemental strand, 54545416 - 54544930
7 tcgaagaatatgatattgaacacctatgtgtttcgtccttgaatgaaaagctggattccttgcaatgtgcaaggcactctgactgtcacaatacacagta 106  Q
    ||||| || |||||||||||| |||||||||||||||||||||||||||| || |||||||||||||||||| |||||||||||||||||||||||| ||    
54545416 tcgaataaaatgatattgaacgcctatgtgtttcgtccttgaatgaaaagttgaattccttgcaatgtgcaatgcactctgactgtcacaatacacaata 54545317  T
107 atttgttcttgcttgtgcccgagttcctccattaacctttgcatccaaatagcttccttgcatgcttgagtagctgccatgtactccgcttctgtcgttg 206  Q
    |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||    
54545316 atttgttcctgcttgtgcccgagttcctccattaacctttgcatccaaatagcttccttgcatgcttgggtagctgccatgtactcagcttctgtcgttg 54545217  T
207 acagagctacaaccgtttgtaacttggacaaccaacttactgctcctcctgcaagcgtgaacacataaccagtagtagattttcttttatcatgatcacc 306  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||    
54545216 acagagctacaacagtttgtaacttggacaaccaacttactgctcctccggcaagtgtgaacacataaccagtagtagattttcttttatcatgatcacc 54545117  T
307 tgcaaaatctgaatcaacataaccccagacagttaactctgatcctccgaaacataccgcaacacctgaggttcctttaatgtacctcatgattctctta 406  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54545116 tgcaaaatctgaatcaacataacccctgacagttaactctgatcctccgaaacataccgcaacacctgaggttcctttaatgtacctcatgattctctta 54545017  T
407 acagcattccaatgctctttacccggatccgccataaaccgactaaccactcccactgcttgtgcaatgtctggtcttgtacatatc 493  Q
    ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54545016 acaacattccaatgctctttacccggatccgccataaaccgactaaccactcccactgcttgtgcaatgtctggtcttgtacatatc 54544930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 243; E-Value: 1e-134
Query Start/End: Original strand, 7 - 493
Target Start/End: Complemental strand, 42589219 - 42588733
7 tcgaagaatatgatattgaacacctatgtgtttcgtccttgaatgaaaagctggattccttgcaatgtgcaaggcactctgactgtcacaatacacagta 106  Q
    ||||| || ||| |||||||||||||||||||| || || ||||||||  |||||||||||||||||||||| ||||| ||||||||||||||||||  |    
42589219 tcgaacaaaatggtattgaacacctatgtgttttgttctcgaatgaaagactggattccttgcaatgtgcaatgcactatgactgtcacaatacacaaca 42589120  T
107 atttgttcttgcttgtgcccgagttcctccattaacctttgcatccaaatagcttccttgcatgcttgagtagctgccatgtactccgcttctgtcgttg 206  Q
    ||||||| |||  ||||||||||||| |||||||  ||||| |||||||||||||||||||| ||||| ||||||||||| || || |||||||| || |    
42589119 atttgttgttgactgtgcccgagttcttccattagtctttgtatccaaatagcttccttgcaagcttgcgtagctgccatatattcagcttctgtagtag 42589020  T
207 acagagctacaaccgtttgtaacttggacaaccaacttactgctcctcctgcaagcgtgaacacataaccagtagtagattttcttttatcatgatcacc 306  Q
    | |||||||| || | |||||| || |||||||||||||| |||||||||||||| |||||||||||||||| ||||||| ||||||||||| |||||||    
42589019 atagagctacgacagattgtaattttgacaaccaacttaccgctcctcctgcaagtgtgaacacataaccagcagtagatcttcttttatcaagatcacc 42588920  T
307 tgcaaaatctgaatcaacataaccccagacagttaactctgatcctccgaaacataccgcaacacctgaggttcctttaatgtacctcatgattctctta 406  Q
    ||||||||||||||||||||||||   |||| | || ||  |||||| || |||||  |||||| || |||||||||| || || |||| ||||||||||    
42588919 tgcaaaatctgaatcaacataacctttgacaataaattccaatcctctgacacataatgcaacatctaaggttccttttatatatctcaggattctctta 42588820  T
407 acagcattccaatgctctttacccggatccgccataaaccgactaaccactcccactgcttgtgcaatgtctggtcttgtacatatc 493  Q
    ||||||| |||||| |||||||| |||||||||||||| ||||||||| ||||||||||||||||||||||||| ||||||||||||    
42588819 acagcatcccaatgttctttaccaggatccgccataaatcgactaaccgctcccactgcttgtgcaatgtctggccttgtacatatc 42588733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 93 - 493
Target Start/End: Complemental strand, 25881030 - 25880628
93 cacaatacacagtaatttgttcttgcttgtgcccgagttcctccattaacctttgcatccaaatagcttccttgcatgcttgagtagctgccatgtactc 192  Q
    |||||||||||  |||||||| ||| ||||||| || ||| ||||||| |||||| |||||||||||||||| ||| ||||| |||| | | || || ||    
25881030 cacaatacacaacaatttgttgttgattgtgcctga-ttcttccattagcctttgtatccaaatagcttcctagcaagcttgcgtaggtacaatatattc 25880932  T
193 cgcttctgtcgttgacagagctacaaccgtttgtaacttggacaaccaacttactgctcctcctgcaagcgtgaacacataaccagtagtaga---tttt 289  Q
     || | ||| || || ||||| |||||  ||||||| || ||||||||||||| |||||||||||||||  ||||||||||||| ||||||||   ||||    
25880931 agcatatgtagtagatagagcgacaacaatttgtaattttgacaaccaacttattgctcctcctgcaagtatgaacacataaccggtagtagattttttt 25880832  T
290 cttttatcatgatcacctgcaaaatctgaatcaacataaccccagacagttaactctgatcctccgaaacataccgcaacacctgaggttcc---tttaa 386  Q
     |||||||| |||| ||||||||||||||||| |||||||||   ||| | || ||  |   || ||||||||  |||||| |||||||| |   ||| |    
25880831 tttttatcaagatctcctgcaaaatctgaatctacataaccctttacaataaattccaa---tctgaaacataatgcaacatctgaggtttcctttttta 25880735  T
387 tgtacctcatgattctcttaacagcattccaatgctctttacccggatccgccataaaccgactaaccactcccactgcttgtgcaatgtctggtcttgt 486  Q
    | || |||| |||||| |||| | |||  |||||||||||||| |||||||||||||| |||||||   |||||||||||||||||||||||||||||||    
25880734 tatatctcacgattcttttaataacatctcaatgctctttaccaggatccgccataaatcgactaattgctcccactgcttgtgcaatgtctggtcttgt 25880635  T
487 acatatc 493  Q
25880634 acatatc 25880628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 366 - 493
Target Start/End: Complemental strand, 25880567 - 25880440
366 caacacctgaggttcctttaatgtacctcatgattctcttaacagcattccaatgctctttacccggatccgccataaaccgactaaccactcccactgc 465  Q
    ||||| ||||||||||||| || || |||| |||||| || | | ||| ||||||||||||||| |||||||||||||| |||||||  ||| |||||||    
25880567 caacatctgaggttccttttatatatctcaggattcttttgataccatcccaatgctctttaccaggatccgccataaatcgactaattacttccactgc 25880468  T
466 ttgtgcaatgtctggtcttgtacatatc 493  Q
25880467 ttgtgcaatgtctggtcttgtacatatc 25880440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 222 - 331
Target Start/End: Complemental strand, 25880348 - 25880239
222 tttgtaacttggacaaccaacttactgctcctcctgcaagcgtgaacacataaccagtagtagattttcttttatcatgatcacctgcaaaatctgaatc 321  Q
    ||||||| || ||||||||||||| |||||||| |||||| |||||||||||||| ||| ||||| ||||||||||| ||||||||  |||||||||||     
25880348 tttgtaattttgacaaccaacttattgctcctcttgcaagtgtgaacacataaccggtattagatattcttttatcacgatcacctataaaatctgaatt 25880249  T
322 aacataaccc 331  Q
    |||| |||||    
25880248 aacaaaaccc 25880239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 416 - 493
Target Start/End: Complemental strand, 25878161 - 25878084
416 caatgctctttacccggatccgccataaaccgactaaccactcccactgcttgtgcaatgtctggtcttgtacatatc 493  Q
    |||||||||||||| |||||||||||||| |||||||    || ||||||||||||||||||| ||||||||||||||    
25878161 caatgctctttaccaggatccgccataaatcgactaattgttctcactgcttgtgcaatgtctagtcttgtacatatc 25878084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 427; Significance: 0; HSPs: 3)
Name: chr2

Target: chr2; HSP #1
Raw Score: 427; E-Value: 0
Query Start/End: Original strand, 7 - 493
Target Start/End: Complemental strand, 829750 - 829264
7 tcgaagaatatgatattgaacacctatgtgtttcgtccttgaatgaaaagctggattccttgcaatgtgcaaggcactctgactgtcacaatacacagta 106  Q
    ||||| || |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
829750 tcgaacaaaatgatattgaacgcctatgtgtttcgtccttgaatgaaaagctggattccttgcaatgtgcaaggcactctgactgtcacaatacacagta 829651  T
107 atttgttcttgcttgtgcccgagttcctccattaacctttgcatccaaatagcttccttgcatgcttgagtagctgccatgtactccgcttctgtcgttg 206  Q
    ||||  || |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||| |||||||||||||    
829650 attttctcctgcttgtgcccgagttcctccattaacctttgcatccagatagcttccttgcatgcttgggtagctgccatgtactcagcttctgtcgttg 829551  T
207 acagagctacaaccgtttgtaacttggacaaccaacttactgctcctcctgcaagcgtgaacacataaccagtagtagattttcttttatcatgatcacc 306  Q
    ||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
829550 acagagctacaacagtttgtaacttggataaccaacttactgctcctcctgcaagcgtgaacacataaccagtagtagattttcttttatcctgatcacc 829451  T
307 tgcaaaatctgaatcaacataaccccagacagttaactctgatcctccgaaacataccgcaacacctgaggttcctttaatgtacctcatgattctctta 406  Q
    |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
829450 tgcaaaatctgaatcaacataacccctgacagttaactctgatcctccgaaacataccgcaacacctggggttcctttaatgtacctcatgattctctta 829351  T
407 acagcattccaatgctctttacccggatccgccataaaccgactaaccactcccactgcttgtgcaatgtctggtcttgtacatatc 493  Q
    ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
829350 acaacattccaatgctctttacccggatccgccataaaccgactaaccactcccactgcttgtgcaatgtctggtcttgtacatatc 829264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 7 - 493
Target Start/End: Complemental strand, 28715344 - 28714868
7 tcgaagaatatgatattgaacacctatgtgtttcgtccttgaatgaaaagctggattccttgcaatgtgcaaggcactctgactgtcacaatacacagta 106  Q
    ||||| || ||||||||||||||||||||| ||| |||||||| |||||| ||||||          ||||||||||| | ||| |||||||||||||||    
28715344 tcgaacaaaatgatattgaacacctatgtgcttcatccttgaacgaaaagttggatt----------tgcaaggcactataactatcacaatacacagta 28715255  T
107 atttgttcttgcttgtgcccgagttcctccattaacctttgcatccaaatagcttccttgcatgcttgagtagctgccatgtactccgcttctgtcgttg 206  Q
    ||||| || ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| |||||    
28715254 atttgctcctgcttgtgcccgagtacctccattaacctttgcatccaaatagcttccttgcatgcttgggtagctgccatgtactcagcttctgacgttg 28715155  T
207 acagagctacaaccgtttgtaacttggacaaccaacttactgctcctcctgcaagcgtgaacacataaccagtagtagattttcttttatcatgatcacc 306  Q
    ||| ||||||||| |||||||||||||| |||||||||||||||||||  |||||| ||||||| |||||||||  ||||||||||| ||||||||||||    
28715154 acatagctacaacagtttgtaacttggataaccaacttactgctcctctcgcaagcatgaacacgtaaccagtaaaagattttctttcatcatgatcacc 28715055  T
307 tgcaaaatctgaatcaacataaccccagacagttaactctgatcctccgaaacataccgcaacacctgaggttcctttaatgtacctcatgattctctta 406  Q
     ||||||||||||||||||||||||  |||| ||||||||||||||||||||||||  ||||||| ||||||||||||||||||||||||||||||||||    
28715054 ggcaaaatctgaatcaacataacccatgacaattaactctgatcctccgaaacatattgcaacacatgaggttcctttaatgtacctcatgattctctta 28714955  T
407 acagcattccaatgctctttacccggatccgccataaaccgactaaccactcccactgcttgtgcaatgtctggtcttgtacatatc 493  Q
    ||| |||||||||||||||||   ||||| | |||||||||||||||||||||||||  ||||||||| |||| |||||||||||||    
28714954 acaacattccaatgctctttataaggatctgtcataaaccgactaaccactcccactaattgtgcaatctctgatcttgtacatatc 28714868  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 164; E-Value: 2e-87
Query Start/End: Original strand, 16 - 493
Target Start/End: Original strand, 13840984 - 13841450
16 atgatattgaacacctatgtgtttcgtccttgaatgaaaagctggattccttgcaatgtgcaaggcactctgactgtcacaatacacagtaatttgttct 115  Q
    |||||||||||||| ||||||||| |||||||||||||||  || ||| ||||||||||| |||||| ||| | |||||||||||| ||||||||| | |    
13840984 atgatattgaacacttatgtgttttgtccttgaatgaaaaa-tgaatttcttgcaatgtgaaaggcattctaattgtcacaatacatagtaatttgatgt 13841082  T
116 tgcttgtgcccgagttcctccattaacctttgcatccaaatagcttccttgcatgcttgagtagctgccatgtactccgcttctgtcgttgacagagcta 215  Q
    || |||||||| ||||||||||||||||||||||| |||||| |||||||||| || || | || |||||||||||| | || ||||||||||| |||||    
13841083 tgtttgtgcccaagttcctccattaacctttgcattcaaataacttccttgcaagcatgggaagatgccatgtactcag-ttttgtcgttgacaaagcta 13841181  T
216 caaccgtttgtaacttggacaaccaacttactgctcctcctgcaagcgtgaacacataaccagtagtagattttcttttatcatgatcacctgcaaaatc 315  Q
    ||     || ||||||||| ||||||||||| ||||||| |  || ||||||||||||| |   |||||||||| | ||||||||||||| || ||||||    
13841182 ca-----ttctaacttggataaccaacttaccgctcctcgtataaacgtgaacacataatc---agtagattttatattatcatgatcacttgtaaaatc 13841273  T
316 tgaatcaacataaccccagacagttaactctgatcctccgaaacataccgcaacacctgaggttcctttaatgtacctcatgattctcttaacagcattc 415  Q
    ||||||||||||||||  | || ||||||||||||||||||||||||  ||||||| ||||||| |||| || || ||||  ||||  ||||||  |||     
13841274 tgaatcaacataacccttgtcatttaactctgatcctccgaaacatattgcaacacttgaggtttctttgatatatctcaaaattcatttaaca-aattt 13841372  T
416 caatgctctttacccggatccgccataaaccgactaaccactcccactgcttgtgcaatgtctggtcttgtacatatc 493  Q
     || | | |||||| ||||  |||||||||||||||||||||||||||  ||||| | ||||||||||||||||||||    
13841373 aaaggatatttaccaggatatgccataaaccgactaaccactcccactatttgtgtagtgtctggtcttgtacatatc 13841450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0074 (Bit Score: 403; Significance: 0; HSPs: 1)
Name: scaffold0074

Target: scaffold0074; HSP #1
Raw Score: 403; E-Value: 0
Query Start/End: Original strand, 7 - 493
Target Start/End: Original strand, 28081 - 28567
7 tcgaagaatatgatattgaacacctatgtgtttcgtccttgaatgaaaagctggattccttgcaatgtgcaaggcactctgactgtcacaatacacagta 106  Q
    ||||| || |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28081 tcgaacaaaatgatattgaacgcctatgtgtttcgtccttgaatgaaaagctggattccttgcaatgtgcaaggcactctgactgtcacaatacacagta 28180  T
107 atttgttcttgcttgtgcccgagttcctccattaacctttgcatccaaatagcttccttgcatgcttgagtagctgccatgtactccgcttctgtcgttg 206  Q
    ||||  || ||||||||| ||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28181 atttaatcctgcttgtgcacgagttcctccataaacctttgcaaccaaatagcttccttgcatgcttgagtagctgccatgtactccgcttctgtcgttg 28280  T
207 acagagctacaaccgtttgtaacttggacaaccaacttactgctcctcctgcaagcgtgaacacataaccagtagtagattttcttttatcatgatcacc 306  Q
    ||||||||||||| |||||||||||||| |||||||||||||||||||||| ||| |||||||||||| |||||||||||||||||||||||||||||||    
28281 acagagctacaacagtttgtaacttggataaccaacttactgctcctcctgaaagtgtgaacacataatcagtagtagattttcttttatcatgatcacc 28380  T
307 tgcaaaatctgaatcaacataaccccagacagttaactctgatcctccgaaacataccgcaacacctgaggttcctttaatgtacctcatgattctctta 406  Q
    | |||||||||||||||||||||||| |||||||||||||||||||| ||||||||  |||||| | |||||||||||||||||||||||||||||||||    
28381 tacaaaatctgaatcaacataacccctgacagttaactctgatcctctgaaacatattgcaacatccgaggttcctttaatgtacctcatgattctctta 28480  T
407 acagcattccaatgctctttacccggatccgccataaaccgactaaccactcccactgcttgtgcaatgtctggtcttgtacatatc 493  Q
28481 acagcattccaatgctctttacccggatccgccataaaccgactaaccactcccactgcttgtgcaatgtctggtcttgtacatatc 28567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 248; Significance: 1e-137; HSPs: 4)
Name: chr7

Target: chr7; HSP #1
Raw Score: 248; E-Value: 1e-137
Query Start/End: Original strand, 45 - 455
Target Start/End: Original strand, 2324197 - 2324601
45 ttgaatgaaaagctggattccttgcaatgtgcaaggcactctgactgtcacaatacacagtaatttgttcttgcttgtgcccgagttcctccattaacct 144  Q
    |||||||||||| ||||||||||||||||| ||       ||||||| ||||||||| ||| ||||  || |||||||||||||||||||||||||||||    
2324197 ttgaatgaaaagatggattccttgcaatgtccac------ctgactgccacaatacaaagtgattttctcctgcttgtgcccgagttcctccattaacct 2324290  T
145 ttgcatccaaatagcttccttgcatgcttgagtagctgccatgtactccgcttctgtcgttgacagagctacaaccgtttgtaacttggacaaccaactt 244  Q
    |||||||||||||||||||||||||||||| ||||||||||||||||  |||||||||||||||| ||||||||| |||||||||||||| ||| |||||    
2324291 ttgcatccaaatagcttccttgcatgcttgggtagctgccatgtacttagcttctgtcgttgacaaagctacaacagtttgtaacttggataactaactt 2324390  T
245 actgctcctcctgcaagcgtgaacacataaccagtagtagattttcttttatcatgatcacctgcaaaatctgaatcaacataaccccagacagttaact 344  Q
    ||  ||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||| | | ||||  || |||||||    
2324391 acaactcctcctgcaagtgtgaacacataactagtagtagattttcttttatcatgatcacctgcaaaatctgactcaagaaatcccccaacggttaact 2324490  T
345 ctgatcctccgaaacataccgcaacacctgaggttcctttaatgtacctcatgattctcttaacagcattccaatgctctttacccggatccgccataaa 444  Q
    ||||||||||||||||||  |||||||||||||||||||| || ||| |||||||||||||||||||||||||||||||||||||  |||||||||||||    
2324491 ctgatcctccgaaacatattgcaacacctgaggttccttttatatacatcatgattctcttaacagcattccaatgctctttaccaagatccgccataaa 2324590  T
445 ccgactaacca 455  Q
    ||||| |||||    
2324591 ccgaccaacca 2324601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 178; E-Value: 8e-96
Query Start/End: Original strand, 7 - 408
Target Start/End: Original strand, 7504809 - 7505210
7 tcgaagaatatgatattgaacacctatgtgtttcgtccttgaatgaaaagctggattccttgcaatgtgcaaggcactctgactgtcacaatacacagta 106  Q
    ||||| || ||| ||||||||| |||||||||| || || ||||||||  |||||||||||||||||||||| ||||||||||||||||||||||||  |    
7504809 tcgaacaaaatggtattgaacatctatgtgttttgttctcgaatgaaagactggattccttgcaatgtgcaatgcactctgactgtcacaatacacaaca 7504908  T
107 atttgttcttgcttgtgcccgagttcctccattaacctttgcatccaaatagcttccttgcatgcttgagtagctgccatgtactccgcttctgtcgttg 206  Q
    ||||||| |||  ||||| ||||||| |||||||  ||||| |||||||||||||||||||| ||||| ||||||||||| || || |||||||| || |    
7504909 atttgttgttgactgtgcacgagttcttccattagtctttgtatccaaatagcttccttgcaagcttgcgtagctgccatatattcagcttctgtagtag 7505008  T
207 acagagctacaaccgtttgtaacttggacaaccaacttactgctcctcctgcaagcgtgaacacataaccagtagtagattttcttttatcatgatcacc 306  Q
    | |||||||| ||   |||||| || ||||| |||||||| |||||||||||||| |||||||||||||||||||||||| ||||||||||| |||||||    
7505009 atagagctacgacaaattgtaattttgacaatcaacttaccgctcctcctgcaagtgtgaacacataaccagtagtagatcttcttttatcaagatcacc 7505108  T
307 tgcaaaatctgaatcaacataaccccagacagttaactctgatcctccgaaacataccgcaacacctgaggttcctttaatgtacctcatgattctctta 406  Q
    ||||||||||||||||||||||||   |||| | || ||  |||||| ||||||||  |||||| || |||||||||| || || |||| ||||||||||    
7505109 tgcaaaatctgaatcaacataacctttgacaataaattccaatcctctgaaacataatgcaacatctaaggttccttttatatatctcaggattctctta 7505208  T
407 ac 408  Q
7505209 ac 7505210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 20 - 362
Target Start/End: Complemental strand, 22510175 - 22509836
20 tattgaacacctatgtgtttcgtccttgaatgaaaagctggattccttgcaatgtgcaaggcactctgactgtcacaatacacagtaatttgttcttgct 119  Q
    |||||||| ||| ||||  ||||| | ||||  |||| |||||| |||| |||||||||| |||||||||| |||||||||| |||||||||||  | ||    
22510175 tattgaacgcctttgtgcatcgtcttggaatacaaagttggattgcttgaaatgtgcaagacactctgactatcacaatacaaagtaatttgttgatact 22510076  T
120 tgtgcccgagttcctccattaacctttgcatccaaatagcttccttgcatgcttgagta-gctgccatgtactccgcttctgtcgttgacagagctacaa 218  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||  | | ||||  || ||||||| ||   |||| | |||||||||||| |||    
22510075 tgtgcgcgagttcctccattaaccttatcatccaaatagcttccttgcaaacct-agtatacttccatgtattcaatttctcttgttgacagagcttcaa 22509977  T
219 ccgtttgtaacttggacaaccaacttactgctcctcctgcaagcgtgaacacataaccagtagtagattttctttt--atcatgatcacctgcaaaatct 316  Q
    |  || ||||||||||||||||| |||||||||||| | |||  |||||     ||||| ||||| || || ||||  ||||||||||||| ||||||||    
22509976 caattggtaacttggacaaccaaattactgctcctcttacaaatgtgaa-----aaccaatagtatatatttttttcaatcatgatcaccttcaaaatct 22509882  T
317 gaatcaacataaccccagacagttaactctgatcctccgaaacata 362  Q
    ||||||||||||| ||  |  ||||||| |||||||||||||||||    
22509881 gaatcaacataacacctaatggttaactttgatcctccgaaacata 22509836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 61; E-Value: 6e-26
Query Start/End: Original strand, 401 - 493
Target Start/End: Original strand, 7506016 - 7506108
401 ctcttaacagcattccaatgctctttacccggatccgccataaaccgactaaccactcccactgcttgtgcaatgtctggtcttgtacatatc 493  Q
    ||||||||| ||| ||||||||||||||| ||||||||||||||  ||||| || ||||||||||||||||||||||||| ||||||||||||    
7506016 ctcttaacaacatcccaatgctctttaccaggatccgccataaattgactagccgctcccactgcttgtgcaatgtctggccttgtacatatc 7506108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 95; Significance: 3e-46; HSPs: 3)
Name: chr1

Target: chr1; HSP #1
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 282 - 492
Target Start/End: Complemental strand, 34973530 - 34973320
282 tagattttcttttatcatgatcacctgcaaaatctgaatcaacataaccccagacagttaactctgatcctccgaaacataccgcaacacctgaggttcc 381  Q
    ||||||||||||||| ||||||| |||||||||||||||| ||||||||||  |||||||| | |||||||||||| ||||  |||||||||||||||||    
34973530 tagattttcttttattatgatcatctgcaaaatctgaatcgacataacccctaacagttaaatttgatcctccgaatcatattgcaacacctgaggttcc 34973431  T
382 tttaatgtacctcatgattctcttaacagcattccaatgctctttacccggatccgccataaaccgactaaccactcccactgcttgtgcaatgtctggt 481  Q
    |||| |||||||||| ||||| |  ||| ||||   |||||||||||  |||||| ||| |||| |||||||||||| | ||| |||| |||||||| ||    
34973430 tttattgtacctcataattctatcgacatcattttgatgctctttactaggatcctccacaaactgactaaccactctcgctgtttgttcaatgtcttgt 34973331  T
482 cttgtacatat 492  Q
34973330 cttgtacatat 34973320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 16 - 164
Target Start/End: Original strand, 41413635 - 41413783
16 atgatattgaacacctatgtgtttcgtccttgaatgaaaagctggattccttgcaatgtgcaaggcactctgactgtcacaatacacagtaatttgttct 115  Q
    |||||||||||| ||||  ||  | ||||||||||| || |||||||| ||||||||||||||| |||||| ||| |||||||| ||| ||||||||| |    
41413635 atgatattgaacgcctacatgccttgtccttgaatggaaggctggattacttgcaatgtgcaagacactctaactatcacaatatacaataatttgttat 41413734  T
116 tgcttgtgcccgagttcctccattaacctttgcatccaaatagcttcct 164  Q
    ||  ||||   ||||||||| |||||| |||||||| ||||||||||||    
41413735 tgtctgtgtttgagttcctcaattaacatttgcatcaaaatagcttcct 41413783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 16 - 168
Target Start/End: Complemental strand, 34973743 - 34973589
16 atgatattgaacacctatgtgtttcgtccttgaatgaaaa--gctggattccttgcaatgtgcaaggcactctgactgtcacaatacacagtaatttgtt 113  Q
    |||||||| ||  ||||| || ||||||||||||||||||  | |||||| | | ||||||||||| |||| | ||| ||| |||||||| |||| | ||    
34973743 atgatattaaatgcctatttgcttcgtccttgaatgaaaaaagttggatttcatacaatgtgcaagacactttaactttcataatacacaataatgtctt 34973644  T
114 cttgcttgtgcccgagttcctccattaacctttgcatccaaatagcttccttgca 168  Q
      |||||||| |  ||| |||||||||||||||||||||||| ||||||||||||    
34973643 gatgcttgtgtctaagtccctccattaacctttgcatccaaacagcttccttgca 34973589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 176100 times since January 2019
Visitors: 2680