View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 11737_low_2 (Length: 499)

Name: 11737_low_2
Description: 11737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 11737_low_2
11737_low_2
[»] chr5 (3 HSPs)
chr5 (16-493)||(41722195-41722672)
chr5 (88-493)||(34355795-34356200)
chr5 (7-92)||(34359375-34359460)
[»] chr4 (4 HSPs)
chr4 (16-493)||(30946238-30946715)
chr4 (16-493)||(42269688-42270165)
chr4 (16-493)||(48697876-48698353)
chr4 (7-493)||(2002668-2003154)
[»] chr8 (2 HSPs)
chr8 (16-493)||(9440146-9440623)
chr8 (7-493)||(24594537-24595023)
[»] chr6 (6 HSPs)
chr6 (16-493)||(27874764-27875241)
chr6 (7-493)||(26976939-26977425)
chr6 (7-493)||(1472511-1472996)
chr6 (19-493)||(21965178-21965640)
chr6 (139-261)||(18967120-18967241)
chr6 (5-90)||(18967256-18967341)
[»] chr3 (7 HSPs)
chr3 (7-493)||(5819321-5819807)
chr3 (7-493)||(54544930-54545416)
chr3 (7-493)||(42588733-42589219)
chr3 (93-493)||(25880628-25881030)
chr3 (366-493)||(25880440-25880567)
chr3 (222-331)||(25880239-25880348)
chr3 (416-493)||(25878084-25878161)
[»] chr2 (3 HSPs)
chr2 (7-493)||(829264-829750)
chr2 (7-493)||(28714868-28715344)
chr2 (16-493)||(13840984-13841450)
[»] scaffold0074 (1 HSPs)
scaffold0074 (7-493)||(28081-28567)
[»] chr7 (4 HSPs)
chr7 (45-455)||(2324197-2324601)
chr7 (7-408)||(7504809-7505210)
chr7 (20-362)||(22509836-22510175)
chr7 (401-493)||(7506016-7506108)
[»] chr1 (3 HSPs)
chr1 (282-492)||(34973320-34973530)
chr1 (16-164)||(41413635-41413783)
chr1 (16-168)||(34973589-34973743)


Alignment Details
Target: chr5 (Bit Score: 462; Significance: 0; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 462; E-Value: 0
Query Start/End: Original strand, 16 - 493
Target Start/End: Complemental strand, 41722672 - 41722195
Alignment:
16 atgatattgaacacctatgtgtttcgtccttgaatgaaaagctggattccttgcaatgtgcaaggcactctgactgtcacaatacacagtaatttgttct 115  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||     
41722672 atgatattgaacgcctatgtgtttcgtccttgaatgaaaagctggattccttgcaatatgcaaggcactctgactgtcacaatacacagtaatttgttcc 41722573  T
116 tgcttgtgcccgagttcctccattaacctttgcatccaaatagcttccttgcatgcttgagtagctgccatgtactccgcttctgtcgttgacagagcta 215  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41722572 tgcttgtgcccgagttcctccattaacctttgcatccaaatagcttccttgcatgcttgagtagctgccatgtactccgcttctgtcgttgacagagcta 41722473  T
216 caaccgtttgtaacttggacaaccaacttactgctcctcctgcaagcgtgaacacataaccagtagtagattttcttttatcatgatcacctgcaaaatc 315  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41722472 caaccgtttgtaacttggacaaccaacttactgctcctcctgcaagcgtgaacacataaccagtagtagattttcttttatcatgatcacctgcaaaatc 41722373  T
316 tgaatcaacataaccccagacagttaactctgatcctccgaaacataccgcaacacctgaggttcctttaatgtacctcatgattctcttaacagcattc 415  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41722372 tgaatcaacataacccctgacagttaactctgatcctccgaaacataccgcaacacctgaggttcctttaatgtacctcatgattctcttaacagcattc 41722273  T
416 caatgctctttacccggatccgccataaaccgactaaccactcccactgcttgtgcaatgtctggtcttgtacatatc 493  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41722272 caatgctctttacccggatccgccataaaccgactaaccactcccactgcttgtgcaatgtctggtcttgtacatatc 41722195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 374; E-Value: 0
Query Start/End: Original strand, 88 - 493
Target Start/End: Complemental strand, 34356200 - 34355795
Alignment:
88 actgtcacaatacacagtaatttgttcttgcttgtgcccgagttcctccattaacctttgcatccaaatagcttccttgcatgcttgagtagctgccatg 187  Q
    |||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
34356200 actgtcacaatacacagtaattttctcttgcttgtgcccgagttcctccattaacctttgcatccaaatagcttccttgcatgcttgggtagctgccatg 34356101  T
188 tactccgcttctgtcgttgacagagctacaaccgtttgtaacttggacaaccaacttactgctcctcctgcaagcgtgaacacataaccagtagtagatt 287  Q
    ||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34356100 tactcagcttctgtcgttgacagagctacaacagtttgtaacttggacaaccaacttactgctcctcctgcaagcgtgaacacataaccagtagtagatt 34356001  T
288 ttcttttatcatgatcacctgcaaaatctgaatcaacataaccccagacagttaactctgatcctccgaaacataccgcaacacctgaggttcctttaat 387  Q
    ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||| |||||||||||||    
34356000 ttcttttatcatgatcacctgcaaaatctgaatcaacataacccctgacagttaactctgatcctccgaaacatactgcaacacctaaggttcctttaat 34355901  T
388 gtacctcatgattctcttaacagcattccaatgctctttacccggatccgccataaaccgactaaccactcccactgcttgtgcaatgtctggtcttgta 487  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34355900 gtacctcatgattctcttaacagcattccaatgctctttacccggatccgccataaaccgactaaccactcccactgcttgtgcaatgtctggtcttgta 34355801  T
488 catatc 493  Q
    ||||||    
34355800 catatc 34355795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 7 - 92
Target Start/End: Complemental strand, 34359460 - 34359375
Alignment:
7 tcgaagaatatgatattgaacacctatgtgtttcgtccttgaatgaaaagctggattccttgcaatgtgcaaggcactctgactgt 92  Q
    ||||| || |||||||||||| || ||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
34359460 tcgaacaaaatgatattgaacgccaatgtgcttcgtccttgaatgaaaagctggattccttgcaatgtgtaaggcactctgactgt 34359375  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 462; Significance: 0; HSPs: 4)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 462; E-Value: 0
Query Start/End: Original strand, 16 - 493
Target Start/End: Original strand, 30946238 - 30946715
Alignment:
16 atgatattgaacacctatgtgtttcgtccttgaatgaaaagctggattccttgcaatgtgcaaggcactctgactgtcacaatacacagtaatttgttct 115  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
30946238 atgatattgaacgcctatgtgtttcgtccttgaatgaaaagctggattccttgcaatgtgcaaggcactctgactgtcacaatacacagtaatttgttcc 30946337  T
116 tgcttgtgcccgagttcctccattaacctttgcatccaaatagcttccttgcatgcttgagtagctgccatgtactccgcttctgtcgttgacagagcta 215  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30946338 tgcttgtgcccgagttcctccattaacctttgcatccaaatagcttccttgcatgcttgagtagctgccatgtactccgcttctgtcgttgacagagcta 30946437  T
216 caaccgtttgtaacttggacaaccaacttactgctcctcctgcaagcgtgaacacataaccagtagtagattttcttttatcatgatcacctgcaaaatc 315  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30946438 caaccgtttgtaacttggacaaccaacttactgctcctcctgtaagcgtgaacacataaccagtagtagattttcttttatcatgatcacctgcaaaatc 30946537  T
316 tgaatcaacataaccccagacagttaactctgatcctccgaaacataccgcaacacctgaggttcctttaatgtacctcatgattctcttaacagcattc 415  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30946538 tgaatcaacataacccctgacagttaactctgatcctccgaaacataccgcaacacctgaggttcctttaatgtacctcatgattctcttaacagcattc 30946637  T
416 caatgctctttacccggatccgccataaaccgactaaccactcccactgcttgtgcaatgtctggtcttgtacatatc 493  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30946638 caatgctctttacccggatccgccataaaccgactaaccactcccactgcttgtgcaatgtctggtcttgtacatatc 30946715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 462; E-Value: 0
Query Start/End: Original strand, 16 - 493
Target Start/End: Complemental strand, 42270165 - 42269688
Alignment:
16 atgatattgaacacctatgtgtttcgtccttgaatgaaaagctggattccttgcaatgtgcaaggcactctgactgtcacaatacacagtaatttgttct 115  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||     
42270165 atgatattgaacgcctatgtgtttcgtccttgaatgaaaagctggattccttgcaatatgcaaggcactctgactgtcacaatacacagtaatttgttcc 42270066  T
116 tgcttgtgcccgagttcctccattaacctttgcatccaaatagcttccttgcatgcttgagtagctgccatgtactccgcttctgtcgttgacagagcta 215  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42270065 tgcttgtgcccgagttcctccattaacctttgcatccaaatagcttccttgcatgcttgagtagctgccatgtactccgcttctgtcgttgacagagcta 42269966  T
216 caaccgtttgtaacttggacaaccaacttactgctcctcctgcaagcgtgaacacataaccagtagtagattttcttttatcatgatcacctgcaaaatc 315  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42269965 caaccgtttgtaacttggacaaccaacttactgctcctcctgcaagcgtgaacacataaccagtagtagattttcttttatcatgatcacctgcaaaatc 42269866  T
316 tgaatcaacataaccccagacagttaactctgatcctccgaaacataccgcaacacctgaggttcctttaatgtacctcatgattctcttaacagcattc 415  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42269865 tgaatcaacataacccctgacagttaactctgatcctccgaaacataccgcaacacctgaggttcctttaatgtacctcatgattctcttaacagcattc 42269766  T
416 caatgctctttacccggatccgccataaaccgactaaccactcccactgcttgtgcaatgtctggtcttgtacatatc 493  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42269765 caatgctctttacccggatccgccataaaccgactaaccactcccactgcttgtgcaatgtctggtcttgtacatatc 42269688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 462; E-Value: 0
Query Start/End: Original strand, 16 - 493
Target Start/End: Original strand, 48697876 - 48698353
Alignment:
16 atgatattgaacacctatgtgtttcgtccttgaatgaaaagctggattccttgcaatgtgcaaggcactctgactgtcacaatacacagtaatttgttct 115  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||     
48697876 atgatattgaacgcctatgtgtttcgtccttgaatgaaaagctggattccttgcaatatgcaaggcactctgactgtcacaatacacagtaatttgttcc 48697975  T
116 tgcttgtgcccgagttcctccattaacctttgcatccaaatagcttccttgcatgcttgagtagctgccatgtactccgcttctgtcgttgacagagcta 215  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48697976 tgcttgtgcccgagttcctccattaacctttgcatccaaatagcttccttgcatgcttgagtagctgccatgtactccgcttctgtcgttgacagagcta 48698075  T
216 caaccgtttgtaacttggacaaccaacttactgctcctcctgcaagcgtgaacacataaccagtagtagattttcttttatcatgatcacctgcaaaatc 315  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48698076 caaccgtttgtaacttggacaaccaacttactgctcctcctgcaagcgtgaacacataaccagtagtagattttcttttatcatgatcacctgcaaaatc 48698175  T
316 tgaatcaacataaccccagacagttaactctgatcctccgaaacataccgcaacacctgaggttcctttaatgtacctcatgattctcttaacagcattc 415  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48698176 tgaatcaacataacccctgacagttaactctgatcctccgaaacataccgcaacacctgaggttcctttaatgtacctcatgattctcttaacagcattc 48698275  T
416 caatgctctttacccggatccgccataaaccgactaaccactcccactgcttgtgcaatgtctggtcttgtacatatc 493  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48698276 caatgctctttacccggatccgccataaaccgactaaccactcccactgcttgtgcaatgtctggtcttgtacatatc 48698353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 243; E-Value: 1e-134
Query Start/End: Original strand, 7 - 493
Target Start/End: Complemental strand, 2003154 - 2002668
Alignment:
7 tcgaagaatatgatattgaacacctatgtgtttcgtccttgaatgaaaagctggattccttgcaatgtgcaaggcactctgactgtcacaatacacagta 106  Q
    ||||| || ||| ||||||||| |||||||||| || || ||||||||   ||||||||||||||| ||||| ||||||| ||||||||||||||||  |    
2003154 tcgaacaaaatggtattgaacatctatgtgttttgttctcgaatgaaagaatggattccttgcaatatgcaatgcactctaactgtcacaatacacaaca 2003055  T
107 atttgttcttgcttgtgcccgagttcctccattaacctttgcatccaaatagcttccttgcatgcttgagtagctgccatgtactccgcttctgtcgttg 206  Q
    ||||||| |||  ||||||||||||| |||||||  ||||| |||||||||||||||||||| |||||  |||||||||| || || |||||||| || |    
2003054 atttgttgttgactgtgcccgagttcttccattagtctttgtatccaaatagcttccttgcaagcttgcatagctgccatatattcagcttctgtagtag 2002955  T
207 acagagctacaaccgtttgtaacttggacaaccaacttactgctcctcctgcaagcgtgaacacataaccagtagtagattttcttttatcatgatcacc 306  Q
    | |||||||| || | |||||| || ||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||| |||||||    
2002954 atagagctacgacagattgtaattttgacaaccaacttactgctcctcctgcaagtgtgaacacataaccagtagtagatcttcttttatcaagatcacc 2002855  T
307 tgcaaaatctgaatcaacataaccccagacagttaactctgatcctccgaaacataccgcaacacctgaggttcctttaatgtacctcatgattctctta 406  Q
    ||||||||||||||||||||||||   |||| | || ||  |||||| ||||||||  |||||| || |||||||||| || || |||| ||||||||||    
2002854 tgcaaaatctgaatcaacataacctttgacaataaattccaatcctctgaaacataatgcaacatctaaggttccttttatatatctcaggattctctta 2002755  T
407 acagcattccaatgctctttacccggatccgccataaaccgactaaccactcccactgcttgtgcaatgtctggtcttgtacatatc 493  Q
    ||||||| ||||||||||||||| |||||||||||||| ||||||||| ||||||||||||||||||||||||| ||||||||||||    
2002754 acagcatcccaatgctctttaccaggatccgccataaatcgactaaccgctcccactgcttgtgcaatgtctggccttgtacatatc 2002668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 458; Significance: 0; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 458; E-Value: 0
Query Start/End: Original strand, 16 - 493
Target Start/End: Original strand, 9440146 - 9440623
Alignment:
16 atgatattgaacacctatgtgtttcgtccttgaatgaaaagctggattccttgcaatgtgcaaggcactctgactgtcacaatacacagtaatttgttct 115  Q
    |||||||||||  |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||     
9440146 atgatattgaatgcctatgtgtttcgtccttgaatgaaaagctggattccttgcaatatgcaaggcactctgactgtcacaatacacagtaatttgttcc 9440245  T
116 tgcttgtgcccgagttcctccattaacctttgcatccaaatagcttccttgcatgcttgagtagctgccatgtactccgcttctgtcgttgacagagcta 215  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9440246 tgcttgtgcccgagttcctccattaacctttgcatccaaatagcttccttgcatgcttgagtagctgccatgtactccgcttctgtcgttgacagagcta 9440345  T
216 caaccgtttgtaacttggacaaccaacttactgctcctcctgcaagcgtgaacacataaccagtagtagattttcttttatcatgatcacctgcaaaatc 315  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9440346 caaccgtttgtaacttggacaaccaacttactgctcctcctgcaagcgtgaacacataaccagtagtagattttcttttatcatgatcacctgcaaaatc 9440445  T
316 tgaatcaacataaccccagacagttaactctgatcctccgaaacataccgcaacacctgaggttcctttaatgtacctcatgattctcttaacagcattc 415  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9440446 tgaatcaacataacccctgacagttaactctgatcctccgaaacataccgcaacacctgaggttcctttaatgtacctcatgattctcttaacagcattc 9440545  T
416 caatgctctttacccggatccgccataaaccgactaaccactcccactgcttgtgcaatgtctggtcttgtacatatc 493  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9440546 caatgctctttacccggatccgccataaaccgactaaccactcccactgcttgtgcaatgtctggtcttgtacatatc 9440623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 7 - 493
Target Start/End: Original strand, 24594537 - 24595023
Alignment:
7 tcgaagaatatgatattgaacacctatgtgtttcgtccttgaatgaaaagctggattccttgcaatgtgcaaggcactctgactgtcacaatacacagta 106  Q
    ||||| || ||| |||||||||||||||||||| || || ||||||||  |||||||||||||||||||||| ||||||||||||||||||||||||  |    
24594537 tcgaacaaaatggtattgaacacctatgtgttttgttctcgaatgaaagactggattccttgcaatgtgcaatgcactctgactgtcacaatacacaaca 24594636  T
107 atttgttcttgcttgtgcccgagttcctccattaacctttgcatccaaatagcttccttgcatgcttgagtagctgccatgtactccgcttctgtcgttg 206  Q
    ||||||| |||  |||| |||||||| |||||||  ||||| |||||||||||||||||||| ||||| ||||||||||| || || |||||||| || |    
24594637 atttgttgttgactgtggccgagttcttccattagtctttgtatccaaatagcttccttgcaagcttgtgtagctgccatatattcagcttctgtagtag 24594736  T
207 acagagctacaaccgtttgtaacttggacaaccaacttactgctcctcctgcaagcgtgaacacataaccagtagtagattttcttttatcatgatcacc 306  Q
    | |||||||| || | |||||| || ||||| |||||||  |||||||||||||| |||||||||||||||||||||||| ||||||||||| |||||||    
24594737 atagagctacgacagattgtaattttgacaatcaacttatcgctcctcctgcaagtgtgaacacataaccagtagtagatcttcttttatcaagatcacc 24594836  T
307 tgcaaaatctgaatcaacataaccccagacagttaactctgatcctccgaaacataccgcaacacctgaggttcctttaatgtacctcatgattctctta 406  Q
    ||||||||||||||||||||||||   |||| | || ||  |||||| ||||||||  |||||| || |||||||||| || || |||| ||||||||||    
24594837 tgcaaaatctgaatcaacataacctttgacaataaattccaatcctctgaaacataatgcaacatctaaggttccttttatatatctcaggattctctta 24594936  T
407 acagcattccaatgctctttacccggatccgccataaaccgactaaccactcccactgcttgtgcaatgtctggtcttgtacatatc 493  Q
    ||| ||| |||||| | |||||| |||||||||||||| ||||||||| ||||||||||||||||||||||||| |||||| |||||    
24594937 acaacatcccaatgttttttaccaggatccgccataaatcgactaaccgctcccactgcttgtgcaatgtctggccttgtaaatatc 24595023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 458; Significance: 0; HSPs: 6)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 458; E-Value: 0
Query Start/End: Original strand, 16 - 493
Target Start/End: Original strand, 27874764 - 27875241
Alignment:
16 atgatattgaacacctatgtgtttcgtccttgaatgaaaagctggattccttgcaatgtgcaaggcactctgactgtcacaatacacagtaatttgttct 115  Q
    |||||||||||  |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||     
27874764 atgatattgaatgcctatgtgtttcgtccttgaatgaaaagctggattccttgcaatatgcaaggcactctgactgtcacaatacacagtaatttgttcc 27874863  T
116 tgcttgtgcccgagttcctccattaacctttgcatccaaatagcttccttgcatgcttgagtagctgccatgtactccgcttctgtcgttgacagagcta 215  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27874864 tgcttgtgcccgagttcctccattaacctttgcatccaaatagcttccttgcatgcttgagtagctgccatgtactccgcttctgtcgttgacagagcta 27874963  T
216 caaccgtttgtaacttggacaaccaacttactgctcctcctgcaagcgtgaacacataaccagtagtagattttcttttatcatgatcacctgcaaaatc 315  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27874964 caaccgtttgtaacttggacaaccaacttactgctcctcctgcaagcgtgaacacataaccagtagtagattttcttttatcatgatcacctgcaaaatc 27875063  T
316 tgaatcaacataaccccagacagttaactctgatcctccgaaacataccgcaacacctgaggttcctttaatgtacctcatgattctcttaacagcattc 415  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27875064 tgaatcaacataacccctgacagttaactctgatcctccgaaacataccgcaacacctgaggttcctttaatgtacctcatgattctcttaacagcattc 27875163  T
416 caatgctctttacccggatccgccataaaccgactaaccactcccactgcttgtgcaatgtctggtcttgtacatatc 493  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27875164 caatgctctttacccggatccgccataaaccgactaaccactcccactgcttgtgcaatgtctggtcttgtacatatc 27875241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 439; E-Value: 0
Query Start/End: Original strand, 7 - 493
Target Start/End: Original strand, 26976939 - 26977425
Alignment:
7 tcgaagaatatgatattgaacacctatgtgtttcgtccttgaatgaaaagctggattccttgcaatgtgcaaggcactctgactgtcacaatacacagta 106  Q
    ||||| || ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26976939 tcgaacaaaatgatattgaacacctatgtgcttcgtccttgaatgaaaagctggattccttgcaatgtgcaaggcactctgactgtcacaatacacagta 26977038  T
107 atttgttcttgcttgtgcccgagttcctccattaacctttgcatccaaatagcttccttgcatgcttgagtagctgccatgtactccgcttctgtcgttg 206  Q
    ||||  || |||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||| ||||||||||||||||| |||||||||||||    
26977039 attttctcctgcttgtgcccgagttcctccattaacctttgcacccagatagcttccttgcatgcttgggtagctgccatgtactcagcttctgtcgttg 26977138  T
207 acagagctacaaccgtttgtaacttggacaaccaacttactgctcctcctgcaagcgtgaacacataaccagtagtagattttcttttatcatgatcacc 306  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26977139 acagagctacaacagtttgtaacttggacaaccaacttactgctcctcctgcaagcgtgaacacataaccagtagtagattttcttttatcatgatcacc 26977238  T
307 tgcaaaatctgaatcaacataaccccagacagttaactctgatcctccgaaacataccgcaacacctgaggttcctttaatgtacctcatgattctctta 406  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26977239 tgcaaaatctgaatcaacataacccctgacagttaactctgatcctccgaaacataccgcaacacctgaggttcctttaatgtacctcatgattctctta 26977338  T
407 acagcattccaatgctctttacccggatccgccataaaccgactaaccactcccactgcttgtgcaatgtctggtcttgtacatatc 493  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26977339 acagcattccaatgctctttacccggatccgccataaaccgactaaccactcccactgcttgtgcaatgtctggtcttgtacatatc 26977425  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 7 - 493
Target Start/End: Original strand, 1472511 - 1472996
Alignment:
7 tcgaagaatatgatattgaacacctatgtgtttcgtccttgaatgaaaagctggattccttgcaatgtgcaaggcactctgactgtcacaatacacagta 106  Q
    ||||| || ||| ||||||||| |||||||||| || || ||||||||  ||||||| | |||||||||||| ||||||||||||||||||||||||  |    
1472511 tcgaacaaaatggtattgaacatctatgtgttttgttctcgaatgaaagactggattacatgcaatgtgcaatgcactctgactgtcacaatacacaaca 1472610  T
107 atttgttcttgcttgtgcccgagttcctccattaacctttgcatccaaatagcttccttgcatgcttgagtagctgccatgtactccgcttctgtcgttg 206  Q
    ||||||| |||  ||||| ||||||| |||||||  ||||| |||||||||||||||||||| ||||| ||||||||||| || || |||||||| || |    
1472611 atttgttgttgactgtgcacgagttcttccattagtctttgtatccaaatagcttccttgcaagcttgcgtagctgccatatattcagcttctgtagtag 1472710  T
207 acagagctacaaccgtttgtaacttggacaaccaacttactgctcctcctgcaagcgtgaacacataaccagtagtagattttcttttatcatgatcacc 306  Q
    | |||||||| | |  |||||| || ||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||| |||||||    
1472711 agagagctacga-caattgtaattttgacaaccaacttactgctcctcctgcaagtgtgaacacataaccagtagtagatcttcttttatcaagatcacc 1472809  T
307 tgcaaaatctgaatcaacataaccccagacagttaactctgatcctccgaaacataccgcaacacctgaggttcctttaatgtacctcatgattctctta 406  Q
    ||||||||||||||||||||||||   |||  | || ||  |||||| ||||||||  |||||| || |||||||||| || || |||| ||||||||||    
1472810 tgcaaaatctgaatcaacataacctttgacgataaattccaatcctctgaaacataatgcaacatctaaggttccttttatatatctcaggattctctta 1472909  T
407 acagcattccaatgctctttacccggatccgccataaaccgactaaccactcccactgcttgtgcaatgtctggtcttgtacatatc 493  Q
    ||||||| ||||||||||||||| |||||||||||||| ||||||||| ||||||||||||||||||||||||  ||||||||||||    
1472910 acagcatcccaatgctctttaccaggatccgccataaatcgactaaccgctcccactgcttgtgcaatgtctgaccttgtacatatc 1472996  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 166; E-Value: 1e-88
Query Start/End: Original strand, 19 - 493
Target Start/End: Complemental strand, 21965640 - 21965178
Alignment:
19 atattgaacacctatgtgtttcgtccttgaatgaaaagctggattccttgcaatgtgcaaggcactctgactgtcacaatacacagtaatttgttcttgc 118  Q
    ||||||||| ||| |||| | ||| ||||||||||||| ||||||||||| ||||||||||| |||||||||||||  ||||||| ||||| |||  |||    
21965640 atattgaacgcctgtgtgctccgttcttgaatgaaaagttggattccttgaaatgtgcaaggtactctgactgtca--atacacaataattcgttgctgc 21965543  T
119 ttgtgcccgagttcctccattaacctttgcatccaaatagcttccttgcatgcttgagtagctgccatgtactccgcttctgtcgttgacagagctacaa 218  Q
    || ||||  |||| ||| ||||||||| |||||||||||| |||| ||||||||   ||||||| | |||||   |||| || |||||||||||||||||    
21965542 ttatgcctaagttgctcaattaaccttcgcatccaaatagtttccatgcatgctaaggtagctgtcttgtacgaagcttttgacgttgacagagctacaa 21965443  T
219 ccgtttgtaacttggacaaccaacttactgctcctcctgcaagcgtgaacacataaccagtagtagattttcttttatcatgatcacctgcaaaatctga 318  Q
      |||||||||||||  |||||||||||||||| || || ||||||||||||||| ||| |||| |||||||| ||||||||||||  ||||||||  ||    
21965442 tagtttgtaacttgggtaaccaacttactgctcatcttggaagcgtgaacacatatccaatagttgattttctattatcatgatcaagtgcaaaattcga 21965343  T
319 atcaacataaccccagacagttaactctgatcctccgaaacataccgcaacacctgaggttcctttaatgtacctcatgattctcttaacagcattccaa 418  Q
    ||||| |||||||| || |||||||| | ||||||||||| |||  |||       |||||||||||||||||||| || |||| ||| || |||||  |    
21965342 atcaatataacccctgatagttaactttaatcctccgaaa-atattgca-------aggttcctttaatgtacctcttg-ttcttttaccaacattctga 21965252  T
419 tgctctttacccggatccgccataaaccgactaaccactcccactgcttgtgcaatgtctggtcttgtacatatc 493  Q
    ||||||||| ||| ||| ||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||    
21965251 tgctcttta-ccgaatctgccataaaccgactaactactcccactgcttgtgcaatgtctggtcttttacatatc 21965178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 87; E-Value: 2e-41
Query Start/End: Original strand, 139 - 261
Target Start/End: Complemental strand, 18967241 - 18967120
Alignment:
139 taacctttgcatccaaatagcttccttgcatgcttgagtagctgccatgtactccgcttctgtcgttgacagagctacaaccgtttgtaacttggacaac 238  Q
    |||| ||||||||||||||||||| ||||||||||| |||||||| |||||||| |||||||||||||||||||||||||| | |||||||||||| |||    
18967241 taacgtttgcatccaaatagcttcattgcatgcttgggtagctgcaatgtactcagcttctgtcgttgacagagctacaacag-ttgtaacttggataac 18967143  T
239 caacttactgctcctcctgcaag 261  Q
    |||||||||||||||||||||||    
18967142 caacttactgctcctcctgcaag 18967120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 5 - 90
Target Start/End: Complemental strand, 18967341 - 18967256
Alignment:
5 tgtcgaagaatatgatattgaacacctatgtgtttcgtccttgaatgaaaagctggattccttgcaatgtgcaaggcactctgact 90  Q
    ||||||| || |||||||| ||| |||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||    
18967341 tgtcgaacaaaatgatatttaacgcctatgtgtttcgtccttgaatgaaaagttggattccttgcaatgtgtaaggcactctgact 18967256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 439; Significance: 0; HSPs: 7)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 439; E-Value: 0
Query Start/End: Original strand, 7 - 493
Target Start/End: Original strand, 5819321 - 5819807
Alignment:
7 tcgaagaatatgatattgaacacctatgtgtttcgtccttgaatgaaaagctggattccttgcaatgtgcaaggcactctgactgtcacaatacacagta 106  Q
    ||||| || |||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5819321 tcgaacaaaatgatattgaacgcctatgtgcttcgtccttgaatgaaaagctggattccttgcaatgtgcaaggcactctgactgtcacaatacacagta 5819420  T
107 atttgttcttgcttgtgcccgagttcctccattaacctttgcatccaaatagcttccttgcatgcttgagtagctgccatgtactccgcttctgtcgttg 206  Q
    ||||  || |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||| |||||||||||||    
5819421 attttctcctgcttgtgcccgagttcctccattaacctttgcatccagatagcttccttgcatgcttgggtagctgccatgtactcagcttctgtcgttg 5819520  T
207 acagagctacaaccgtttgtaacttggacaaccaacttactgctcctcctgcaagcgtgaacacataaccagtagtagattttcttttatcatgatcacc 306  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5819521 acagagctacaacagtttgtaacttggacaaccaacttactgctcctcctgcaagcgtgaacacataaccagtagtagattttcttttatcatgatcacc 5819620  T
307 tgcaaaatctgaatcaacataaccccagacagttaactctgatcctccgaaacataccgcaacacctgaggttcctttaatgtacctcatgattctctta 406  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5819621 tgcaaaatctgaatcaacataacccctgacagttaactctgatcctccgaaacataccgcaacacctgaggttcctttaatgtacctcatgattctctta 5819720  T
407 acagcattccaatgctctttacccggatccgccataaaccgactaaccactcccactgcttgtgcaatgtctggtcttgtacatatc 493  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5819721 acagcattccaatgctctttacccggatccgccataaaccgactaaccactcccactgcttgtgcaatgtctggtcttgtacatatc 5819807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 427; E-Value: 0
Query Start/End: Original strand, 7 - 493
Target Start/End: Complemental strand, 54545416 - 54544930
Alignment:
7 tcgaagaatatgatattgaacacctatgtgtttcgtccttgaatgaaaagctggattccttgcaatgtgcaaggcactctgactgtcacaatacacagta 106  Q
    ||||| || |||||||||||| |||||||||||||||||||||||||||| || |||||||||||||||||| |||||||||||||||||||||||| ||    
54545416 tcgaataaaatgatattgaacgcctatgtgtttcgtccttgaatgaaaagttgaattccttgcaatgtgcaatgcactctgactgtcacaatacacaata 54545317  T
107 atttgttcttgcttgtgcccgagttcctccattaacctttgcatccaaatagcttccttgcatgcttgagtagctgccatgtactccgcttctgtcgttg 206  Q
    |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||    
54545316 atttgttcctgcttgtgcccgagttcctccattaacctttgcatccaaatagcttccttgcatgcttgggtagctgccatgtactcagcttctgtcgttg 54545217  T
207 acagagctacaaccgtttgtaacttggacaaccaacttactgctcctcctgcaagcgtgaacacataaccagtagtagattttcttttatcatgatcacc 306  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||    
54545216 acagagctacaacagtttgtaacttggacaaccaacttactgctcctccggcaagtgtgaacacataaccagtagtagattttcttttatcatgatcacc 54545117  T
307 tgcaaaatctgaatcaacataaccccagacagttaactctgatcctccgaaacataccgcaacacctgaggttcctttaatgtacctcatgattctctta 406  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54545116 tgcaaaatctgaatcaacataacccctgacagttaactctgatcctccgaaacataccgcaacacctgaggttcctttaatgtacctcatgattctctta 54545017  T
407 acagcattccaatgctctttacccggatccgccataaaccgactaaccactcccactgcttgtgcaatgtctggtcttgtacatatc 493  Q
    ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54545016 acaacattccaatgctctttacccggatccgccataaaccgactaaccactcccactgcttgtgcaatgtctggtcttgtacatatc 54544930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 243; E-Value: 1e-134
Query Start/End: Original strand, 7 - 493
Target Start/End: Complemental strand, 42589219 - 42588733
Alignment:
7 tcgaagaatatgatattgaacacctatgtgtttcgtccttgaatgaaaagctggattccttgcaatgtgcaaggcactctgactgtcacaatacacagta 106  Q
    ||||| || ||| |||||||||||||||||||| || || ||||||||  |||||||||||||||||||||| ||||| ||||||||||||||||||  |    
42589219 tcgaacaaaatggtattgaacacctatgtgttttgttctcgaatgaaagactggattccttgcaatgtgcaatgcactatgactgtcacaatacacaaca 42589120  T
107 atttgttcttgcttgtgcccgagttcctccattaacctttgcatccaaatagcttccttgcatgcttgagtagctgccatgtactccgcttctgtcgttg 206  Q
    ||||||| |||  ||||||||||||| |||||||  ||||| |||||||||||||||||||| ||||| ||||||||||| || || |||||||| || |    
42589119 atttgttgttgactgtgcccgagttcttccattagtctttgtatccaaatagcttccttgcaagcttgcgtagctgccatatattcagcttctgtagtag 42589020  T
207 acagagctacaaccgtttgtaacttggacaaccaacttactgctcctcctgcaagcgtgaacacataaccagtagtagattttcttttatcatgatcacc 306  Q
    | |||||||| || | |||||| || |||||||||||||| |||||||||||||| |||||||||||||||| ||||||| ||||||||||| |||||||    
42589019 atagagctacgacagattgtaattttgacaaccaacttaccgctcctcctgcaagtgtgaacacataaccagcagtagatcttcttttatcaagatcacc 42588920  T
307 tgcaaaatctgaatcaacataaccccagacagttaactctgatcctccgaaacataccgcaacacctgaggttcctttaatgtacctcatgattctctta 406  Q
    ||||||||||||||||||||||||   |||| | || ||  |||||| || |||||  |||||| || |||||||||| || || |||| ||||||||||    
42588919 tgcaaaatctgaatcaacataacctttgacaataaattccaatcctctgacacataatgcaacatctaaggttccttttatatatctcaggattctctta 42588820  T
407 acagcattccaatgctctttacccggatccgccataaaccgactaaccactcccactgcttgtgcaatgtctggtcttgtacatatc 493  Q
    ||||||| |||||| |||||||| |||||||||||||| ||||||||| ||||||||||||||||||||||||| ||||||||||||    
42588819 acagcatcccaatgttctttaccaggatccgccataaatcgactaaccgctcccactgcttgtgcaatgtctggccttgtacatatc 42588733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 93 - 493
Target Start/End: Complemental strand, 25881030 - 25880628
Alignment:
93 cacaatacacagtaatttgttcttgcttgtgcccgagttcctccattaacctttgcatccaaatagcttccttgcatgcttgagtagctgccatgtactc 192  Q
    |||||||||||  |||||||| ||| ||||||| || ||| ||||||| |||||| |||||||||||||||| ||| ||||| |||| | | || || ||    
25881030 cacaatacacaacaatttgttgttgattgtgcctga-ttcttccattagcctttgtatccaaatagcttcctagcaagcttgcgtaggtacaatatattc 25880932  T
193 cgcttctgtcgttgacagagctacaaccgtttgtaacttggacaaccaacttactgctcctcctgcaagcgtgaacacataaccagtagtaga---tttt 289  Q
     || | ||| || || ||||| |||||  ||||||| || ||||||||||||| |||||||||||||||  ||||||||||||| ||||||||   ||||    
25880931 agcatatgtagtagatagagcgacaacaatttgtaattttgacaaccaacttattgctcctcctgcaagtatgaacacataaccggtagtagattttttt 25880832  T
290 cttttatcatgatcacctgcaaaatctgaatcaacataaccccagacagttaactctgatcctccgaaacataccgcaacacctgaggttcc---tttaa 386  Q
     |||||||| |||| ||||||||||||||||| |||||||||   ||| | || ||  |   || ||||||||  |||||| |||||||| |   ||| |    
25880831 tttttatcaagatctcctgcaaaatctgaatctacataaccctttacaataaattccaa---tctgaaacataatgcaacatctgaggtttcctttttta 25880735  T
387 tgtacctcatgattctcttaacagcattccaatgctctttacccggatccgccataaaccgactaaccactcccactgcttgtgcaatgtctggtcttgt 486  Q
    | || |||| |||||| |||| | |||  |||||||||||||| |||||||||||||| |||||||   |||||||||||||||||||||||||||||||    
25880734 tatatctcacgattcttttaataacatctcaatgctctttaccaggatccgccataaatcgactaattgctcccactgcttgtgcaatgtctggtcttgt 25880635  T
487 acatatc 493  Q
    |||||||    
25880634 acatatc 25880628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 366 - 493
Target Start/End: Complemental strand, 25880567 - 25880440
Alignment:
366 caacacctgaggttcctttaatgtacctcatgattctcttaacagcattccaatgctctttacccggatccgccataaaccgactaaccactcccactgc 465  Q
    ||||| ||||||||||||| || || |||| |||||| || | | ||| ||||||||||||||| |||||||||||||| |||||||  ||| |||||||    
25880567 caacatctgaggttccttttatatatctcaggattcttttgataccatcccaatgctctttaccaggatccgccataaatcgactaattacttccactgc 25880468  T
466 ttgtgcaatgtctggtcttgtacatatc 493  Q
    ||||||||||||||||||||||||||||    
25880467 ttgtgcaatgtctggtcttgtacatatc 25880440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 222 - 331
Target Start/End: Complemental strand, 25880348 - 25880239
Alignment:
222 tttgtaacttggacaaccaacttactgctcctcctgcaagcgtgaacacataaccagtagtagattttcttttatcatgatcacctgcaaaatctgaatc 321  Q
    ||||||| || ||||||||||||| |||||||| |||||| |||||||||||||| ||| ||||| ||||||||||| ||||||||  |||||||||||     
25880348 tttgtaattttgacaaccaacttattgctcctcttgcaagtgtgaacacataaccggtattagatattcttttatcacgatcacctataaaatctgaatt 25880249  T
322 aacataaccc 331  Q
    |||| |||||    
25880248 aacaaaaccc 25880239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 416 - 493
Target Start/End: Complemental strand, 25878161 - 25878084
Alignment:
416 caatgctctttacccggatccgccataaaccgactaaccactcccactgcttgtgcaatgtctggtcttgtacatatc 493  Q
    |||||||||||||| |||||||||||||| |||||||    || ||||||||||||||||||| ||||||||||||||    
25878161 caatgctctttaccaggatccgccataaatcgactaattgttctcactgcttgtgcaatgtctagtcttgtacatatc 25878084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 427; Significance: 0; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 427; E-Value: 0
Query Start/End: Original strand, 7 - 493
Target Start/End: Complemental strand, 829750 - 829264
Alignment:
7 tcgaagaatatgatattgaacacctatgtgtttcgtccttgaatgaaaagctggattccttgcaatgtgcaaggcactctgactgtcacaatacacagta 106  Q
    ||||| || |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
829750 tcgaacaaaatgatattgaacgcctatgtgtttcgtccttgaatgaaaagctggattccttgcaatgtgcaaggcactctgactgtcacaatacacagta 829651  T
107 atttgttcttgcttgtgcccgagttcctccattaacctttgcatccaaatagcttccttgcatgcttgagtagctgccatgtactccgcttctgtcgttg 206  Q
    ||||  || |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||| |||||||||||||    
829650 attttctcctgcttgtgcccgagttcctccattaacctttgcatccagatagcttccttgcatgcttgggtagctgccatgtactcagcttctgtcgttg 829551  T
207 acagagctacaaccgtttgtaacttggacaaccaacttactgctcctcctgcaagcgtgaacacataaccagtagtagattttcttttatcatgatcacc 306  Q
    ||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
829550 acagagctacaacagtttgtaacttggataaccaacttactgctcctcctgcaagcgtgaacacataaccagtagtagattttcttttatcctgatcacc 829451  T
307 tgcaaaatctgaatcaacataaccccagacagttaactctgatcctccgaaacataccgcaacacctgaggttcctttaatgtacctcatgattctctta 406  Q
    |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
829450 tgcaaaatctgaatcaacataacccctgacagttaactctgatcctccgaaacataccgcaacacctggggttcctttaatgtacctcatgattctctta 829351  T
407 acagcattccaatgctctttacccggatccgccataaaccgactaaccactcccactgcttgtgcaatgtctggtcttgtacatatc 493  Q
    ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
829350 acaacattccaatgctctttacccggatccgccataaaccgactaaccactcccactgcttgtgcaatgtctggtcttgtacatatc 829264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 7 - 493
Target Start/End: Complemental strand, 28715344 - 28714868
Alignment:
7 tcgaagaatatgatattgaacacctatgtgtttcgtccttgaatgaaaagctggattccttgcaatgtgcaaggcactctgactgtcacaatacacagta 106  Q
    ||||| || ||||||||||||||||||||| ||| |||||||| |||||| ||||||          ||||||||||| | ||| |||||||||||||||    
28715344 tcgaacaaaatgatattgaacacctatgtgcttcatccttgaacgaaaagttggatt----------tgcaaggcactataactatcacaatacacagta 28715255  T
107 atttgttcttgcttgtgcccgagttcctccattaacctttgcatccaaatagcttccttgcatgcttgagtagctgccatgtactccgcttctgtcgttg 206  Q
    ||||| || ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| |||||    
28715254 atttgctcctgcttgtgcccgagtacctccattaacctttgcatccaaatagcttccttgcatgcttgggtagctgccatgtactcagcttctgacgttg 28715155  T
207 acagagctacaaccgtttgtaacttggacaaccaacttactgctcctcctgcaagcgtgaacacataaccagtagtagattttcttttatcatgatcacc 306  Q
    ||| ||||||||| |||||||||||||| |||||||||||||||||||  |||||| ||||||| |||||||||  ||||||||||| ||||||||||||    
28715154 acatagctacaacagtttgtaacttggataaccaacttactgctcctctcgcaagcatgaacacgtaaccagtaaaagattttctttcatcatgatcacc 28715055  T
307 tgcaaaatctgaatcaacataaccccagacagttaactctgatcctccgaaacataccgcaacacctgaggttcctttaatgtacctcatgattctctta 406  Q
     ||||||||||||||||||||||||  |||| ||||||||||||||||||||||||  ||||||| ||||||||||||||||||||||||||||||||||    
28715054 ggcaaaatctgaatcaacataacccatgacaattaactctgatcctccgaaacatattgcaacacatgaggttcctttaatgtacctcatgattctctta 28714955  T
407 acagcattccaatgctctttacccggatccgccataaaccgactaaccactcccactgcttgtgcaatgtctggtcttgtacatatc 493  Q
    ||| |||||||||||||||||   ||||| | |||||||||||||||||||||||||  ||||||||| |||| |||||||||||||    
28714954 acaacattccaatgctctttataaggatctgtcataaaccgactaaccactcccactaattgtgcaatctctgatcttgtacatatc 28714868  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 164; E-Value: 2e-87
Query Start/End: Original strand, 16 - 493
Target Start/End: Original strand, 13840984 - 13841450
Alignment:
16 atgatattgaacacctatgtgtttcgtccttgaatgaaaagctggattccttgcaatgtgcaaggcactctgactgtcacaatacacagtaatttgttct 115  Q
    |||||||||||||| ||||||||| |||||||||||||||  || ||| ||||||||||| |||||| ||| | |||||||||||| ||||||||| | |    
13840984 atgatattgaacacttatgtgttttgtccttgaatgaaaaa-tgaatttcttgcaatgtgaaaggcattctaattgtcacaatacatagtaatttgatgt 13841082  T
116 tgcttgtgcccgagttcctccattaacctttgcatccaaatagcttccttgcatgcttgagtagctgccatgtactccgcttctgtcgttgacagagcta 215  Q
    || |||||||| ||||||||||||||||||||||| |||||| |||||||||| || || | || |||||||||||| | || ||||||||||| |||||    
13841083 tgtttgtgcccaagttcctccattaacctttgcattcaaataacttccttgcaagcatgggaagatgccatgtactcag-ttttgtcgttgacaaagcta 13841181  T
216 caaccgtttgtaacttggacaaccaacttactgctcctcctgcaagcgtgaacacataaccagtagtagattttcttttatcatgatcacctgcaaaatc 315  Q
    ||     || ||||||||| ||||||||||| ||||||| |  || ||||||||||||| |   |||||||||| | ||||||||||||| || ||||||    
13841182 ca-----ttctaacttggataaccaacttaccgctcctcgtataaacgtgaacacataatc---agtagattttatattatcatgatcacttgtaaaatc 13841273  T
316 tgaatcaacataaccccagacagttaactctgatcctccgaaacataccgcaacacctgaggttcctttaatgtacctcatgattctcttaacagcattc 415  Q
    ||||||||||||||||  | || ||||||||||||||||||||||||  ||||||| ||||||| |||| || || ||||  ||||  ||||||  |||     
13841274 tgaatcaacataacccttgtcatttaactctgatcctccgaaacatattgcaacacttgaggtttctttgatatatctcaaaattcatttaaca-aattt 13841372  T
416 caatgctctttacccggatccgccataaaccgactaaccactcccactgcttgtgcaatgtctggtcttgtacatatc 493  Q
     || | | |||||| ||||  |||||||||||||||||||||||||||  ||||| | ||||||||||||||||||||    
13841373 aaaggatatttaccaggatatgccataaaccgactaaccactcccactatttgtgtagtgtctggtcttgtacatatc 13841450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0074 (Bit Score: 403; Significance: 0; HSPs: 1)
Name: scaffold0074
Description:

Target: scaffold0074; HSP #1
Raw Score: 403; E-Value: 0
Query Start/End: Original strand, 7 - 493
Target Start/End: Original strand, 28081 - 28567
Alignment:
7 tcgaagaatatgatattgaacacctatgtgtttcgtccttgaatgaaaagctggattccttgcaatgtgcaaggcactctgactgtcacaatacacagta 106  Q
    ||||| || |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28081 tcgaacaaaatgatattgaacgcctatgtgtttcgtccttgaatgaaaagctggattccttgcaatgtgcaaggcactctgactgtcacaatacacagta 28180  T
107 atttgttcttgcttgtgcccgagttcctccattaacctttgcatccaaatagcttccttgcatgcttgagtagctgccatgtactccgcttctgtcgttg 206  Q
    ||||  || ||||||||| ||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28181 atttaatcctgcttgtgcacgagttcctccataaacctttgcaaccaaatagcttccttgcatgcttgagtagctgccatgtactccgcttctgtcgttg 28280  T
207 acagagctacaaccgtttgtaacttggacaaccaacttactgctcctcctgcaagcgtgaacacataaccagtagtagattttcttttatcatgatcacc 306  Q
    ||||||||||||| |||||||||||||| |||||||||||||||||||||| ||| |||||||||||| |||||||||||||||||||||||||||||||    
28281 acagagctacaacagtttgtaacttggataaccaacttactgctcctcctgaaagtgtgaacacataatcagtagtagattttcttttatcatgatcacc 28380  T
307 tgcaaaatctgaatcaacataaccccagacagttaactctgatcctccgaaacataccgcaacacctgaggttcctttaatgtacctcatgattctctta 406  Q
    | |||||||||||||||||||||||| |||||||||||||||||||| ||||||||  |||||| | |||||||||||||||||||||||||||||||||    
28381 tacaaaatctgaatcaacataacccctgacagttaactctgatcctctgaaacatattgcaacatccgaggttcctttaatgtacctcatgattctctta 28480  T
407 acagcattccaatgctctttacccggatccgccataaaccgactaaccactcccactgcttgtgcaatgtctggtcttgtacatatc 493  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28481 acagcattccaatgctctttacccggatccgccataaaccgactaaccactcccactgcttgtgcaatgtctggtcttgtacatatc 28567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 248; Significance: 1e-137; HSPs: 4)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 248; E-Value: 1e-137
Query Start/End: Original strand, 45 - 455
Target Start/End: Original strand, 2324197 - 2324601
Alignment:
45 ttgaatgaaaagctggattccttgcaatgtgcaaggcactctgactgtcacaatacacagtaatttgttcttgcttgtgcccgagttcctccattaacct 144  Q
    |||||||||||| ||||||||||||||||| ||       ||||||| ||||||||| ||| ||||  || |||||||||||||||||||||||||||||    
2324197 ttgaatgaaaagatggattccttgcaatgtccac------ctgactgccacaatacaaagtgattttctcctgcttgtgcccgagttcctccattaacct 2324290  T
145 ttgcatccaaatagcttccttgcatgcttgagtagctgccatgtactccgcttctgtcgttgacagagctacaaccgtttgtaacttggacaaccaactt 244  Q
    |||||||||||||||||||||||||||||| ||||||||||||||||  |||||||||||||||| ||||||||| |||||||||||||| ||| |||||    
2324291 ttgcatccaaatagcttccttgcatgcttgggtagctgccatgtacttagcttctgtcgttgacaaagctacaacagtttgtaacttggataactaactt 2324390  T
245 actgctcctcctgcaagcgtgaacacataaccagtagtagattttcttttatcatgatcacctgcaaaatctgaatcaacataaccccagacagttaact 344  Q
    ||  ||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||| | | ||||  || |||||||    
2324391 acaactcctcctgcaagtgtgaacacataactagtagtagattttcttttatcatgatcacctgcaaaatctgactcaagaaatcccccaacggttaact 2324490  T
345 ctgatcctccgaaacataccgcaacacctgaggttcctttaatgtacctcatgattctcttaacagcattccaatgctctttacccggatccgccataaa 444  Q
    ||||||||||||||||||  |||||||||||||||||||| || ||| |||||||||||||||||||||||||||||||||||||  |||||||||||||    
2324491 ctgatcctccgaaacatattgcaacacctgaggttccttttatatacatcatgattctcttaacagcattccaatgctctttaccaagatccgccataaa 2324590  T
445 ccgactaacca 455  Q
    ||||| |||||    
2324591 ccgaccaacca 2324601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 178; E-Value: 8e-96
Query Start/End: Original strand, 7 - 408
Target Start/End: Original strand, 7504809 - 7505210
Alignment:
7 tcgaagaatatgatattgaacacctatgtgtttcgtccttgaatgaaaagctggattccttgcaatgtgcaaggcactctgactgtcacaatacacagta 106  Q
    ||||| || ||| ||||||||| |||||||||| || || ||||||||  |||||||||||||||||||||| ||||||||||||||||||||||||  |    
7504809 tcgaacaaaatggtattgaacatctatgtgttttgttctcgaatgaaagactggattccttgcaatgtgcaatgcactctgactgtcacaatacacaaca 7504908  T
107 atttgttcttgcttgtgcccgagttcctccattaacctttgcatccaaatagcttccttgcatgcttgagtagctgccatgtactccgcttctgtcgttg 206  Q
    ||||||| |||  ||||| ||||||| |||||||  ||||| |||||||||||||||||||| ||||| ||||||||||| || || |||||||| || |    
7504909 atttgttgttgactgtgcacgagttcttccattagtctttgtatccaaatagcttccttgcaagcttgcgtagctgccatatattcagcttctgtagtag 7505008  T
207 acagagctacaaccgtttgtaacttggacaaccaacttactgctcctcctgcaagcgtgaacacataaccagtagtagattttcttttatcatgatcacc 306  Q
    | |||||||| ||   |||||| || ||||| |||||||| |||||||||||||| |||||||||||||||||||||||| ||||||||||| |||||||    
7505009 atagagctacgacaaattgtaattttgacaatcaacttaccgctcctcctgcaagtgtgaacacataaccagtagtagatcttcttttatcaagatcacc 7505108  T
307 tgcaaaatctgaatcaacataaccccagacagttaactctgatcctccgaaacataccgcaacacctgaggttcctttaatgtacctcatgattctctta 406  Q
    ||||||||||||||||||||||||   |||| | || ||  |||||| ||||||||  |||||| || |||||||||| || || |||| ||||||||||    
7505109 tgcaaaatctgaatcaacataacctttgacaataaattccaatcctctgaaacataatgcaacatctaaggttccttttatatatctcaggattctctta 7505208  T
407 ac 408  Q
    ||    
7505209 ac 7505210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 20 - 362
Target Start/End: Complemental strand, 22510175 - 22509836
Alignment:
20 tattgaacacctatgtgtttcgtccttgaatgaaaagctggattccttgcaatgtgcaaggcactctgactgtcacaatacacagtaatttgttcttgct 119  Q
    |||||||| ||| ||||  ||||| | ||||  |||| |||||| |||| |||||||||| |||||||||| |||||||||| |||||||||||  | ||    
22510175 tattgaacgcctttgtgcatcgtcttggaatacaaagttggattgcttgaaatgtgcaagacactctgactatcacaatacaaagtaatttgttgatact 22510076  T
120 tgtgcccgagttcctccattaacctttgcatccaaatagcttccttgcatgcttgagta-gctgccatgtactccgcttctgtcgttgacagagctacaa 218  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||  | | ||||  || ||||||| ||   |||| | |||||||||||| |||    
22510075 tgtgcgcgagttcctccattaaccttatcatccaaatagcttccttgcaaacct-agtatacttccatgtattcaatttctcttgttgacagagcttcaa 22509977  T
219 ccgtttgtaacttggacaaccaacttactgctcctcctgcaagcgtgaacacataaccagtagtagattttctttt--atcatgatcacctgcaaaatct 316  Q
    |  || ||||||||||||||||| |||||||||||| | |||  |||||     ||||| ||||| || || ||||  ||||||||||||| ||||||||    
22509976 caattggtaacttggacaaccaaattactgctcctcttacaaatgtgaa-----aaccaatagtatatatttttttcaatcatgatcaccttcaaaatct 22509882  T
317 gaatcaacataaccccagacagttaactctgatcctccgaaacata 362  Q
    ||||||||||||| ||  |  ||||||| |||||||||||||||||    
22509881 gaatcaacataacacctaatggttaactttgatcctccgaaacata 22509836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 61; E-Value: 6e-26
Query Start/End: Original strand, 401 - 493
Target Start/End: Original strand, 7506016 - 7506108
Alignment:
401 ctcttaacagcattccaatgctctttacccggatccgccataaaccgactaaccactcccactgcttgtgcaatgtctggtcttgtacatatc 493  Q
    ||||||||| ||| ||||||||||||||| ||||||||||||||  ||||| || ||||||||||||||||||||||||| ||||||||||||    
7506016 ctcttaacaacatcccaatgctctttaccaggatccgccataaattgactagccgctcccactgcttgtgcaatgtctggccttgtacatatc 7506108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 95; Significance: 3e-46; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 282 - 492
Target Start/End: Complemental strand, 34973530 - 34973320
Alignment:
282 tagattttcttttatcatgatcacctgcaaaatctgaatcaacataaccccagacagttaactctgatcctccgaaacataccgcaacacctgaggttcc 381  Q
    ||||||||||||||| ||||||| |||||||||||||||| ||||||||||  |||||||| | |||||||||||| ||||  |||||||||||||||||    
34973530 tagattttcttttattatgatcatctgcaaaatctgaatcgacataacccctaacagttaaatttgatcctccgaatcatattgcaacacctgaggttcc 34973431  T
382 tttaatgtacctcatgattctcttaacagcattccaatgctctttacccggatccgccataaaccgactaaccactcccactgcttgtgcaatgtctggt 481  Q
    |||| |||||||||| ||||| |  ||| ||||   |||||||||||  |||||| ||| |||| |||||||||||| | ||| |||| |||||||| ||    
34973430 tttattgtacctcataattctatcgacatcattttgatgctctttactaggatcctccacaaactgactaaccactctcgctgtttgttcaatgtcttgt 34973331  T
482 cttgtacatat 492  Q
    |||||||||||    
34973330 cttgtacatat 34973320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 16 - 164
Target Start/End: Original strand, 41413635 - 41413783
Alignment:
16 atgatattgaacacctatgtgtttcgtccttgaatgaaaagctggattccttgcaatgtgcaaggcactctgactgtcacaatacacagtaatttgttct 115  Q
    |||||||||||| ||||  ||  | ||||||||||| || |||||||| ||||||||||||||| |||||| ||| |||||||| ||| ||||||||| |    
41413635 atgatattgaacgcctacatgccttgtccttgaatggaaggctggattacttgcaatgtgcaagacactctaactatcacaatatacaataatttgttat 41413734  T
116 tgcttgtgcccgagttcctccattaacctttgcatccaaatagcttcct 164  Q
    ||  ||||   ||||||||| |||||| |||||||| ||||||||||||    
41413735 tgtctgtgtttgagttcctcaattaacatttgcatcaaaatagcttcct 41413783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 16 - 168
Target Start/End: Complemental strand, 34973743 - 34973589
Alignment:
16 atgatattgaacacctatgtgtttcgtccttgaatgaaaa--gctggattccttgcaatgtgcaaggcactctgactgtcacaatacacagtaatttgtt 113  Q
    |||||||| ||  ||||| || ||||||||||||||||||  | |||||| | | ||||||||||| |||| | ||| ||| |||||||| |||| | ||    
34973743 atgatattaaatgcctatttgcttcgtccttgaatgaaaaaagttggatttcatacaatgtgcaagacactttaactttcataatacacaataatgtctt 34973644  T
114 cttgcttgtgcccgagttcctccattaacctttgcatccaaatagcttccttgca 168  Q
      |||||||| |  ||| |||||||||||||||||||||||| ||||||||||||    
34973643 gatgcttgtgtctaagtccctccattaacctttgcatccaaacagcttccttgca 34973589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC