View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 11737_low_3 (Length: 462)

Name: 11737_low_3
Description: 11737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 11737_low_3
11737_low_3
[»] chr8 (1 HSPs)
chr8 (1-438)||(929795-930233)


Alignment Details
Target: chr8 (Bit Score: 373; Significance: 0; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 373; E-Value: 0
Query Start/End: Original strand, 1 - 438
Target Start/End: Complemental strand, 930233 - 929795
Alignment:
1 agtagtcgtggtgcaagcaagaccgtggcagaacagtacgtactataacagtcaaaaagtgttaaactagaaatcaacaacaaaaagcaagtctaaggtg 100  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
930233 agtagttgtggtgcaagcaagaccgtggcagaacagtacgtactataacagtcaaaaagtgttaaactagaaatcaacaacaaaaagcaagtctaaggtg 930134  T
101 taggatacaccaatataattgacttaggataaccaannnnnnnnnnnnnn-gaataaaagataagtaaaacacgccattgatatataatcatggtatata 199  Q
    |||||||||||||||||||||||| |||||||||||               ||||||||||| |||||||||||||||||||||||||||||||||||||    
930133 taggatacaccaatataattgactcaggataaccaattttttttgttttttgaataaaagattagtaaaacacgccattgatatataatcatggtatata 930034  T
200 ctatacagtggaatcatgtatttcaacacttccaaaactgatgaaaaatagcatatctatagttaatcacaattaacattcacaattaatatcaacaatg 299  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
930033 ctatacagtggaatcatgtatttcaacacttccaaaactgatgaaaaatagcatatctatagttaatcacaattaacattcacaattaatatcaacaatg 929934  T
300 aacatcattaacaacaactaatacaacatgatttggagatgatcataaaataaagaaataatcgatataatcaagatgattattgaagagtatcaacaaa 399  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
929933 aacatcattaacaacaactaatacaacatgatttggagatgatcataaaataaagaaataatcgatataatcaagatgattattgaagagtatcaacaaa 929834  T
400 ctcggtagcatcgacacccctgatcaaagatgtgttaga 438  Q
    |||||||||||||||||||||||||||||| ||||||||    
929833 ctcggtagcatcgacacccctgatcaaagacgtgttaga 929795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC