View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 11737_low_4 (Length: 398)

Name: 11737_low_4
Description: 11737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] 11737_low_4
[»] chr1 (1 HSPs)
chr1 (1-381)||(46586552-46586931)

Alignment Details
Target: chr1 (Bit Score: 337; Significance: 0; HSPs: 1)
Name: chr1

Target: chr1; HSP #1
Raw Score: 337; E-Value: 0
Query Start/End: Original strand, 1 - 381
Target Start/End: Complemental strand, 46586931 - 46586552
1 tctatttgatacaatggatagtatatcaaacgtgatttattgaaaatgattcttaactcaatccaaatcacctctgcttatgaatggttgtagatgatca 100  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
46586931 tctatttgatacaatgggtagtatatcaaacgtgatttattgaaaatgattcttaactcaatcaaaatcacctctgcttatgaatggttgtagatgatca 46586832  T
101 caacttataatttttatgaatatcattctcaaagttatatggtgaaatgttttgaaaaaagttgatgatgcatgggaaatttaatggacggtgggttgat 200  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||| |||||||||||||| |||||||||||||||||    
46586831 caacttataatttttatgaatatcattctcaaagttatatggtaaaatgttttgaaaaa-gttgatggtgcatgggaaatttgatggacggtgggttgat 46586733  T
201 gacaatatagatatgtggaaggtgtgactcccaatcatttgtggttcaattctttcacattcgaaggttgaatcatcgcaataaatcaatggcccatttc 300  Q
46586732 gacaatatagatatgtggaaggtgtgactcccaatcatttgtggttcaattctttcacattcgaaggttgaatcatcgcaataaatcaatggcccatttc 46586633  T
301 attaaattctccatatggatacagatcgccatcaatccactagtttcagctctagtttgtgtccaattaatatgtcacacc 381  Q
     |||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||    
46586632 tttaaattctccagatggatacagatcgccatcaatccattagtttcagctctagtttgtgtccaattaacatgtcacacc 46586552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 98093 times since January 2019
Visitors: 2269