View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 11737_low_5 (Length: 339)

Name: 11737_low_5
Description: 11737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 11737_low_5
11737_low_5
[»] chr8 (1 HSPs)
chr8 (1-339)||(930228-930566)


Alignment Details
Target: chr8 (Bit Score: 303; Significance: 1e-170; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 1 - 339
Target Start/End: Complemental strand, 930566 - 930228
Alignment:
1 ccactcttatccaaaaatcagactttgaaataataatttagaaagatatatacaaagataaacggatttaaacaaatgttggcccctgttcgaggtggtt 100  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
930566 ccactcttatccaaaaatcagactttgaaacaataatttagaaagatatatacaaagataaacggatttaaacaaatgttggcccctgttcgaggtggtt 930467  T
101 tttgtgttatattttgaaattttcataatgtaacaacctcagatatagnnnnnnnngtcaaaattaacaagaaacataacagcagcaatattgattgcac 200  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||        ||||||||||||||||||||||||||||||||||||||||||||    
930466 tttgtgttatattttgaaattttcataatgtaacaacctcggatatagttttttttgtcaaaattaacaagaaacataacagcagcaatattgattgcac 930367  T
201 aaagctaaaaatcgtttgtggataatatgattacctgagaacaaacaacaatatgaactggattgatcacttggaatggccgatacacgaatggtgacgc 300  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
930366 aaagctaaaaaccgtttgtggataatatgattacctgagaacaaacaacaatatgaactggattgatcacttggaatggccgatacacgaatggtgacgc 930267  T
301 acacaggaacaacctcgtgagatgaaacttgaaagtagt 339  Q
    |||||||||||||||||||||||||||||||||||||||    
930266 acacaggaacaacctcgtgagatgaaacttgaaagtagt 930228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC