View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 11737_low_6 (Length: 277)

Name: 11737_low_6
Description: 11737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 11737_low_6
11737_low_6
[»] chr8 (1 HSPs)
chr8 (3-261)||(15694955-15695213)


Alignment Details
Target: chr8 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 3 - 261
Target Start/End: Complemental strand, 15695213 - 15694955
Alignment:
3 catgtccaagaatatcctttgacttttctaaaatatctatcaatacaaacacatgaagagtggacttggtaaacataaattcatgactcaaattttctat 102  Q
    |||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15695213 catgaccaataatatcctttgacttttctaaaatatctatcaatacaaacacatgaagagtggacttggtaaacataaattcatgactcaaattttctat 15695114  T
103 cattacagcatcatttgctttggacttctaaatataatagctcaattatcattacaacatcattggcaataattggaatcatgcaataggaacatagtac 202  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15695113 cattacagcatcatttgctttggacttctaaatataatagctcaattatcattacaacatcattggcaataattggaatcatgcaataggaacatagtac 15695014  T
203 tccatggaaggaagaaaactaaacttgacatcaatattttttgctttcatactatatat 261  Q
    |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
15695013 tccatggaaggaagaaaactaaacttgagatcaatattttttgctttcatactatatat 15694955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 78144 times since January 2019
Visitors: 2277