View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 454-NF4349-Insertion-11 (Length: 145)

Name: 454-NF4349-Insertion-11
Description: 454-NF4349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] 454-NF4349-Insertion-11
[»] chr1 (1 HSPs)
chr1 (1-145)||(37164159-37164303)

Alignment Details
Target: chr1 (Bit Score: 141; Significance: 3e-74; HSPs: 1)
Name: chr1

Target: chr1; HSP #1
Raw Score: 141; E-Value: 3e-74
Query Start/End: Original strand, 1 - 145
Target Start/End: Complemental strand, 37164303 - 37164159
1 aatctagcatttgactctaaacctcatatttactataacaacttctaaaccattcttcaataatctacattcaaacaaatttctattttggacaccattc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
37164303 aatctagcatttgactctaaacctcatatttactataacaacttctaaaccattcttcaataatctacattcaaacatatttctattttggacaccattc 37164204  T
101 tgaattgcacactccggtagggtttgacggaggattaccaccgcc 145  Q
37164203 tgaattgcacactccggtagggtttgacggaggattaccaccgcc 37164159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 98489 times since January 2019
Visitors: 2275