View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 454-NF4349-Insertion-2 (Length: 210)

Name: 454-NF4349-Insertion-2
Description: 454-NF4349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 454-NF4349-Insertion-2
454-NF4349-Insertion-2
[»] chr1 (1 HSPs)
chr1 (8-210)||(37055158-37055360)


Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 8 - 210
Target Start/End: Original strand, 37055158 - 37055360
Alignment:
8 aaaaccttgtttctcttcattctcatctaaacctgagattttctgaacctgcttcttttcattttcttgttctttcatgtaatagttatcttgtaaagta 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37055158 aaaaccttgtttctcttcattctcatctaaacctgagattttctgaacctgcttcttttcattttcttgttctttcatgtaatagttatcttgtaaagta 37055257  T
108 tgaacatggaagcttccagctgcattgattaaagcaccaacactcaaaatgtgagtcctttgtgatgatgataaaggaaccaagagtgtgataatgatga 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37055258 tgaacatggaagcttccagctgcattgattaaagcaccaacactcaaaatgtgagtcctttgtgatgatgataaaggaaccaagagtgtgataatgatga 37055357  T
208 tga 210  Q
    |||    
37055358 tga 37055360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 98538 times since January 2019
Visitors: 2275