View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 454-NF4349-Insertion-20 (Length: 62)

Name: 454-NF4349-Insertion-20
Description: 454-NF4349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] 454-NF4349-Insertion-20
[»] chr8 (27 HSPs)
chr8 (1-62)||(21197690-21197751)
chr8 (1-62)||(23837848-23837909)
chr8 (1-58)||(21191144-21191201)
chr8 (1-59)||(17285857-17285915)
chr8 (1-62)||(23151385-23151446)
chr8 (5-58)||(26012115-26012168)
chr8 (1-62)||(29307066-29307127)
chr8 (1-62)||(38534297-38534358)
chr8 (15-62)||(5855232-5855279)
chr8 (16-62)||(15933918-15933964)
chr8 (1-62)||(33610591-33610652)
chr8 (16-62)||(33529046-33529092)
chr8 (10-59)||(22735445-22735494)
chr8 (19-59)||(31193911-31193951)
chr8 (1-60)||(39446305-39446365)
chr8 (17-59)||(21197734-21197776)
chr8 (1-59)||(22148061-22148118)
chr8 (1-62)||(22981916-22981977)
chr8 (5-62)||(23158804-23158861)
chr8 (1-62)||(23350796-23350857)
chr8 (1-61)||(20653573-20653633)
chr8 (19-59)||(23158779-23158819)
chr8 (26-62)||(37652020-37652056)
chr8 (31-62)||(19330924-19330955)
chr8 (16-59)||(23150401-23150444)
chr8 (16-59)||(23151428-23151471)
chr8 (16-59)||(33610634-33610677)
[»] chr3 (29 HSPs)
chr3 (1-62)||(11881757-11881818)
chr3 (1-62)||(19306428-19306489)
chr3 (1-61)||(16880761-16880821)
chr3 (4-59)||(15879020-15879075)
chr3 (1-59)||(3576000-3576058)
chr3 (1-58)||(12032164-12032221)
chr3 (1-62)||(34560476-34560537)
chr3 (1-62)||(17192191-17192252)
chr3 (1-61)||(11060547-11060607)
chr3 (1-61)||(12559780-12559840)
chr3 (9-61)||(40939774-40939826)
chr3 (1-60)||(17522429-17522488)
chr3 (10-62)||(47784306-47784360)
chr3 (10-55)||(15521587-15521632)
chr3 (1-62)||(17205321-17205382)
chr3 (13-62)||(39657171-39657220)
chr3 (13-61)||(14296084-14296132)
chr3 (13-61)||(14301711-14301759)
chr3 (1-60)||(23492993-23493051)
chr3 (1-60)||(30207864-30207923)
chr3 (1-59)||(14285598-14285655)
chr3 (9-59)||(17959888-17959938)
chr3 (1-39)||(48422220-48422258)
chr3 (10-59)||(14081114-14081163)
chr3 (1-61)||(14304691-14304751)
chr3 (31-62)||(6224682-6224713)
chr3 (16-59)||(11881800-11881843)
chr3 (27-62)||(18970541-18970576)
chr3 (20-59)||(39657146-39657185)
[»] chr2 (25 HSPs)
chr2 (1-62)||(2784-2845)
chr2 (1-62)||(2155367-2155428)
chr2 (1-62)||(24294061-24294122)
chr2 (1-61)||(22762831-22762890)
chr2 (1-60)||(19668676-19668735)
chr2 (10-59)||(723009-723058)
chr2 (1-62)||(24885286-24885347)
chr2 (10-62)||(22579411-22579463)
chr2 (9-59)||(25306056-25306106)
chr2 (1-60)||(24086993-24087053)
chr2 (27-62)||(7322164-7322199)
chr2 (17-59)||(2828-2870)
chr2 (17-59)||(7322139-7322181)
chr2 (1-59)||(16936193-16936250)
chr2 (1-59)||(17006853-17006910)
chr2 (10-60)||(19433387-19433437)
chr2 (1-59)||(22275368-22275425)
chr2 (1-59)||(23777630-23777687)
chr2 (1-62)||(23821345-23821406)
chr2 (1-62)||(23830424-23830485)
chr2 (5-55)||(24340962-24341012)
chr2 (1-59)||(25213679-25213736)
chr2 (10-59)||(68614-68662)
chr2 (20-59)||(23821392-23821431)
chr2 (20-59)||(23830471-23830510)
[»] chr1 (18 HSPs)
chr1 (1-62)||(17023625-17023686)
chr1 (1-62)||(17609549-17609610)
chr1 (1-62)||(19603755-19603816)
chr1 (1-62)||(16646559-16646620)
chr1 (1-59)||(27675421-27675479)
chr1 (1-59)||(51627232-51627290)
chr1 (1-62)||(16657286-16657347)
chr1 (1-62)||(37233394-37233455)
chr1 (1-62)||(41219401-41219462)
chr1 (1-59)||(20177801-20177859)
chr1 (10-59)||(22829000-22829049)
chr1 (14-62)||(36355843-36355891)
chr1 (20-59)||(16646534-16646573)
chr1 (1-62)||(20954979-20955040)
chr1 (1-62)||(22142902-22142962)
chr1 (26-62)||(8537514-8537550)
chr1 (26-62)||(8602753-8602789)
chr1 (31-62)||(21195623-21195654)
[»] scaffold0013 (1 HSPs)
scaffold0013 (1-59)||(36102-36160)
[»] scaffold1272 (2 HSPs)
scaffold1272 (5-62)||(929-986)
scaffold1272 (17-59)||(904-946)
[»] scaffold0032 (2 HSPs)
scaffold0032 (1-62)||(93390-93451)
scaffold0032 (1-61)||(104159-104219)
[»] chr6 (19 HSPs)
chr6 (1-62)||(18381351-18381412)
chr6 (1-59)||(14152936-14152994)
chr6 (1-62)||(21623819-21623880)
chr6 (1-62)||(22361303-22361364)
chr6 (1-62)||(14128786-14128847)
chr6 (1-62)||(17547220-17547281)
chr6 (1-62)||(18629147-18629208)
chr6 (4-59)||(16887361-16887417)
chr6 (1-62)||(27752064-27752125)
chr6 (1-61)||(18399586-18399646)
chr6 (18-62)||(25654744-25654788)
chr6 (16-59)||(18629190-18629233)
chr6 (1-60)||(25920234-25920293)
chr6 (1-59)||(16299571-16299628)
chr6 (13-62)||(25366797-25366846)
chr6 (6-58)||(17082745-17082797)
chr6 (16-59)||(21410631-21410674)
chr6 (16-59)||(22361346-22361389)
chr6 (20-59)||(25366832-25366871)
[»] chr5 (23 HSPs)
chr5 (1-62)||(21222175-21222236)
chr5 (1-60)||(3674512-3674571)
chr5 (1-62)||(24224913-24224974)
chr5 (1-62)||(32965279-32965340)
chr5 (1-62)||(28902839-28902900)
chr5 (1-62)||(28939234-28939295)
chr5 (16-62)||(37983985-37984031)
chr5 (1-61)||(23467081-23467141)
chr5 (7-62)||(22053408-22053463)
chr5 (15-56)||(21296753-21296794)
chr5 (16-62)||(5450421-5450467)
chr5 (1-59)||(7529537-7529594)
chr5 (1-59)||(16106279-16106336)
chr5 (1-59)||(16596124-16596182)
chr5 (1-59)||(18777575-18777632)
chr5 (5-62)||(18530641-18530698)
chr5 (9-60)||(7729069-7729121)
chr5 (16-56)||(23494544-23494584)
chr5 (31-62)||(6457223-6457254)
chr5 (1-60)||(7425940-7425997)
chr5 (1-28)||(25005496-25005523)
chr5 (31-62)||(29918688-29918719)
chr5 (1-56)||(34939903-34939957)
[»] scaffold0025 (2 HSPs)
scaffold0025 (1-62)||(53954-54015)
scaffold0025 (5-62)||(9482-9539)
[»] chr7 (22 HSPs)
chr7 (1-58)||(16920188-16920245)
chr7 (1-62)||(9081253-9081314)
chr7 (1-62)||(13390004-13390065)
chr7 (1-62)||(16914493-16914554)
chr7 (1-62)||(14268438-14268499)
chr7 (1-62)||(48357264-48357325)
chr7 (1-56)||(13378157-13378212)
chr7 (5-62)||(15709790-15709847)
chr7 (1-61)||(12247660-12247720)
chr7 (15-62)||(34240786-34240833)
chr7 (5-62)||(36024775-36024832)
chr7 (16-59)||(9611932-9611975)
chr7 (16-59)||(9839503-9839546)
chr7 (19-62)||(14268484-14268527)
chr7 (1-60)||(16569546-16569605)
chr7 (1-60)||(16596057-16596116)
chr7 (17-59)||(9081228-9081270)
chr7 (1-59)||(18253430-18253487)
chr7 (31-62)||(4485337-4485368)
chr7 (31-62)||(10332096-10332127)
chr7 (26-61)||(28722729-28722764)
chr7 (31-62)||(31501791-31501822)
[»] scaffold0700 (1 HSPs)
scaffold0700 (1-62)||(3146-3207)
[»] scaffold0483 (2 HSPs)
scaffold0483 (5-62)||(7312-7369)
scaffold0483 (17-60)||(7286-7329)
[»] scaffold0150 (1 HSPs)
scaffold0150 (1-62)||(29185-29246)
[»] scaffold0010 (2 HSPs)
scaffold0010 (1-62)||(31669-31730)
scaffold0010 (17-62)||(31641-31686)
[»] scaffold0327 (1 HSPs)
scaffold0327 (1-62)||(6316-6377)
[»] scaffold0138 (2 HSPs)
scaffold0138 (1-62)||(21967-22028)
scaffold0138 (20-59)||(22014-22053)
[»] scaffold0123 (2 HSPs)
scaffold0123 (9-62)||(11522-11575)
scaffold0123 (17-59)||(11497-11539)
[»] scaffold0016 (1 HSPs)
scaffold0016 (1-62)||(116095-116156)
[»] chr4 (19 HSPs)
chr4 (1-62)||(18277054-18277115)
chr4 (1-62)||(40885103-40885164)
chr4 (1-62)||(47534617-47534678)
chr4 (1-59)||(12244421-12244480)
chr4 (1-56)||(18493676-18493731)
chr4 (9-62)||(41165515-41165568)
chr4 (9-59)||(52265085-52265135)
chr4 (2-62)||(7850621-7850682)
chr4 (5-62)||(10103823-10103880)
chr4 (5-62)||(15674662-15674719)
chr4 (5-62)||(33241333-33241390)
chr4 (1-59)||(19021098-19021155)
chr4 (10-59)||(15045450-15045498)
chr4 (10-59)||(15108926-15108974)
chr4 (5-62)||(31132947-31133004)
chr4 (10-59)||(34177223-34177272)
chr4 (3-59)||(9795839-9795894)
chr4 (31-62)||(38765327-38765358)
chr4 (31-62)||(41255966-41255997)
[»] scaffold0554 (1 HSPs)
scaffold0554 (1-60)||(2563-2622)
[»] scaffold0021 (3 HSPs)
scaffold0021 (10-61)||(16547-16598)
scaffold0021 (10-61)||(26078-26129)
scaffold0021 (1-61)||(12700-12760)
[»] scaffold0643 (1 HSPs)
scaffold0643 (1-55)||(139-193)
[»] scaffold0058 (1 HSPs)
scaffold0058 (1-59)||(69875-69933)
[»] scaffold0151 (1 HSPs)
scaffold0151 (1-62)||(21954-22015)
[»] scaffold0006 (1 HSPs)
scaffold0006 (1-62)||(196818-196878)
[»] scaffold0031 (1 HSPs)
scaffold0031 (1-61)||(71260-71320)
[»] scaffold0103 (1 HSPs)
scaffold0103 (1-60)||(34302-34361)
[»] scaffold0014 (1 HSPs)
scaffold0014 (1-60)||(159947-160006)
[»] scaffold0022 (2 HSPs)
scaffold0022 (13-59)||(102525-102571)
scaffold0022 (31-62)||(132433-132464)
[»] scaffold1295 (2 HSPs)
scaffold1295 (1-62)||(751-812)
scaffold1295 (20-59)||(726-765)
[»] scaffold0610 (1 HSPs)
scaffold0610 (1-62)||(132-193)
[»] scaffold0507 (1 HSPs)
scaffold0507 (1-62)||(1078-1139)
[»] scaffold0120 (1 HSPs)
scaffold0120 (5-42)||(27566-27603)
[»] scaffold0095 (1 HSPs)
scaffold0095 (1-60)||(33267-33327)
[»] scaffold0480 (1 HSPs)
scaffold0480 (1-56)||(8450-8505)
[»] scaffold0409 (2 HSPs)
scaffold0409 (11-58)||(925-972)
scaffold0409 (11-58)||(9180-9227)
[»] scaffold0162 (1 HSPs)
scaffold0162 (19-62)||(6607-6650)
[»] scaffold0118 (1 HSPs)
scaffold0118 (1-56)||(34018-34072)
[»] scaffold0682 (1 HSPs)
scaffold0682 (1-59)||(8127-8184)
[»] scaffold0387 (1 HSPs)
scaffold0387 (1-59)||(6765-6822)
[»] scaffold0207 (1 HSPs)
scaffold0207 (1-59)||(11312-11369)
[»] scaffold0173 (1 HSPs)
scaffold0173 (1-59)||(5846-5903)
[»] scaffold0125 (1 HSPs)
scaffold0125 (1-59)||(43556-43613)
[»] scaffold0075 (1 HSPs)
scaffold0075 (1-59)||(34041-34098)
[»] scaffold0001 (1 HSPs)
scaffold0001 (1-59)||(164563-164620)
[»] scaffold0004 (1 HSPs)
scaffold0004 (1-62)||(28117-28178)
[»] scaffold1932 (2 HSPs)
scaffold1932 (6-62)||(944-1000)
scaffold1932 (16-59)||(982-1025)
[»] scaffold0521 (1 HSPs)
scaffold0521 (1-61)||(11743-11803)
[»] scaffold0389 (1 HSPs)
scaffold0389 (20-59)||(11282-11321)
[»] scaffold0357 (1 HSPs)
scaffold0357 (31-62)||(7034-7065)
[»] scaffold0342 (1 HSPs)
scaffold0342 (1-60)||(12916-12975)
[»] scaffold0338 (1 HSPs)
scaffold0338 (1-60)||(9634-9693)
[»] scaffold0080 (1 HSPs)
scaffold0080 (31-62)||(23282-23313)

Alignment Details
Target: chr8 (Bit Score: 58; Significance: 3e-25; HSPs: 27)
Name: chr8

Target: chr8; HSP #1
Raw Score: 58; E-Value: 3e-25
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 21197690 - 21197751
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
21197690 ttactagtgtagtaattagtattttaccgataagtgaccgttgctagtattttaccgttaag 21197751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 54; E-Value: 8e-23
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 23837909 - 23837848
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||    
23837909 ttactagtgtagtaattagtattttaccgttaagtgaccgttgttaatattttaccgttaag 23837848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 50; E-Value: 2e-20
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 21191144 - 21191201
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgt 58  Q
    |||||||||||||||||||||||||| || ||||||||||||||||||||||||||||    
21191144 ttactagtgtagtaattagtattttaacgataagtgaccgttgctagtattttaccgt 21191201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 47; E-Value: 1e-18
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 17285915 - 17285857
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    ||||||| ||| |||||||||||||||| ||||||||||||||||||||||||||||||    
17285915 ttactagggtaataattagtattttaccattaagtgaccgttgctagtattttaccgtt 17285857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 42; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 23151385 - 23151446
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||| |||||||||||||||||||||| |||||||| ||||| |||||||| |||||||||    
23151385 ttactggtgtagtaattagtattttaccattaagtgatcgttgttagtatttcaccgttaag 23151446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 42; E-Value: 0.000000000000001
Query Start/End: Original strand, 5 - 58
Target Start/End: Complemental strand, 26012168 - 26012115
5 tagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgt 58  Q
    |||||| || ||||||||||||||||||||||||||||| ||||||||||||||    
26012168 tagtgtggttattagtattttaccgttaagtgaccgttgttagtattttaccgt 26012115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 42; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 29307127 - 29307066
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    |||||||||| |||||||||||||||| ||||||||||||||| | |||||| |||||||||    
29307127 ttactagtgtggtaattagtattttactgttaagtgaccgttgttggtatttaaccgttaag 29307066  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 42; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 38534358 - 38534297
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||| ||||| |||||||||||||||||||||||| |||| ||||||||||| ||||||    
38534358 ttactagagtagtgattagtattttaccgttaagtgacagttggtagtattttactgttaag 38534297  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 40; E-Value: 0.00000000000002
Query Start/End: Original strand, 15 - 62
Target Start/End: Complemental strand, 5855279 - 5855232
15 attagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||||||||||| ||||||| ||||||||||||||||||    
5855279 attagtattttaccgttaagtaaccgttgttagtattttaccgttaag 5855232  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 39; E-Value: 0.00000000000007
Query Start/End: Original strand, 16 - 62
Target Start/End: Complemental strand, 15933964 - 15933918
16 ttagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||||||| |||||||||| ||||||||||||||||||    
15933964 ttagtattttaccgttacgtgaccgttgttagtattttaccgttaag 15933918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 38; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 33610591 - 33610652
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||||||||||  |  |||||||||| ||||||| ||||||||||||||||||    
33610591 ttactagtgtagtaattagttgtgaaccgttaagtaaccgttgttagtattttaccgttaag 33610652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 35; E-Value: 0.00000000002
Query Start/End: Original strand, 16 - 62
Target Start/End: Complemental strand, 33529092 - 33529046
16 ttagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    |||||||||||||||||||||| ||||  ||||||||||||||||||    
33529092 ttagtattttaccgttaagtgatcgttattagtattttaccgttaag 33529046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 34; E-Value: 0.00000000007
Query Start/End: Original strand, 10 - 59
Target Start/End: Original strand, 22735445 - 22735494
10 tagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    |||| ||||| ||||||||||||||||||||||| |||| ||||||||||    
22735445 tagttattagaattttaccgttaagtgaccgttgttagtgttttaccgtt 22735494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 33; E-Value: 0.0000000003
Query Start/End: Original strand, 19 - 59
Target Start/End: Original strand, 31193911 - 31193951
19 gtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    ||||||||||||||||||||||||  |||||||||||||||    
31193911 gtattttaccgttaagtgaccgttagtagtattttaccgtt 31193951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 33; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 60
Target Start/End: Original strand, 39446305 - 39446365
1 ttactagtgtagtaattagtattttaccg-ttaagtgaccgttgctagtattttaccgtta 60  Q
    ||||||| ||||||||||||||||||||| || ||||||||||| |  |||||||||||||    
39446305 ttactagagtagtaattagtattttaccgttttagtgaccgttggtgatattttaccgtta 39446365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 31; E-Value: 0.000000004
Query Start/End: Original strand, 17 - 59
Target Start/End: Original strand, 21197734 - 21197776
17 tagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    |||||||||||||||||||||| |||  |||||||||||||||    
21197734 tagtattttaccgttaagtgactgttaatagtattttaccgtt 21197776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 31; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 22148118 - 22148061
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    ||||||||||||| |||||| |||||||||| ||||||||||| |  ||||||||||||    
22148118 ttactagtgtagtgattagt-ttttaccgtttagtgaccgttggttatattttaccgtt 22148061  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 30; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 22981977 - 22981916
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||| || ||||||||| ||||||||||| |||||||||| |  |||||||||| ||||    
22981977 ttactagagtggtaattagtgttttaccgttacgtgaccgttgttgatattttaccgataag 22981916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 30; E-Value: 0.00000002
Query Start/End: Original strand, 5 - 62
Target Start/End: Complemental strand, 23158861 - 23158804
5 tagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    |||||| |||||||||| |  ||||||||||||| |||| | ||||||||||||||||    
23158861 tagtgtggtaattagtagtgaaccgttaagtgacagttgttggtattttaccgttaag 23158804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 30; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 23350857 - 23350796
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    |||||||| |||||||||||     ||||||||||||| |||| ||||||||||||||||||    
23350857 ttactagtatagtaattagttgagaaccgttaagtgactgttgttagtattttaccgttaag 23350796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 29; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 20653573 - 20653633
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaa 61  Q
    ||||||| ||| ||||||||||||||||||| |||||| |||| |  ||||||| ||||||    
20653573 ttactagagtaataattagtattttaccgtttagtgactgttggtgatattttatcgttaa 20653633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 29; E-Value: 0.00000007
Query Start/End: Original strand, 19 - 59
Target Start/End: Complemental strand, 23158819 - 23158779
19 gtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    ||||||||||||||||||| ||||  |||||||||||||||    
23158819 gtattttaccgttaagtgaacgttattagtattttaccgtt 23158779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 29; E-Value: 0.00000007
Query Start/End: Original strand, 26 - 62
Target Start/End: Original strand, 37652020 - 37652056
26 accgttaagtgaccgttgctagtattttaccgttaag 62  Q
    |||| ||||||||||||| ||||||||||||||||||    
37652020 accggtaagtgaccgttgttagtattttaccgttaag 37652056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 31 - 62
Target Start/End: Original strand, 19330924 - 19330955
31 taagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||| ||||||||||||||||||    
19330924 taagtgaccgttgttagtattttaccgttaag 19330955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 16 - 59
Target Start/End: Complemental strand, 23150444 - 23150401
16 ttagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    |||||||||||||||||||||| ||||  | |||||||||||||    
23150444 ttagtattttaccgttaagtgaacgttatttgtattttaccgtt 23150401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 16 - 59
Target Start/End: Original strand, 23151428 - 23151471
16 ttagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    ||||||||| |||||||||||| ||||  |||||||||||||||    
23151428 ttagtatttcaccgttaagtgatcgttattagtattttaccgtt 23151471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #27
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 16 - 59
Target Start/End: Original strand, 33610634 - 33610677
16 ttagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    ||||||||||||||||||||||  |||  |||||||||||||||    
33610634 ttagtattttaccgttaagtgatagttattagtattttaccgtt 33610677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 58; Significance: 3e-25; HSPs: 29)
Name: chr3

Target: chr3; HSP #1
Raw Score: 58; E-Value: 3e-25
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 11881757 - 11881818
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
11881757 ttactagtgtagtaattagtattttaccgttaagtgaccgttgttagtattttaccgttaag 11881818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 54; E-Value: 8e-23
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 19306489 - 19306428
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||    
19306489 ttactagtgtagtaattagtattttaccgttaagtgaccgttattagtattttaccgttaag 19306428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 49; E-Value: 8e-20
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 16880821 - 16880761
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaa 61  Q
    ||||||| |||||||| |||||||||||||||||||||||||| |||||||||||||||||    
16880821 ttactagagtagtaatcagtattttaccgttaagtgaccgttggtagtattttaccgttaa 16880761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 48; E-Value: 3e-19
Query Start/End: Original strand, 4 - 59
Target Start/End: Complemental strand, 15879075 - 15879020
4 ctagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    |||| ||||||||||||||||||||||||||||||| |||||||||||||||||||    
15879075 ctagggtagtaattagtattttaccgttaagtgaccattgctagtattttaccgtt 15879020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 47; E-Value: 1e-18
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 3576000 - 3576058
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    |||||||||| |||||||||||||||| ||||||||||||||| |||||||||||||||    
3576000 ttactagtgttgtaattagtattttacggttaagtgaccgttgttagtattttaccgtt 3576058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 46; E-Value: 5e-18
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 12032221 - 12032164
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgt 58  Q
    ||||||| |||||||||||||||||||||||||||||| |||| ||||||||||||||    
12032221 ttactagagtagtaattagtattttaccgttaagtgactgttgttagtattttaccgt 12032164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 46; E-Value: 5e-18
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 34560537 - 34560476
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    |||||||||||||  |||||||||||||||||||||||| ||| ||||||||||||||||||    
34560537 ttactagtgtagttgttagtattttaccgttaagtgaccattgttagtattttaccgttaag 34560476  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 42; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 17192252 - 17192191
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||| |||||||||| |||||||||||||||| ||||||| | ||||||||||||||||    
17192252 ttactagggtagtaattaatattttaccgttaagtaaccgttgttggtattttaccgttaag 17192191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 37; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 11060547 - 11060607
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaa 61  Q
    ||||||| |||||||||| |||||||||||| ||||||||||| ||  |||||||||||||    
11060547 ttactagagtagtaattaatattttaccgtttagtgaccgttggtaaaattttaccgttaa 11060607  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 37; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 12559780 - 12559840
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaa 61  Q
    ||||||| ||||||||| |||||||| |||||||||||||||| ||| |||||||| ||||    
12559780 ttactagagtagtaattggtattttatcgttaagtgaccgttggtagaattttaccattaa 12559840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 37; E-Value: 0.000000000001
Query Start/End: Original strand, 9 - 61
Target Start/End: Complemental strand, 40939826 - 40939774
9 gtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaa 61  Q
    ||||| ||||||||| ||||||| ||||||||||| |||||||||||||||||    
40939826 gtagtgattagtattataccgtttagtgaccgttggtagtattttaccgttaa 40939774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 36; E-Value: 0.000000000004
Query Start/End: Original strand, 1 - 60
Target Start/End: Original strand, 17522429 - 17522488
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtta 60  Q
    |||||||  ||| ||||| |||||||||||||||||||||||| ||| ||||||||||||    
17522429 ttactaggttagaaattaatattttaccgttaagtgaccgttggtagaattttaccgtta 17522488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 36; E-Value: 0.000000000004
Query Start/End: Original strand, 10 - 62
Target Start/End: Original strand, 47784306 - 47784360
10 tagtaattagtattttaccgttaagtgaccgttgctag--tattttaccgttaag 62  Q
    ||||||||||||||||||||||||||||| |||| |||  |||||||||||||||    
47784306 tagtaattagtattttaccgttaagtgactgttggtagtatattttaccgttaag 47784360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 34; E-Value: 0.00000000007
Query Start/End: Original strand, 10 - 55
Target Start/End: Complemental strand, 15521632 - 15521587
10 tagtaattagtattttaccgttaagtgaccgttgctagtattttac 55  Q
    |||| ||||||||||||||||||||||||||||| |||| ||||||    
15521632 tagttattagtattttaccgttaagtgaccgttgttagtgttttac 15521587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 34; E-Value: 0.00000000007
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 17205382 - 17205321
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||| |||||||||| ||||||||| |||||||| | ||| | ||||||||||||||||    
17205382 ttactagggtagtaattaatattttaccattaagtgatcattgttggtattttaccgttaag 17205321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 34; E-Value: 0.00000000007
Query Start/End: Original strand, 13 - 62
Target Start/End: Complemental strand, 39657220 - 39657171
13 taattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    |||||||||||||||||||| |||||||||| |  |||||||||||||||    
39657220 taattagtattttaccgttatgtgaccgttgttgatattttaccgttaag 39657171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 33; E-Value: 0.0000000003
Query Start/End: Original strand, 13 - 61
Target Start/End: Complemental strand, 14296132 - 14296084
13 taattagtattttaccgttaagtgaccgttgctagtattttaccgttaa 61  Q
    |||||| |||||||||||| ||| ||||||| |||||||||||||||||    
14296132 taattaatattttaccgtttagttaccgttggtagtattttaccgttaa 14296084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 33; E-Value: 0.0000000003
Query Start/End: Original strand, 13 - 61
Target Start/End: Complemental strand, 14301759 - 14301711
13 taattagtattttaccgttaagtgaccgttgctagtattttaccgttaa 61  Q
    |||||| |||||||||||| ||| ||||||| |||||||||||||||||    
14301759 taattaatattttaccgtttagttaccgttggtagtattttaccgttaa 14301711  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 32; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 60
Target Start/End: Complemental strand, 23493051 - 23492993
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtta 60  Q
    ||||||||||||| |||||| |||||||||| ||||||||||| |  |||||||||||||    
23493051 ttactagtgtagtgattagt-ttttaccgtttagtgaccgttggttatattttaccgtta 23492993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 32; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 60
Target Start/End: Complemental strand, 30207923 - 30207864
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtta 60  Q
    ||||||| ||||| |||| |||||||||||||||||||| ||| |  |||||||||||||    
30207923 ttactagggtagtcattaatattttaccgttaagtgaccattgttgatattttaccgtta 30207864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 31; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 14285655 - 14285598
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    |||| ||||||||||||||| |||||||||| ||||||||||| |  ||||||||||||    
14285655 ttaccagtgtagtaattagt-ttttaccgtttagtgaccgttggttatattttaccgtt 14285598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 31; E-Value: 0.000000004
Query Start/End: Original strand, 9 - 59
Target Start/End: Original strand, 17959888 - 17959938
9 gtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    ||||||||||||||||||| ||||||| ||||||  ||| |||||||||||    
17959888 gtagtaattagtattttacagttaagtaaccgttagtagcattttaccgtt 17959938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 31; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 48422258 - 48422220
1 ttactagtgtagtaattagtattttaccgttaagtgacc 39  Q
    ||||||| |||||||||| ||||||||||||||||||||    
48422258 ttactagggtagtaattaatattttaccgttaagtgacc 48422220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 30; E-Value: 0.00000002
Query Start/End: Original strand, 10 - 59
Target Start/End: Complemental strand, 14081163 - 14081114
10 tagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    |||| ||||| ||||||| ||||||||||||||  |||||||||||||||    
14081163 tagttattagaattttactgttaagtgaccgttaatagtattttaccgtt 14081114  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 29; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 14304751 - 14304691
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaa 61  Q
    ||||||| ||| ||||||||||||||||||| |||||| |||| |  ||||||| ||||||    
14304751 ttactagagtaataattagtattttaccgtttagtgactgttggtgatattttatcgttaa 14304691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 31 - 62
Target Start/End: Original strand, 6224682 - 6224713
31 taagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||| ||||||||||||||||||    
6224682 taagtgaccgttgttagtattttaccgttaag 6224713  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 16 - 59
Target Start/End: Original strand, 11881800 - 11881843
16 ttagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    ||||||||||||||||||||| |||||  ||||| |||||||||    
11881800 ttagtattttaccgttaagtggccgttattagtaatttaccgtt 11881843  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 62
Target Start/End: Complemental strand, 18970576 - 18970541
27 ccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||| ||||||| ||||||||||||||||||    
18970576 ccgttaagtcaccgttgttagtattttaccgttaag 18970541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 20 - 59
Target Start/End: Complemental strand, 39657185 - 39657146
20 tattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    |||||||||||||||||||||||  ||||| |||||||||    
39657185 tattttaccgttaagtgaccgttattagtaatttaccgtt 39657146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 58; Significance: 3e-25; HSPs: 25)
Name: chr2

Target: chr2; HSP #1
Raw Score: 58; E-Value: 3e-25
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 2784 - 2845
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
2784 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtgttttaccgttaag 2845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 58; E-Value: 3e-25
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 2155367 - 2155428
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
2155367 ttactagtgtagtaattagtattttaccgataagtgaccgttgctagtattttaccgttaag 2155428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 42; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 24294061 - 24294122
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||| ||||||||||||||||||||||||||| || ||||||||| ||||||| |||||    
24294061 ttactagggtagtaattagtattttaccgttaagtaactgttgctagtgttttaccattaag 24294122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 41; E-Value: 0.000000000000004
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 22762831 - 22762890
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaa 61  Q
    ||||||| |||||||||| ||||| |||||||||||||||||| |||||||||||||||||    
22762831 ttactagagtagtaattaatattt-accgttaagtgaccgttggtagtattttaccgttaa 22762890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 40; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 60
Target Start/End: Original strand, 19668676 - 19668735
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtta 60  Q
    |||||||  |||||||||||||||||||||||||||||||||  ||||||||||| ||||    
19668676 ttactagaatagtaattagtattttaccgttaagtgaccgttaatagtattttactgtta 19668735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 38; E-Value: 0.0000000000003
Query Start/End: Original strand, 10 - 59
Target Start/End: Complemental strand, 723058 - 723009
10 tagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    |||| ||||||||||||||||||||||||||||| |||| ||||||||||    
723058 tagttattagtattttaccgttaagtgaccgttgttagtgttttaccgtt 723009  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 38; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 24885347 - 24885286
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||||||||||  |  |||||||||||||||||| ||||||||||| ||||||    
24885347 ttactagtgtagtaattagttgtgaaccgttaagtgaccgttgttagtattttactgttaag 24885286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 37; E-Value: 0.000000000001
Query Start/End: Original strand, 10 - 62
Target Start/End: Original strand, 22579411 - 22579463
10 tagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    |||||||| |||||||||||||| |||||||||| ||| ||||||||||||||    
22579411 tagtaatttgtattttaccgttaggtgaccgttggtagaattttaccgttaag 22579463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 35; E-Value: 0.00000000002
Query Start/End: Original strand, 9 - 59
Target Start/End: Complemental strand, 25306106 - 25306056
9 gtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    |||||||||||||||||||||||||||||  |||  |||||||||||||||    
25306106 gtagtaattagtattttaccgttaagtgattgttaatagtattttaccgtt 25306056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 33; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 60
Target Start/End: Original strand, 24086993 - 24087053
1 ttactagtgtagtaattagtattttaccg-ttaagtgaccgttgctagtattttaccgtta 60  Q
    ||||||| |||||||||| |||||||||| |||||||||||||| |  |||||||||||||    
24086993 ttactagagtagtaattaatattttaccgtttaagtgaccgttggtgatattttaccgtta 24087053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 32; E-Value: 0.000000001
Query Start/End: Original strand, 27 - 62
Target Start/End: Complemental strand, 7322199 - 7322164
27 ccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||||||| ||||||||||||||||||    
7322199 ccgttaagtgaccgttgatagtattttaccgttaag 7322164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 31; E-Value: 0.000000004
Query Start/End: Original strand, 17 - 59
Target Start/End: Original strand, 2828 - 2870
17 tagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    |||| |||||||||||||||||||||  |||||||||||||||    
2828 tagtgttttaccgttaagtgaccgttaatagtattttaccgtt 2870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 31; E-Value: 0.000000004
Query Start/End: Original strand, 17 - 59
Target Start/End: Complemental strand, 7322181 - 7322139
17 tagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    ||||||||||||||||||||||||||  |||||||||| ||||    
7322181 tagtattttaccgttaagtgaccgttagtagtattttatcgtt 7322139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 31; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 16936250 - 16936193
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    ||||||||||||| |||||| |||||||||| ||||||||||| |  ||||||||||||    
16936250 ttactagtgtagtgattagt-ttttaccgtttagtgaccgttggttatattttaccgtt 16936193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 31; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 17006910 - 17006853
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    ||||||||||||| |||||| |||||||||| ||||||||||| |  ||||||||||||    
17006910 ttactagtgtagtgattagt-ttttaccgtttagtgaccgttggttatattttaccgtt 17006853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 31; E-Value: 0.000000004
Query Start/End: Original strand, 10 - 60
Target Start/End: Original strand, 19433387 - 19433437
10 tagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtta 60  Q
    |||| |||||| |||||| ||||||||||||||| |||| |||||||||||    
19433387 tagttattagtgttttactgttaagtgaccgttgttagtgttttaccgtta 19433437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 31; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 22275425 - 22275368
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    |||||||||||||||||| | |||||||||| ||||||||||| |  ||||||||||||    
22275425 ttactagtgtagtaattaat-ttttaccgtttagtgaccgttggttatattttaccgtt 22275368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 31; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 23777630 - 23777687
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    ||||||||||||| |||||| |||||||||| ||||||||||| |  ||||||||||||    
23777630 ttactagtgtagtgattagt-ttttaccgtttagtgaccgttggttatattttaccgtt 23777687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 31; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 23821345 - 23821406
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctag-tattttaccgttaag 62  Q
    ||||||| ||| |||||||||||||||||||| ||||| |||| ||| |||||||||||||||    
23821345 ttactagggtaataattagtattttaccgttatgtgactgttg-tagatattttaccgttaag 23821406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 31; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 23830424 - 23830485
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctag-tattttaccgttaag 62  Q
    ||||||| ||| |||||||||||||||||||| ||||| |||| ||| |||||||||||||||    
23830424 ttactagggtaataattagtattttaccgttatgtgactgttg-tagatattttaccgttaag 23830485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 31; E-Value: 0.000000004
Query Start/End: Original strand, 5 - 55
Target Start/End: Original strand, 24340962 - 24341012
5 tagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttac 55  Q
    ||||||||||||||||||||||||||| |||||| |||  |||| ||||||    
24340962 tagtgtagtaattagtattttaccgtttagtgactgttaatagtgttttac 24341012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 31; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 25213736 - 25213679
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    ||||||||||||| |||||| |||||||||| ||||||||||| |  ||||||||||||    
25213736 ttactagtgtagtgattagt-ttttaccgtttagtgaccgttggttatattttaccgtt 25213679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 30; E-Value: 0.00000002
Query Start/End: Original strand, 10 - 59
Target Start/End: Complemental strand, 68662 - 68614
10 tagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    |||| ||||| ||||||||||||||||||||||| |||| ||||||||||    
68662 tagttattagaattttaccgttaagtgaccgttg-tagtgttttaccgtt 68614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 20 - 59
Target Start/End: Original strand, 23821392 - 23821431
20 tattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    |||||||||||||||||||||||  ||||| |||||||||    
23821392 tattttaccgttaagtgaccgttattagtaatttaccgtt 23821431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 20 - 59
Target Start/End: Original strand, 23830471 - 23830510
20 tattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    |||||||||||||||||||||||  ||||| |||||||||    
23830471 tattttaccgttaagtgaccgttattagtaatttaccgtt 23830510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 58; Significance: 3e-25; HSPs: 18)
Name: chr1

Target: chr1; HSP #1
Raw Score: 58; E-Value: 3e-25
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 17023686 - 17023625
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
17023686 ttactagtgtagtaattagtattttaccgttaagtgaccgttgttagtattttaccgttaag 17023625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 54; E-Value: 8e-23
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 17609610 - 17609549
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    |||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||    
17609610 ttactagtgtggtaattagtattttaccgttaagtgaccgttgttagtattttaccgttaag 17609549  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 54; E-Value: 8e-23
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 19603816 - 19603755
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||    
19603816 ttactagtgtagtaattaatattttaccgttaagtgaccgttgctagtattctaccgttaag 19603755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 50; E-Value: 2e-20
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 16646620 - 16646559
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||| ||||||||||||||||||||||||||||||||||| || |||||||||||||||    
16646620 ttactagggtagtaattagtattttaccgttaagtgaccgttggtaatattttaccgttaag 16646559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 47; E-Value: 1e-18
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 27675479 - 27675421
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    ||||||||||||||||||||||||||||||||||||| ||||  |||||||||||||||    
27675479 ttactagtgtagtaattagtattttaccgttaagtgatcgttaatagtattttaccgtt 27675421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 43; E-Value: 3e-16
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 51627232 - 51627290
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    ||||||| ||||||||||||||||||||||||||||||||||  ||||| |||||||||    
51627232 ttactagagtagtaattagtattttaccgttaagtgaccgttattagtaatttaccgtt 51627290  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 42; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 16657347 - 16657286
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||| |||||||||| || ||||||||||||||||||||| |||||||||||| |||||    
16657347 ttactagagtagtaattaatagtttaccgttaagtgaccgttggtagtattttaccattaag 16657286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 42; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 37233394 - 37233455
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    |||||||||| || |||||||||||||||||||||||| |||| | ||||||||||||||||    
37233394 ttactagtgtggttattagtattttaccgttaagtgactgttgttggtattttaccgttaag 37233455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 42; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 41219401 - 41219462
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||||||||||||||||| | || |||| |||||||||||||||||| |||||    
41219401 ttactagtgtagtaattagtattttactgataggtgatcgttgctagtattttaccattaag 41219462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 39; E-Value: 0.00000000000007
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 20177859 - 20177801
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    ||||||||||||||||||||||||||||||||||||| | ||  || ||||||||||||    
20177859 ttactagtgtagtaattagtattttaccgttaagtgatcattaataatattttaccgtt 20177801  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 38; E-Value: 0.0000000000003
Query Start/End: Original strand, 10 - 59
Target Start/End: Original strand, 22829000 - 22829049
10 tagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    |||| ||||||||||||||||||||||||||||| |||| ||||||||||    
22829000 tagttattagtattttaccgttaagtgaccgttgttagtgttttaccgtt 22829049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 33; E-Value: 0.0000000003
Query Start/End: Original strand, 14 - 62
Target Start/End: Original strand, 36355843 - 36355891
14 aattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||||| ||| |||||||| | ||||||||||||||||||    
36355843 aattagtattttaccattatgtgaccgtcggtagtattttaccgttaag 36355891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 32; E-Value: 0.000000001
Query Start/End: Original strand, 20 - 59
Target Start/End: Complemental strand, 16646573 - 16646534
20 tattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    |||||||||||||||||||||||  |||||||||||||||    
16646573 tattttaccgttaagtgaccgttaatagtattttaccgtt 16646534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 30; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 20954979 - 20955040
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||| |||||  | |||||||||||||||| ||||||||| || ||||||| |||||||    
20954979 ttactagggtagtggtcagtattttaccgttaaatgaccgttgttaatattttatcgttaag 20955040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 30; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 22142902 - 22142962
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    |||||||||| |||||||||| |  ||| |||||||||||||| ||||||||| ||||||||    
22142902 ttactagtgtggtaattagtagtgaaccattaagtgaccgttgttagtatttt-ccgttaag 22142962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 29; E-Value: 0.00000007
Query Start/End: Original strand, 26 - 62
Target Start/End: Original strand, 8537514 - 8537550
26 accgttaagtgaccgttgctagtattttaccgttaag 62  Q
    |||| ||||||||||||| ||||||||||||||||||    
8537514 accggtaagtgaccgttgttagtattttaccgttaag 8537550  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 29; E-Value: 0.00000007
Query Start/End: Original strand, 26 - 62
Target Start/End: Original strand, 8602753 - 8602789
26 accgttaagtgaccgttgctagtattttaccgttaag 62  Q
    |||| ||||||||||||| ||||||||||||||||||    
8602753 accggtaagtgaccgttgttagtattttaccgttaag 8602789  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 31 - 62
Target Start/End: Complemental strand, 21195654 - 21195623
31 taagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||| ||||||||||||||||||    
21195654 taagtgaccgttgttagtattttaccgttaag 21195623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0013 (Bit Score: 55; Significance: 2e-23; HSPs: 1)
Name: scaffold0013

Target: scaffold0013; HSP #1
Raw Score: 55; E-Value: 2e-23
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 36160 - 36102
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
36160 ttactagtgtagtaattagtattttaccgttaagtgaccgttgttagtattttaccgtt 36102  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1272 (Bit Score: 54; Significance: 8e-23; HSPs: 2)
Name: scaffold1272

Target: scaffold1272; HSP #1
Raw Score: 54; E-Value: 8e-23
Query Start/End: Original strand, 5 - 62
Target Start/End: Complemental strand, 986 - 929
5 tagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
986 tagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttatcgttaag 929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1272; HSP #2
Raw Score: 31; E-Value: 0.000000004
Query Start/End: Original strand, 17 - 59
Target Start/End: Complemental strand, 946 - 904
17 tagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    |||||||||| |||||||||||||||  |||||||||||||||    
946 tagtattttatcgttaagtgaccgttaatagtattttaccgtt 904  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0032 (Bit Score: 54; Significance: 8e-23; HSPs: 2)
Name: scaffold0032

Target: scaffold0032; HSP #1
Raw Score: 54; E-Value: 8e-23
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 93390 - 93451
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
93390 ttactagagtagtaattagtattttaccgttaagtgaccgttggtagtattttaccgttaag 93451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0032; HSP #2
Raw Score: 33; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 104159 - 104219
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaa 61  Q
    |||||||  |||||||||||  |  |||||||||||||||||| |||||||||||||||||    
104159 ttactagcatagtaattagtggtgaaccgttaagtgaccgttgttagtattttaccgttaa 104219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 54; Significance: 8e-23; HSPs: 19)
Name: chr6

Target: chr6; HSP #1
Raw Score: 54; E-Value: 8e-23
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 18381351 - 18381412
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||    
18381351 ttactagtgtagtaattagtattttaccgataagtgatcgttgctagtattttaccgttaag 18381412  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 51; E-Value: 5e-21
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 14152994 - 14152936
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    ||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||    
14152994 ttactagtgtagtaattagtattttaccgttaagtgaccgttattagtattttaccgtt 14152936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 50; E-Value: 2e-20
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 21623880 - 21623819
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||| ||||    
21623880 ttactagggtagtaattagtattttaccgttaagtgaccgttgttagtattttaccgctaag 21623819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 50; E-Value: 2e-20
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 22361303 - 22361364
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||| |||||||||| |||||||||||||||||||||||| ||||||||||||||||||    
22361303 ttactagggtagtaattaatattttaccgttaagtgaccgttgttagtattttaccgttaag 22361364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 46; E-Value: 5e-18
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 14128847 - 14128786
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||||||| |||||||||||||||||| |||||  ||||||||||||||||||    
14128847 ttactagtgtagtaattggtattttaccgttaagtggccgttattagtattttaccgttaag 14128786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 46; E-Value: 5e-18
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 17547220 - 17547281
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    |||||||||||||||||||||||||||| |||||| | ||||| ||||||||||||||||||    
17547220 ttactagtgtagtaattagtattttacctttaagtaatcgttgttagtattttaccgttaag 17547281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 42; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 18629147 - 18629208
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||||||||||  | ||||||||| ||||||||| ||||||||||||||||||    
18629147 ttactagtgtagtaattagttgtgtaccgttaaatgaccgttgttagtattttaccgttaag 18629208  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 37; E-Value: 0.000000000001
Query Start/End: Original strand, 4 - 59
Target Start/End: Original strand, 16887361 - 16887417
4 ctagtgtagtaattagtattttaccgttaagtgaccgttg-ctagtattttaccgtt 59  Q
    |||| |||||||||||||||||||||||||||||||||||  ||| |||||||||||    
16887361 ctagagtagtaattagtattttaccgttaagtgaccgttgtatagcattttaccgtt 16887417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 34; E-Value: 0.00000000007
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 27752125 - 27752064
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||| ||| ||||||||||||||||||||| ||||||||  |||| |||||||| ||||    
27752125 ttactagagtaataattagtattttaccgttaattgaccgttagtagtgttttaccgctaag 27752064  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 33; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 18399646 - 18399586
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaa 61  Q
    ||||||| ||| ||||||||||||||||||| ||||||| ||| |  ||||||||||||||    
18399646 ttactagagtaataattagtattttaccgtttagtgaccattggtgatattttaccgttaa 18399586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 33; E-Value: 0.0000000003
Query Start/End: Original strand, 18 - 62
Target Start/End: Complemental strand, 25654788 - 25654744
18 agtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    |||||||||||||||||||| ||||  ||||||||||||||||||    
25654788 agtattttaccgttaagtgatcgttattagtattttaccgttaag 25654744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 32; E-Value: 0.000000001
Query Start/End: Original strand, 16 - 59
Target Start/End: Original strand, 18629190 - 18629233
16 ttagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    |||||||||||||||||||||| ||||  |||||||||||||||    
18629190 ttagtattttaccgttaagtgatcgttattagtattttaccgtt 18629233  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 32; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 60
Target Start/End: Complemental strand, 25920293 - 25920234
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtta 60  Q
    |||||||  |||||||||||||||||||||| ||||||||||  ||||| |||| |||||    
25920293 ttactaggatagtaattagtattttaccgtttagtgaccgttattagtaatttatcgtta 25920234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 31; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 16299571 - 16299628
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    ||||||||||||| |||||| |||||||||| ||||||||||| |  ||||||||||||    
16299571 ttactagtgtagtgattagt-ttttaccgtttagtgaccgttggttatattttaccgtt 16299628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 30; E-Value: 0.00000002
Query Start/End: Original strand, 13 - 62
Target Start/End: Original strand, 25366797 - 25366846
13 taattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    |||||||||||||||||||| ||||||| || |  |||||||||||||||    
25366797 taattagtattttaccgttatgtgaccgatgttgatattttaccgttaag 25366846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 29; E-Value: 0.00000007
Query Start/End: Original strand, 6 - 58
Target Start/End: Original strand, 17082745 - 17082797
6 agtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgt 58  Q
    |||||||||||||||  |  |||||| ||||||||||| ||||||||||||||    
17082745 agtgtagtaattagtggtgaaccgtttagtgaccgttgttagtattttaccgt 17082797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 16 - 59
Target Start/End: Original strand, 21410631 - 21410674
16 ttagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    |||| ||||||||||||||||||||||  ||||| |||||||||    
21410631 ttagaattttaccgttaagtgaccgttattagtaatttaccgtt 21410674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 16 - 59
Target Start/End: Original strand, 22361346 - 22361389
16 ttagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    |||||||||||||||||||||| | ||  |||||||||||||||    
22361346 ttagtattttaccgttaagtgatcattaatagtattttaccgtt 22361389  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 20 - 59
Target Start/End: Original strand, 25366832 - 25366871
20 tattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    |||||||||||||||||||||||  ||||| |||||||||    
25366832 tattttaccgttaagtgaccgttattagtaatttaccgtt 25366871  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 54; Significance: 8e-23; HSPs: 23)
Name: chr5

Target: chr5; HSP #1
Raw Score: 54; E-Value: 8e-23
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 21222175 - 21222236
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    |||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||    
21222175 ttactagtgtggtaattagtattttaccgttaagtgaccgttgttagtattttaccgttaag 21222236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 52; E-Value: 1e-21
Query Start/End: Original strand, 1 - 60
Target Start/End: Complemental strand, 3674571 - 3674512
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtta 60  Q
    ||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||    
3674571 ttactagggtagtaattagtattttaccgttaagtgaccgttggtagtattttaccgtta 3674512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 50; E-Value: 2e-20
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 24224913 - 24224974
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    |||||||||| || ||||||||||||||||||||||||||||| ||||||||||||||||||    
24224913 ttactagtgtggttattagtattttaccgttaagtgaccgttgttagtattttaccgttaag 24224974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 46; E-Value: 5e-18
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 32965279 - 32965340
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||| |||||||||| |||||||| ||||||||||||||| ||||||||||||||||||    
32965279 ttactagggtagtaattaatattttactgttaagtgaccgttggtagtattttaccgttaag 32965340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 42; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 28902900 - 28902839
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||| |||||||||| || ||||||||||||||||||||| |||||||||||| |||||    
28902900 ttactagagtagtaattaatagtttaccgttaagtgaccgttggtagtattttaccattaag 28902839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 42; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 28939295 - 28939234
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||| |||||||||| || ||||||||||||||||||||| |||||||||||| |||||    
28939295 ttactagagtagtaattaatagtttaccgttaagtgaccgttggtagtattttaccattaag 28939234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 39; E-Value: 0.00000000000007
Query Start/End: Original strand, 16 - 62
Target Start/End: Complemental strand, 37984031 - 37983985
16 ttagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    |||||||||||||||||||||||||||| |||||| |||||||||||    
37984031 ttagtattttaccgttaagtgaccgttgttagtatcttaccgttaag 37983985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 37; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 23467141 - 23467081
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaa 61  Q
    ||||||| ||| |||||||||||||||||||| |||||||||| |  ||||||||||||||    
23467141 ttactagggtaataattagtattttaccgttatgtgaccgttgttgatattttaccgttaa 23467081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 36; E-Value: 0.000000000004
Query Start/End: Original strand, 7 - 62
Target Start/End: Original strand, 22053408 - 22053463
7 gtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||||||||||||||| |||||| |||  ||||||||||||| ||||    
22053408 gtgtagtaattagtattttaccgtttagtgactgttaatagtattttaccgctaag 22053463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 34; E-Value: 0.00000000007
Query Start/End: Original strand, 15 - 56
Target Start/End: Original strand, 21296753 - 21296794
15 attagtattttaccgttaagtgaccgttgctagtattttacc 56  Q
    ||||||||||||||||||||||||||||| |||| |||||||    
21296753 attagtattttaccgttaagtgaccgttgttagtgttttacc 21296794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 31; E-Value: 0.000000004
Query Start/End: Original strand, 16 - 62
Target Start/End: Original strand, 5450421 - 5450467
16 ttagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||| |||||||||| ||||  ||||||||||||||||||    
5450421 ttagtattttatcgttaagtgatcgttattagtattttaccgttaag 5450467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 31; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 7529594 - 7529537
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    |||||||||||||||||||| |||||||||| |||||| |||| |  ||||||||||||    
7529594 ttactagtgtagtaattagt-ttttaccgtttagtgactgttggttatattttaccgtt 7529537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 31; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 16106336 - 16106279
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    ||||||||||||| |||||| |||||||||| ||||||||||| |  ||||||||||||    
16106336 ttactagtgtagtgattagt-ttttaccgtttagtgaccgttgattatattttaccgtt 16106279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 31; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 16596182 - 16596124
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    ||||||| ||| | ||||||||||||| ||||||||||||||  ||||| |||||||||    
16596182 ttactagggtaatgattagtattttactgttaagtgaccgttattagtaatttaccgtt 16596124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 31; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 18777575 - 18777632
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    ||||||||||||| |||||| |||||||||| ||||||||||| |  ||||||||||||    
18777575 ttactagtgtagtgattagt-ttttaccgtttagtgaccgttggttatattttaccgtt 18777632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 30; E-Value: 0.00000002
Query Start/End: Original strand, 5 - 62
Target Start/End: Original strand, 18530641 - 18530698
5 tagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||||||||||||||||| ||| || |||  |||| |||||||| ||||    
18530641 tagtgtagtaattagtattttaccgtttagttactgttaatagtgttttaccgctaag 18530698  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 29; E-Value: 0.00000007
Query Start/End: Original strand, 9 - 60
Target Start/End: Complemental strand, 7729121 - 7729069
9 gtagtaattagtattttaccg-ttaagtgaccgttgctagtattttaccgtta 60  Q
    ||||||||||||||||||||| |||||||||| ||| |  |||||||||||||    
7729121 gtagtaattagtattttaccgtttaagtgaccattggtgatattttaccgtta 7729069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 29; E-Value: 0.00000007
Query Start/End: Original strand, 16 - 56
Target Start/End: Complemental strand, 23494584 - 23494544
16 ttagtattttaccgttaagtgaccgttgctagtattttacc 56  Q
    |||||||||||||||||||||||||||  ||||| ||||||    
23494584 ttagtattttaccgttaagtgaccgttattagtaatttacc 23494544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 31 - 62
Target Start/End: Complemental strand, 6457254 - 6457223
31 taagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||| ||||||||||||||||||    
6457254 taagtgaccgttgttagtattttaccgttaag 6457223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 60
Target Start/End: Complemental strand, 7425997 - 7425940
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtta 60  Q
    ||||||||||||| |||||| ||||||||||| |||||||||| |  |||||||||||||    
7425997 ttactagtgtagtgattagt-ttttaccgtta-gtgaccgttgattatattttaccgtta 7425940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 28
Target Start/End: Complemental strand, 25005523 - 25005496
1 ttactagtgtagtaattagtattttacc 28  Q
25005523 ttactagtgtagtaattagtattttacc 25005496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 31 - 62
Target Start/End: Complemental strand, 29918719 - 29918688
31 taagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||| ||||||||||||||||||    
29918719 taagtgaccgttgttagtattttaccgttaag 29918688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 56
Target Start/End: Complemental strand, 34939957 - 34939903
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttacc 56  Q
    ||||||||||||| |||||| |||||||||| ||||||||||| |  |||||||||    
34939957 ttactagtgtagtgattagt-ttttaccgtttagtgaccgttggttatattttacc 34939903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0025 (Bit Score: 50; Significance: 2e-20; HSPs: 2)
Name: scaffold0025

Target: scaffold0025; HSP #1
Raw Score: 50; E-Value: 2e-20
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 54015 - 53954
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||||| || ||||||    
54015 ttactagtgtagtaattagtattttaccgttaagtgaccgttgttagtatttcacagttaag 53954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0025; HSP #2
Raw Score: 34; E-Value: 0.00000000007
Query Start/End: Original strand, 5 - 62
Target Start/End: Complemental strand, 9539 - 9482
5 tagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||||||||||||||||| |||||| |||  |||| |||||||| ||||    
9539 tagtgtagtaattagtattttaccgtttagtgactgttaatagtgttttaccgctaag 9482  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 50; Significance: 2e-20; HSPs: 22)
Name: chr7

Target: chr7; HSP #1
Raw Score: 50; E-Value: 2e-20
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 16920245 - 16920188
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgt 58  Q
    ||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||    
16920245 ttactagggtagtaattagtattttaccgttaagtgaccgttgttagtattttaccgt 16920188  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 46; E-Value: 5e-18
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 9081314 - 9081253
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||| ||||||||||||| ||||||||||||||||||||| ||||||||||| ||||||    
9081314 ttactagggtagtaattagtactttaccgttaagtgaccgttggtagtattttactgttaag 9081253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 46; E-Value: 5e-18
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 13390065 - 13390004
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||| ||||||| ||||| |||||||||||||||||||||||||| |||||||||||||    
13390065 ttactagggtagtaagtagtactttaccgttaagtgaccgttgctagtgttttaccgttaag 13390004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 46; E-Value: 5e-18
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 16914493 - 16914554
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    |||||||||| || |||||||||||||||||||||||| |||| ||||||||||||||||||    
16914493 ttactagtgtggttattagtattttaccgttaagtgactgttgttagtattttaccgttaag 16914554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 42; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 14268438 - 14268499
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    |||||||||| || ||||||||||||||||||||||| ||||| | ||||||||||||||||    
14268438 ttactagtgtggttattagtattttaccgttaagtgatcgttgttggtattttaccgttaag 14268499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 42; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 48357325 - 48357264
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    |||||||||| || ||||||||||||||||||||||| ||||| | ||||||||||||||||    
48357325 ttactagtgtggttattagtattttaccgttaagtgatcgttgttggtattttaccgttaag 48357264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 40; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 56
Target Start/End: Complemental strand, 13378212 - 13378157
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttacc 56  Q
    ||||||| ||||||||||||||||||||||||||||||||||  |||||| |||||    
13378212 ttactagggtagtaattagtattttaccgttaagtgaccgttaatagtatgttacc 13378157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 38; E-Value: 0.0000000000003
Query Start/End: Original strand, 5 - 62
Target Start/End: Complemental strand, 15709847 - 15709790
5 tagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||||||||||||||||| |||||| |||  ||||||||||||| ||||    
15709847 tagtgtagtaattagtattttaccgtttagtgactgttaatagtattttaccgctaag 15709790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 37; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 12247660 - 12247720
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaa 61  Q
    ||||||| |||||||||| |||||||||||| |||||| |||| || ||||||||||||||    
12247660 ttactagagtagtaattaatattttaccgtttagtgactgttggtaatattttaccgttaa 12247720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 36; E-Value: 0.000000000004
Query Start/End: Original strand, 15 - 62
Target Start/End: Original strand, 34240786 - 34240833
15 attagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||||||||||||  ||||| ||||||||||||||||||    
34240786 attagtattttaccgttaagtggtcgttgttagtattttaccgttaag 34240833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 34; E-Value: 0.00000000007
Query Start/End: Original strand, 5 - 62
Target Start/End: Complemental strand, 36024832 - 36024775
5 tagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||||||||||||||||| |||||| |||  |||| |||||||| ||||    
36024832 tagtgtagtaattagtattttaccgtttagtgactgttaatagtgttttaccgctaag 36024775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 32; E-Value: 0.000000001
Query Start/End: Original strand, 16 - 59
Target Start/End: Complemental strand, 9611975 - 9611932
16 ttagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    ||||||| |||||||||||||||||||  |||||||||||||||    
9611975 ttagtatcttaccgttaagtgaccgttattagtattttaccgtt 9611932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 32; E-Value: 0.000000001
Query Start/End: Original strand, 16 - 59
Target Start/End: Complemental strand, 9839546 - 9839503
16 ttagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    ||||||| |||||||||||||||||||  |||||||||||||||    
9839546 ttagtatcttaccgttaagtgaccgttattagtattttaccgtt 9839503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 32; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 62
Target Start/End: Original strand, 14268484 - 14268527
19 gtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||||||||| ||||  ||||||||||||||||||    
14268484 gtattttaccgttaagtgatcgttaatagtattttaccgttaag 14268527  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 32; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 60
Target Start/End: Original strand, 16569546 - 16569605
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtta 60  Q
    ||||||| ||| |||||| |||||||||||| ||||||||||| |  |||||||||||||    
16569546 ttactagagtaataattaatattttaccgtttagtgaccgttggtgatattttaccgtta 16569605  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 32; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 60
Target Start/End: Complemental strand, 16596116 - 16596057
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtta 60  Q
    ||||||| ||| |||||| |||||||||||| ||||||||||| |  |||||||||||||    
16596116 ttactagagtaataattaatattttaccgtttagtgaccgttggtgatattttaccgtta 16596057  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 31; E-Value: 0.000000004
Query Start/End: Original strand, 17 - 59
Target Start/End: Complemental strand, 9081270 - 9081228
17 tagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    ||||||||||| ||||||||||||||  |||||||||||||||    
9081270 tagtattttactgttaagtgaccgttaatagtattttaccgtt 9081228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 31; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 18253430 - 18253487
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    ||||||||||||| |||||| |||||||||| ||||||||||| |  ||||||||||||    
18253430 ttactagtgtagtgattagt-ttttaccgtttagtgaccgttggtcatattttaccgtt 18253487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 31 - 62
Target Start/End: Complemental strand, 4485368 - 4485337
31 taagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||| ||||||||||||||||||    
4485368 taagtgaccgttgttagtattttaccgttaag 4485337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 31 - 62
Target Start/End: Original strand, 10332096 - 10332127
31 taagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||| ||||||||||||||||||    
10332096 taagtgaccgttgttagtattttaccgttaag 10332127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 26 - 61
Target Start/End: Complemental strand, 28722764 - 28722729
26 accgttaagtgaccgttgctagtattttaccgttaa 61  Q
    |||| ||||||||||||| |||||||||||||||||    
28722764 accggtaagtgaccgttgttagtattttaccgttaa 28722729  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 31 - 62
Target Start/End: Complemental strand, 31501822 - 31501791
31 taagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||| ||||||||||||||||||    
31501822 taagtgaccgttgttagtattttaccgttaag 31501791  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0700 (Bit Score: 46; Significance: 5e-18; HSPs: 1)
Name: scaffold0700

Target: scaffold0700; HSP #1
Raw Score: 46; E-Value: 5e-18
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 3207 - 3146
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||||||| ||||||||||||| ||||| ||||| ||||||||||||||||||    
3207 ttactagtgtagtaattcgtattttaccgttgagtgaacgttgttagtattttaccgttaag 3146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0483 (Bit Score: 46; Significance: 5e-18; HSPs: 2)
Name: scaffold0483

Target: scaffold0483; HSP #1
Raw Score: 46; E-Value: 5e-18
Query Start/End: Original strand, 5 - 62
Target Start/End: Complemental strand, 7369 - 7312
5 tagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||||||||||||||||||||||||| | |||||||||||| |||||||    
7369 tagtgtagtaattagtattttaccgttaagtgaccatagctagtattttatcgttaag 7312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0483; HSP #2
Raw Score: 32; E-Value: 0.000000001
Query Start/End: Original strand, 17 - 60
Target Start/End: Complemental strand, 7329 - 7286
17 tagtattttaccgttaagtgaccgttgctagtattttaccgtta 60  Q
    |||||||||| |||||||||||||||  ||||||||||||||||    
7329 tagtattttatcgttaagtgaccgttaatagtattttaccgtta 7286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0150 (Bit Score: 46; Significance: 5e-18; HSPs: 1)
Name: scaffold0150

Target: scaffold0150; HSP #1
Raw Score: 46; E-Value: 5e-18
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 29246 - 29185
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    |||||||||||||||||||||| ||||| ||||||||||||||||||| |||||| ||||||    
29246 ttactagtgtagtaattagtatcttaccattaagtgaccgttgctagtgttttactgttaag 29185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0010 (Bit Score: 46; Significance: 5e-18; HSPs: 2)
Name: scaffold0010

Target: scaffold0010; HSP #1
Raw Score: 46; E-Value: 5e-18
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 31730 - 31669
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    |||||||||| |||||||||||||||||||||  ||||||||| ||||||||||||||||||    
31730 ttactagtgtggtaattagtattttaccgttatatgaccgttgatagtattttaccgttaag 31669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0010; HSP #2
Raw Score: 38; E-Value: 0.0000000000003
Query Start/End: Original strand, 17 - 62
Target Start/End: Complemental strand, 31686 - 31641
17 tagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||||||||||||||||| |||||||||||| |||||    
31686 tagtattttaccgttaagtgaccgttgttagtattttaccattaag 31641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0327 (Bit Score: 42; Significance: 0.000000000000001; HSPs: 1)
Name: scaffold0327

Target: scaffold0327; HSP #1
Raw Score: 42; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 6377 - 6316
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||| |||||||||||||||||||| |||||||||||||| |  |||||||||||||||    
6377 ttactagagtagtaattagtattttacctttaagtgaccgttgttgatattttaccgttaag 6316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0138 (Bit Score: 42; Significance: 0.000000000000001; HSPs: 2)
Name: scaffold0138

Target: scaffold0138; HSP #1
Raw Score: 42; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 21967 - 22028
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||| ||||||||||||||||||||||||||||||| ||| |  |||||||||||||||    
21967 ttactagagtagtaattagtattttaccgttaagtgaccattgttgatattttaccgttaag 22028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0138; HSP #2
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 20 - 59
Target Start/End: Original strand, 22014 - 22053
20 tattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    |||||||||||||||||||||||  ||||| |||||||||    
22014 tattttaccgttaagtgaccgttattagtaatttaccgtt 22053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0123 (Bit Score: 42; Significance: 0.000000000000001; HSPs: 2)
Name: scaffold0123

Target: scaffold0123; HSP #1
Raw Score: 42; E-Value: 0.000000000000001
Query Start/End: Original strand, 9 - 62
Target Start/End: Complemental strand, 11575 - 11522
9 gtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||||||||| |||||||||| |||| ||||||||||||||||||    
11575 gtagtaattagtattttacggttaagtgacagttggtagtattttaccgttaag 11522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0123; HSP #2
Raw Score: 31; E-Value: 0.000000004
Query Start/End: Original strand, 17 - 59
Target Start/End: Complemental strand, 11539 - 11497
17 tagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    ||||||||||||||||||||||||||  ||| |||||||||||    
11539 tagtattttaccgttaagtgaccgttagtagcattttaccgtt 11497  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0016 (Bit Score: 42; Significance: 0.000000000000001; HSPs: 1)
Name: scaffold0016

Target: scaffold0016; HSP #1
Raw Score: 42; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 116095 - 116156
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    |||||||| |||||||||||||||||||||||||||||| ||| |  |||||||||||||||    
116095 ttactagtttagtaattagtattttaccgttaagtgaccattgttgatattttaccgttaag 116156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 42; Significance: 0.000000000000001; HSPs: 19)
Name: chr4

Target: chr4; HSP #1
Raw Score: 42; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 18277115 - 18277054
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    |||||| ||| || ||||||||||||||||||||||||||||  ||||||||||||||||||    
18277115 ttactattgtggttattagtattttaccgttaagtgaccgttattagtattttaccgttaag 18277054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 40885103 - 40885164
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||| |||||||||||||||||||||||||||| || ||| ||||| ||||||||||||    
40885103 ttactagagtagtaattagtattttaccgttaagtgcccattggtagtagtttaccgttaag 40885164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 42; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 47534617 - 47534678
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||| ||||||||||||||||| |||||| |||| |||||||| |||||||||    
47534617 ttactagtgtagtcattagtattttaccgtttagtgactgttgttagtatttaaccgttaag 47534678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 40; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 12244421 - 12244480
1 ttactagtgtagtaattagtatttt-accgttaagtgaccgttgctagtattttaccgtt 59  Q
    ||||||||||||||||||||||||| ||||||| |||||||||  |||||||||||||||    
12244421 ttactagtgtagtaattagtatttttaccgttacgtgaccgttagtagtattttaccgtt 12244480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 40; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 56
Target Start/End: Original strand, 18493676 - 18493731
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttacc 56  Q
    ||||||| ||||||||||||||| |||||||||||||||||| ||||| |||||||    
18493676 ttactagagtagtaattagtattctaccgttaagtgaccgttactagtgttttacc 18493731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 38; E-Value: 0.0000000000003
Query Start/End: Original strand, 9 - 62
Target Start/End: Original strand, 41165515 - 41165568
9 gtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||| ||| |||| ||||||||||||||||||| |||||||||||||    
41165515 gtagtaattagaattataccattaagtgaccgttgctagtgttttaccgttaag 41165568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 35; E-Value: 0.00000000002
Query Start/End: Original strand, 9 - 59
Target Start/End: Original strand, 52265085 - 52265135
9 gtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    |||||||||| |||||||||||||||||||||||  ||||| |||||||||    
52265085 gtagtaattaatattttaccgttaagtgaccgttattagtaatttaccgtt 52265135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 34; E-Value: 0.00000000007
Query Start/End: Original strand, 2 - 62
Target Start/End: Complemental strand, 7850682 - 7850621
2 tactagtgtagtaattagta-ttttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    |||||||||||||||||||| |||||||||| ||||||||||  |||| |||||||| ||||    
7850682 tactagtgtagtaattagtatttttaccgtttagtgaccgttaatagtgttttaccgctaag 7850621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 34; E-Value: 0.00000000007
Query Start/End: Original strand, 5 - 62
Target Start/End: Original strand, 10103823 - 10103880
5 tagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||||||||||||||||| |||||| |||  |||| |||||||| ||||    
10103823 tagtgtagtaattagtattttaccgtttagtgactgttaatagtgttttaccgctaag 10103880  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 34; E-Value: 0.00000000007
Query Start/End: Original strand, 5 - 62
Target Start/End: Original strand, 15674662 - 15674719
5 tagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||||||||||||||||| |||||| |||  |||| |||||||| ||||    
15674662 tagtgtagtaattagtattttaccgtttagtgactgttaatagtgttttaccgctaag 15674719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 34; E-Value: 0.00000000007
Query Start/End: Original strand, 5 - 62
Target Start/End: Complemental strand, 33241390 - 33241333
5 tagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||||||||||||||||| |||||| |||  |||| |||||||| ||||    
33241390 tagtgtagtaattagtattttaccgtttagtgactgttaatagtgttttaccgctaag 33241333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 31; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 19021155 - 19021098
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    ||||||||||||| |||||| |||||||||| ||||||||||| |  ||||||||||||    
19021155 ttactagtgtagtgattagt-ttttaccgtttagtgaccgttggttatattttaccgtt 19021098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 30; E-Value: 0.00000002
Query Start/End: Original strand, 10 - 59
Target Start/End: Complemental strand, 15045498 - 15045450
10 tagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    |||| ||||| ||||||||||||||||||||||| |||| ||||||||||    
15045498 tagttattagaattttaccgttaagtgaccgttg-tagtgttttaccgtt 15045450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 30; E-Value: 0.00000002
Query Start/End: Original strand, 10 - 59
Target Start/End: Original strand, 15108926 - 15108974
10 tagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    |||| ||||| ||||||||||||||||||||||| |||| ||||||||||    
15108926 tagttattagaattttaccgttaagtgaccgttg-tagtgttttaccgtt 15108974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 30; E-Value: 0.00000002
Query Start/End: Original strand, 5 - 62
Target Start/End: Complemental strand, 31133004 - 31132947
5 tagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    |||||||||||||||||||||| |||| |||||| |||  |||| |||||||| ||||    
31133004 tagtgtagtaattagtattttagcgtttagtgactgttaatagtgttttaccgctaag 31132947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 30; E-Value: 0.00000002
Query Start/End: Original strand, 10 - 59
Target Start/End: Original strand, 34177223 - 34177272
10 tagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    |||| ||||| ||||||||||||||||||||||  ||||| |||||||||    
34177223 tagttattagaattttaccgttaagtgaccgttattagtaatttaccgtt 34177272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 29; E-Value: 0.00000007
Query Start/End: Original strand, 3 - 59
Target Start/End: Complemental strand, 9795894 - 9795839
3 actagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    ||||||||||| |||||| |||||||||| ||||||||||| |  ||||||||||||    
9795894 actagtgtagtgattagt-ttttaccgtttagtgaccgttggttatattttaccgtt 9795839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 31 - 62
Target Start/End: Complemental strand, 38765358 - 38765327
31 taagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||| ||||||||||||||||||    
38765358 taagtgaccgttgttagtattttaccgttaag 38765327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 31 - 62
Target Start/End: Original strand, 41255966 - 41255997
31 taagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||| ||||||||||||||||||    
41255966 taagtgaccgttgttagtattttaccgttaag 41255997  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0554 (Bit Score: 40; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0554

Target: scaffold0554; HSP #1
Raw Score: 40; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 60
Target Start/End: Complemental strand, 2622 - 2563
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtta 60  Q
    |||||||  ||| ||||| |||||||||||||||||||||||||||| ||||||||||||    
2622 ttactagattagaaattaatattttaccgttaagtgaccgttgctagaattttaccgtta 2563  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0021 (Bit Score: 40; Significance: 0.00000000000002; HSPs: 3)
Name: scaffold0021

Target: scaffold0021; HSP #1
Raw Score: 40; E-Value: 0.00000000000002
Query Start/End: Original strand, 10 - 61
Target Start/End: Complemental strand, 16598 - 16547
10 tagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaa 61  Q
    ||||||||| |||||||||||||||||||||||| ||| |||||||||||||    
16598 tagtaattaatattttaccgttaagtgaccgttggtagaattttaccgttaa 16547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0021; HSP #2
Raw Score: 40; E-Value: 0.00000000000002
Query Start/End: Original strand, 10 - 61
Target Start/End: Complemental strand, 26129 - 26078
10 tagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaa 61  Q
    ||||||||| |||||||||||||||||||||||| ||| |||||||||||||    
26129 tagtaattaatattttaccgttaagtgaccgttggtagaattttaccgttaa 26078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0021; HSP #3
Raw Score: 37; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 12760 - 12700
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaa 61  Q
    |||||||  ||||||||| |||||||||||||| ||||||||| ||| |||||||||||||    
12760 ttactagattagtaattaatattttaccgttaactgaccgttggtagaattttaccgttaa 12700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0643 (Bit Score: 39; Significance: 0.00000000000007; HSPs: 1)
Name: scaffold0643

Target: scaffold0643; HSP #1
Raw Score: 39; E-Value: 0.00000000000007
Query Start/End: Original strand, 1 - 55
Target Start/End: Complemental strand, 193 - 139
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttac 55  Q
    ||||||| ||||||||||||||||||||||||||||||||||  ||||| |||||    
193 ttactagggtagtaattagtattttaccgttaagtgaccgttattagtaatttac 139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0058 (Bit Score: 39; Significance: 0.00000000000007; HSPs: 1)
Name: scaffold0058

Target: scaffold0058; HSP #1
Raw Score: 39; E-Value: 0.00000000000007
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 69875 - 69933
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    ||||||| ||||||||||||||||||||||||||| ||||||  |||||||||| ||||    
69875 ttactagagtagtaattagtattttaccgttaagtaaccgttaatagtattttatcgtt 69933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0151 (Bit Score: 38; Significance: 0.0000000000003; HSPs: 1)
Name: scaffold0151

Target: scaffold0151; HSP #1
Raw Score: 38; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 21954 - 22015
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||||||||||  |  ||||||||||||| |||| ||||||||||||||||||    
21954 ttactagtgtagtaattagttgtgaaccgttaagtgactgttgttagtattttaccgttaag 22015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0006 (Bit Score: 38; Significance: 0.0000000000003; HSPs: 1)
Name: scaffold0006

Target: scaffold0006; HSP #1
Raw Score: 38; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 196818 - 196878
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    |||||||||| || ||||||||||||||||||| ||| ||||| ||||||||||||||||||    
196818 ttactagtgtggttattagtattttaccgttaactga-cgttgttagtattttaccgttaag 196878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0031 (Bit Score: 37; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0031

Target: scaffold0031; HSP #1
Raw Score: 37; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 71320 - 71260
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaa 61  Q
    ||||||| ||| ||||||||||||||||||| ||||||||||| |  ||||||||||||||    
71320 ttactagagtaataattagtattttaccgtttagtgaccgttggtgatattttaccgttaa 71260  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0103 (Bit Score: 36; Significance: 0.000000000004; HSPs: 1)
Name: scaffold0103

Target: scaffold0103; HSP #1
Raw Score: 36; E-Value: 0.000000000004
Query Start/End: Original strand, 1 - 60
Target Start/End: Complemental strand, 34361 - 34302
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtta 60  Q
    |||||||  |||||||||||||||||||||| ||||||||||| |  |||||||||||||    
34361 ttactagattagtaattagtattttaccgtttagtgaccgttggtgatattttaccgtta 34302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0014 (Bit Score: 36; Significance: 0.000000000004; HSPs: 1)
Name: scaffold0014

Target: scaffold0014; HSP #1
Raw Score: 36; E-Value: 0.000000000004
Query Start/End: Original strand, 1 - 60
Target Start/End: Complemental strand, 160006 - 159947
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtta 60  Q
    ||||||| ||| |||||| |||||||||| ||||||||||||| |||| |||||||||||    
160006 ttactagagtaataattaatattttaccgataagtgaccgttggtagtgttttaccgtta 159947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0022 (Bit Score: 35; Significance: 0.00000000002; HSPs: 2)
Name: scaffold0022

Target: scaffold0022; HSP #1
Raw Score: 35; E-Value: 0.00000000002
Query Start/End: Original strand, 13 - 59
Target Start/End: Original strand, 102525 - 102571
13 taattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    ||||||||||||||||||||||||||||||  ||||| |||||||||    
102525 taattagtattttaccgttaagtgaccgttattagtaatttaccgtt 102571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0022; HSP #2
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 31 - 62
Target Start/End: Complemental strand, 132464 - 132433
31 taagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||| ||||||||||||||||||    
132464 taagtgaccgttgttagtattttaccgttaag 132433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1295 (Bit Score: 34; Significance: 0.00000000007; HSPs: 2)
Name: scaffold1295

Target: scaffold1295; HSP #1
Raw Score: 34; E-Value: 0.00000000007
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 812 - 751
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||| |||||||||| ||||||||||||| |||||| ||| |  |||||||||||||||    
812 ttactagggtagtaattaatattttaccgttacgtgacccttgttgatattttaccgttaag 751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1295; HSP #2
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 20 - 59
Target Start/End: Complemental strand, 765 - 726
20 tattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    |||||||||||||||||||||||  ||||| |||||||||    
765 tattttaccgttaagtgaccgttattagtaatttaccgtt 726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0610 (Bit Score: 34; Significance: 0.00000000007; HSPs: 1)
Name: scaffold0610

Target: scaffold0610; HSP #1
Raw Score: 34; E-Value: 0.00000000007
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 132 - 193
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||| ||||| ||||||||||||||||| ||| ||||||| | |||||||||| |||||    
132 ttactagagtagtgattagtattttaccgtttagttaccgttggtggtattttacccttaag 193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0507 (Bit Score: 34; Significance: 0.00000000007; HSPs: 1)
Name: scaffold0507

Target: scaffold0507; HSP #1
Raw Score: 34; E-Value: 0.00000000007
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 1078 - 1139
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||| |||||||||| ||||||||||||| ||||||||||    |||||||||||||||    
1078 ttactagggtagtaattaatattttaccgttacgtgaccgttgtcgatattttaccgttaag 1139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0120 (Bit Score: 34; Significance: 0.00000000007; HSPs: 1)
Name: scaffold0120

Target: scaffold0120; HSP #1
Raw Score: 34; E-Value: 0.00000000007
Query Start/End: Original strand, 5 - 42
Target Start/End: Original strand, 27566 - 27603
5 tagtgtagtaattagtattttaccgttaagtgaccgtt 42  Q
    ||||||||||||||||||||||||||| ||||||||||    
27566 tagtgtagtaattagtattttaccgtttagtgaccgtt 27603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0095 (Bit Score: 33; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0095

Target: scaffold0095; HSP #1
Raw Score: 33; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 60
Target Start/End: Original strand, 33267 - 33327
1 ttactagtgtagtaattagtattttaccg-ttaagtgaccgttgctagtattttaccgtta 60  Q
    ||||||| ||||||||||||||||||||| || ||||||||||| |  |||||||||||||    
33267 ttactagagtagtaattagtattttaccgttttagtgaccgttggtgatattttaccgtta 33327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0480 (Bit Score: 32; Significance: 0.000000001; HSPs: 1)
Name: scaffold0480

Target: scaffold0480; HSP #1
Raw Score: 32; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 56
Target Start/End: Original strand, 8450 - 8505
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttacc 56  Q
    |||||||  ||||||||||||||||||| |||||||||||||  ||||| ||||||    
8450 ttactagaatagtaattagtattttaccattaagtgaccgttattagtaatttacc 8505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0409 (Bit Score: 32; Significance: 0.000000001; HSPs: 2)
Name: scaffold0409

Target: scaffold0409; HSP #1
Raw Score: 32; E-Value: 0.000000001
Query Start/End: Original strand, 11 - 58
Target Start/End: Original strand, 925 - 972
11 agtaattagtattttaccgttaagtgaccgttgctagtattttaccgt 58  Q
    ||||||||||||||||||||||||||||| ||  ||| ||||||||||    
925 agtaattagtattttaccgttaagtgacctttaatagcattttaccgt 972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0409; HSP #2
Raw Score: 32; E-Value: 0.000000001
Query Start/End: Original strand, 11 - 58
Target Start/End: Original strand, 9180 - 9227
11 agtaattagtattttaccgttaagtgaccgttgctagtattttaccgt 58  Q
    ||||||||||||||||||||||||||||| ||  ||| ||||||||||    
9180 agtaattagtattttaccgttaagtgacctttaatagcattttaccgt 9227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0162 (Bit Score: 32; Significance: 0.000000001; HSPs: 1)
Name: scaffold0162

Target: scaffold0162; HSP #1
Raw Score: 32; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 62
Target Start/End: Original strand, 6607 - 6650
19 gtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||||||||| ||||  ||||||||||||||||||    
6607 gtattttaccgttaagtgatcgttattagtattttaccgttaag 6650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0118 (Bit Score: 32; Significance: 0.000000001; HSPs: 1)
Name: scaffold0118

Target: scaffold0118; HSP #1
Raw Score: 32; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 56
Target Start/End: Original strand, 34018 - 34072
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttacc 56  Q
    |||||||||||||||||||| |||||||||| ||||||||||| |  |||||||||    
34018 ttactagtgtagtaattagt-ttttaccgtttagtgaccgttggttatattttacc 34072  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0682 (Bit Score: 31; Significance: 0.000000004; HSPs: 1)
Name: scaffold0682

Target: scaffold0682; HSP #1
Raw Score: 31; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 8127 - 8184
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    |||||||||||||||||||| ||||||| || ||||||||||| |  ||||||||||||    
8127 ttactagtgtagtaattagt-ttttaccatttagtgaccgttggttatattttaccgtt 8184  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0387 (Bit Score: 31; Significance: 0.000000004; HSPs: 1)
Name: scaffold0387

Target: scaffold0387; HSP #1
Raw Score: 31; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 6765 - 6822
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    ||||||||||||| |||||| |||||||||| ||||||||||| |  ||||||||||||    
6765 ttactagtgtagtgattagt-ttttaccgtttagtgaccgttggtcatattttaccgtt 6822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0207 (Bit Score: 31; Significance: 0.000000004; HSPs: 1)
Name: scaffold0207

Target: scaffold0207; HSP #1
Raw Score: 31; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 11369 - 11312
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    |||||||||||||||||||| ||||||| || ||||||||||| |  ||||||||||||    
11369 ttactagtgtagtaattagt-ttttaccatttagtgaccgttggttatattttaccgtt 11312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0173 (Bit Score: 31; Significance: 0.000000004; HSPs: 1)
Name: scaffold0173

Target: scaffold0173; HSP #1
Raw Score: 31; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 5903 - 5846
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    ||||||||||||| |||||| |||||||||| ||||||||||| |  ||||||||||||    
5903 ttactagtgtagtgattagt-ttttaccgtttagtgaccgttggttatattttaccgtt 5846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0125 (Bit Score: 31; Significance: 0.000000004; HSPs: 1)
Name: scaffold0125

Target: scaffold0125; HSP #1
Raw Score: 31; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 43613 - 43556
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    ||||||||||||| |||||| |||||||||| ||||||||||| |  ||||||||||||    
43613 ttactagtgtagtgattagt-ttttaccgtttagtgaccgttggttatattttaccgtt 43556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0075 (Bit Score: 31; Significance: 0.000000004; HSPs: 1)
Name: scaffold0075

Target: scaffold0075; HSP #1
Raw Score: 31; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 34041 - 34098
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    ||||||||||||| |||||| |||||||||| ||||||||||| |  ||||||||||||    
34041 ttactagtgtagtgattagt-ttttaccgtttagtgaccgttggttatattttaccgtt 34098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0001 (Bit Score: 31; Significance: 0.000000004; HSPs: 1)
Name: scaffold0001

Target: scaffold0001; HSP #1
Raw Score: 31; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 164563 - 164620
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    ||||||||||||| |||||| |||||||||| ||||||||||| |  ||||||||||||    
164563 ttactagtgtagtgattagt-ttttaccgtttagtgaccgttggtcatattttaccgtt 164620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0004 (Bit Score: 30; Significance: 0.00000002; HSPs: 1)
Name: scaffold0004

Target: scaffold0004; HSP #1
Raw Score: 30; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 28178 - 28117
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    |||||||||| |||||||||  |  |||| ||||||| ||||| ||||||||||||||||||    
28178 ttactagtgtggtaattagttgtgaaccggtaagtgatcgttgttagtattttaccgttaag 28117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1932 (Bit Score: 29; Significance: 0.00000007; HSPs: 2)
Name: scaffold1932

Target: scaffold1932; HSP #1
Raw Score: 29; E-Value: 0.00000007
Query Start/End: Original strand, 6 - 62
Target Start/End: Original strand, 944 - 1000
6 agtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    |||||||||||||||  |  |||||| ||||||||||| ||| ||||||||||||||    
944 agtgtagtaattagtggtgaaccgtttagtgaccgttgttagcattttaccgttaag 1000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1932; HSP #2
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 16 - 59
Target Start/End: Original strand, 982 - 1025
16 ttagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    |||| ||||||||||||||||||||||  ||| |||||||||||    
982 ttagcattttaccgttaagtgaccgttagtagcattttaccgtt 1025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0521 (Bit Score: 29; Significance: 0.00000007; HSPs: 1)
Name: scaffold0521

Target: scaffold0521; HSP #1
Raw Score: 29; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 11803 - 11743
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaa 61  Q
    ||||||||||||||||||||  |  |||||| ||||||| ||| |||||||| ||||||||    
11803 ttactagtgtagtaattagtggtaaaccgttcagtgaccattgttagtatttcaccgttaa 11743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0389 (Bit Score: 28; Significance: 0.0000003; HSPs: 1)
Name: scaffold0389

Target: scaffold0389; HSP #1
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 20 - 59
Target Start/End: Complemental strand, 11321 - 11282
20 tattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    |||||||||||||||||||||||  ||||| |||||||||    
11321 tattttaccgttaagtgaccgttattagtaatttaccgtt 11282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0357 (Bit Score: 28; Significance: 0.0000003; HSPs: 1)
Name: scaffold0357

Target: scaffold0357; HSP #1
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 31 - 62
Target Start/End: Complemental strand, 7065 - 7034
31 taagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||| ||||||||||||||||||||||    
7065 taagtgaccattgctagtattttaccgttaag 7034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0342 (Bit Score: 28; Significance: 0.0000003; HSPs: 1)
Name: scaffold0342

Target: scaffold0342; HSP #1
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 60
Target Start/End: Complemental strand, 12975 - 12916
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtta 60  Q
    ||||||| |||||||||||||||||||| || ||||  ||||| |  |||||||||||||    
12975 ttactagagtagtaattagtattttaccatttagtggtcgttggtgatattttaccgtta 12916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0338 (Bit Score: 28; Significance: 0.0000003; HSPs: 1)
Name: scaffold0338

Target: scaffold0338; HSP #1
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 60
Target Start/End: Complemental strand, 9693 - 9634
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtta 60  Q
    ||||||| ||| ||||||   |||||||||| ||||||||||| || |||||||||||||    
9693 ttactagagtaataattaaggttttaccgtttagtgaccgttggtaatattttaccgtta 9634  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0080 (Bit Score: 28; Significance: 0.0000003; HSPs: 1)
Name: scaffold0080

Target: scaffold0080; HSP #1
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 31 - 62
Target Start/End: Original strand, 23282 - 23313
31 taagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||| ||||||||||||||||||    
23282 taagtgaccgttgttagtattttaccgttaag 23313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC