View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 454-NF4349-Insertion-20 (Length: 62)

Name: 454-NF4349-Insertion-20
Description: 454-NF4349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 454-NF4349-Insertion-20
454-NF4349-Insertion-20
[»] chr8 (27 HSPs)
chr8 (1-62)||(21197690-21197751)
chr8 (1-62)||(23837848-23837909)
chr8 (1-58)||(21191144-21191201)
chr8 (1-59)||(17285857-17285915)
chr8 (1-62)||(23151385-23151446)
chr8 (5-58)||(26012115-26012168)
chr8 (1-62)||(29307066-29307127)
chr8 (1-62)||(38534297-38534358)
chr8 (15-62)||(5855232-5855279)
chr8 (16-62)||(15933918-15933964)
chr8 (1-62)||(33610591-33610652)
chr8 (16-62)||(33529046-33529092)
chr8 (10-59)||(22735445-22735494)
chr8 (19-59)||(31193911-31193951)
chr8 (1-60)||(39446305-39446365)
chr8 (17-59)||(21197734-21197776)
chr8 (1-59)||(22148061-22148118)
chr8 (1-62)||(22981916-22981977)
chr8 (5-62)||(23158804-23158861)
chr8 (1-62)||(23350796-23350857)
chr8 (1-61)||(20653573-20653633)
chr8 (19-59)||(23158779-23158819)
chr8 (26-62)||(37652020-37652056)
chr8 (31-62)||(19330924-19330955)
chr8 (16-59)||(23150401-23150444)
chr8 (16-59)||(23151428-23151471)
chr8 (16-59)||(33610634-33610677)
[»] chr3 (29 HSPs)
chr3 (1-62)||(11881757-11881818)
chr3 (1-62)||(19306428-19306489)
chr3 (1-61)||(16880761-16880821)
chr3 (4-59)||(15879020-15879075)
chr3 (1-59)||(3576000-3576058)
chr3 (1-58)||(12032164-12032221)
chr3 (1-62)||(34560476-34560537)
chr3 (1-62)||(17192191-17192252)
chr3 (1-61)||(11060547-11060607)
chr3 (1-61)||(12559780-12559840)
chr3 (9-61)||(40939774-40939826)
chr3 (1-60)||(17522429-17522488)
chr3 (10-62)||(47784306-47784360)
chr3 (10-55)||(15521587-15521632)
chr3 (1-62)||(17205321-17205382)
chr3 (13-62)||(39657171-39657220)
chr3 (13-61)||(14296084-14296132)
chr3 (13-61)||(14301711-14301759)
chr3 (1-60)||(23492993-23493051)
chr3 (1-60)||(30207864-30207923)
chr3 (1-59)||(14285598-14285655)
chr3 (9-59)||(17959888-17959938)
chr3 (1-39)||(48422220-48422258)
chr3 (10-59)||(14081114-14081163)
chr3 (1-61)||(14304691-14304751)
chr3 (31-62)||(6224682-6224713)
chr3 (16-59)||(11881800-11881843)
chr3 (27-62)||(18970541-18970576)
chr3 (20-59)||(39657146-39657185)
[»] chr2 (25 HSPs)
chr2 (1-62)||(2784-2845)
chr2 (1-62)||(2155367-2155428)
chr2 (1-62)||(24294061-24294122)
chr2 (1-61)||(22762831-22762890)
chr2 (1-60)||(19668676-19668735)
chr2 (10-59)||(723009-723058)
chr2 (1-62)||(24885286-24885347)
chr2 (10-62)||(22579411-22579463)
chr2 (9-59)||(25306056-25306106)
chr2 (1-60)||(24086993-24087053)
chr2 (27-62)||(7322164-7322199)
chr2 (17-59)||(2828-2870)
chr2 (17-59)||(7322139-7322181)
chr2 (1-59)||(16936193-16936250)
chr2 (1-59)||(17006853-17006910)
chr2 (10-60)||(19433387-19433437)
chr2 (1-59)||(22275368-22275425)
chr2 (1-59)||(23777630-23777687)
chr2 (1-62)||(23821345-23821406)
chr2 (1-62)||(23830424-23830485)
chr2 (5-55)||(24340962-24341012)
chr2 (1-59)||(25213679-25213736)
chr2 (10-59)||(68614-68662)
chr2 (20-59)||(23821392-23821431)
chr2 (20-59)||(23830471-23830510)
[»] chr1 (18 HSPs)
chr1 (1-62)||(17023625-17023686)
chr1 (1-62)||(17609549-17609610)
chr1 (1-62)||(19603755-19603816)
chr1 (1-62)||(16646559-16646620)
chr1 (1-59)||(27675421-27675479)
chr1 (1-59)||(51627232-51627290)
chr1 (1-62)||(16657286-16657347)
chr1 (1-62)||(37233394-37233455)
chr1 (1-62)||(41219401-41219462)
chr1 (1-59)||(20177801-20177859)
chr1 (10-59)||(22829000-22829049)
chr1 (14-62)||(36355843-36355891)
chr1 (20-59)||(16646534-16646573)
chr1 (1-62)||(20954979-20955040)
chr1 (1-62)||(22142902-22142962)
chr1 (26-62)||(8537514-8537550)
chr1 (26-62)||(8602753-8602789)
chr1 (31-62)||(21195623-21195654)
[»] scaffold0013 (1 HSPs)
scaffold0013 (1-59)||(36102-36160)
[»] scaffold1272 (2 HSPs)
scaffold1272 (5-62)||(929-986)
scaffold1272 (17-59)||(904-946)
[»] scaffold0032 (2 HSPs)
scaffold0032 (1-62)||(93390-93451)
scaffold0032 (1-61)||(104159-104219)
[»] chr6 (19 HSPs)
chr6 (1-62)||(18381351-18381412)
chr6 (1-59)||(14152936-14152994)
chr6 (1-62)||(21623819-21623880)
chr6 (1-62)||(22361303-22361364)
chr6 (1-62)||(14128786-14128847)
chr6 (1-62)||(17547220-17547281)
chr6 (1-62)||(18629147-18629208)
chr6 (4-59)||(16887361-16887417)
chr6 (1-62)||(27752064-27752125)
chr6 (1-61)||(18399586-18399646)
chr6 (18-62)||(25654744-25654788)
chr6 (16-59)||(18629190-18629233)
chr6 (1-60)||(25920234-25920293)
chr6 (1-59)||(16299571-16299628)
chr6 (13-62)||(25366797-25366846)
chr6 (6-58)||(17082745-17082797)
chr6 (16-59)||(21410631-21410674)
chr6 (16-59)||(22361346-22361389)
chr6 (20-59)||(25366832-25366871)
[»] chr5 (23 HSPs)
chr5 (1-62)||(21222175-21222236)
chr5 (1-60)||(3674512-3674571)
chr5 (1-62)||(24224913-24224974)
chr5 (1-62)||(32965279-32965340)
chr5 (1-62)||(28902839-28902900)
chr5 (1-62)||(28939234-28939295)
chr5 (16-62)||(37983985-37984031)
chr5 (1-61)||(23467081-23467141)
chr5 (7-62)||(22053408-22053463)
chr5 (15-56)||(21296753-21296794)
chr5 (16-62)||(5450421-5450467)
chr5 (1-59)||(7529537-7529594)
chr5 (1-59)||(16106279-16106336)
chr5 (1-59)||(16596124-16596182)
chr5 (1-59)||(18777575-18777632)
chr5 (5-62)||(18530641-18530698)
chr5 (9-60)||(7729069-7729121)
chr5 (16-56)||(23494544-23494584)
chr5 (31-62)||(6457223-6457254)
chr5 (1-60)||(7425940-7425997)
chr5 (1-28)||(25005496-25005523)
chr5 (31-62)||(29918688-29918719)
chr5 (1-56)||(34939903-34939957)
[»] scaffold0025 (2 HSPs)
scaffold0025 (1-62)||(53954-54015)
scaffold0025 (5-62)||(9482-9539)
[»] chr7 (22 HSPs)
chr7 (1-58)||(16920188-16920245)
chr7 (1-62)||(9081253-9081314)
chr7 (1-62)||(13390004-13390065)
chr7 (1-62)||(16914493-16914554)
chr7 (1-62)||(14268438-14268499)
chr7 (1-62)||(48357264-48357325)
chr7 (1-56)||(13378157-13378212)
chr7 (5-62)||(15709790-15709847)
chr7 (1-61)||(12247660-12247720)
chr7 (15-62)||(34240786-34240833)
chr7 (5-62)||(36024775-36024832)
chr7 (16-59)||(9611932-9611975)
chr7 (16-59)||(9839503-9839546)
chr7 (19-62)||(14268484-14268527)
chr7 (1-60)||(16569546-16569605)
chr7 (1-60)||(16596057-16596116)
chr7 (17-59)||(9081228-9081270)
chr7 (1-59)||(18253430-18253487)
chr7 (31-62)||(4485337-4485368)
chr7 (31-62)||(10332096-10332127)
chr7 (26-61)||(28722729-28722764)
chr7 (31-62)||(31501791-31501822)
[»] scaffold0700 (1 HSPs)
scaffold0700 (1-62)||(3146-3207)
[»] scaffold0483 (2 HSPs)
scaffold0483 (5-62)||(7312-7369)
scaffold0483 (17-60)||(7286-7329)
[»] scaffold0150 (1 HSPs)
scaffold0150 (1-62)||(29185-29246)
[»] scaffold0010 (2 HSPs)
scaffold0010 (1-62)||(31669-31730)
scaffold0010 (17-62)||(31641-31686)
[»] scaffold0327 (1 HSPs)
scaffold0327 (1-62)||(6316-6377)
[»] scaffold0138 (2 HSPs)
scaffold0138 (1-62)||(21967-22028)
scaffold0138 (20-59)||(22014-22053)
[»] scaffold0123 (2 HSPs)
scaffold0123 (9-62)||(11522-11575)
scaffold0123 (17-59)||(11497-11539)
[»] scaffold0016 (1 HSPs)
scaffold0016 (1-62)||(116095-116156)
[»] chr4 (19 HSPs)
chr4 (1-62)||(18277054-18277115)
chr4 (1-62)||(40885103-40885164)
chr4 (1-62)||(47534617-47534678)
chr4 (1-59)||(12244421-12244480)
chr4 (1-56)||(18493676-18493731)
chr4 (9-62)||(41165515-41165568)
chr4 (9-59)||(52265085-52265135)
chr4 (2-62)||(7850621-7850682)
chr4 (5-62)||(10103823-10103880)
chr4 (5-62)||(15674662-15674719)
chr4 (5-62)||(33241333-33241390)
chr4 (1-59)||(19021098-19021155)
chr4 (10-59)||(15045450-15045498)
chr4 (10-59)||(15108926-15108974)
chr4 (5-62)||(31132947-31133004)
chr4 (10-59)||(34177223-34177272)
chr4 (3-59)||(9795839-9795894)
chr4 (31-62)||(38765327-38765358)
chr4 (31-62)||(41255966-41255997)
[»] scaffold0554 (1 HSPs)
scaffold0554 (1-60)||(2563-2622)
[»] scaffold0021 (3 HSPs)
scaffold0021 (10-61)||(16547-16598)
scaffold0021 (10-61)||(26078-26129)
scaffold0021 (1-61)||(12700-12760)
[»] scaffold0643 (1 HSPs)
scaffold0643 (1-55)||(139-193)
[»] scaffold0058 (1 HSPs)
scaffold0058 (1-59)||(69875-69933)
[»] scaffold0151 (1 HSPs)
scaffold0151 (1-62)||(21954-22015)
[»] scaffold0006 (1 HSPs)
scaffold0006 (1-62)||(196818-196878)
[»] scaffold0031 (1 HSPs)
scaffold0031 (1-61)||(71260-71320)
[»] scaffold0103 (1 HSPs)
scaffold0103 (1-60)||(34302-34361)
[»] scaffold0014 (1 HSPs)
scaffold0014 (1-60)||(159947-160006)
[»] scaffold0022 (2 HSPs)
scaffold0022 (13-59)||(102525-102571)
scaffold0022 (31-62)||(132433-132464)
[»] scaffold1295 (2 HSPs)
scaffold1295 (1-62)||(751-812)
scaffold1295 (20-59)||(726-765)
[»] scaffold0610 (1 HSPs)
scaffold0610 (1-62)||(132-193)
[»] scaffold0507 (1 HSPs)
scaffold0507 (1-62)||(1078-1139)
[»] scaffold0120 (1 HSPs)
scaffold0120 (5-42)||(27566-27603)
[»] scaffold0095 (1 HSPs)
scaffold0095 (1-60)||(33267-33327)
[»] scaffold0480 (1 HSPs)
scaffold0480 (1-56)||(8450-8505)
[»] scaffold0409 (2 HSPs)
scaffold0409 (11-58)||(925-972)
scaffold0409 (11-58)||(9180-9227)
[»] scaffold0162 (1 HSPs)
scaffold0162 (19-62)||(6607-6650)
[»] scaffold0118 (1 HSPs)
scaffold0118 (1-56)||(34018-34072)
[»] scaffold0682 (1 HSPs)
scaffold0682 (1-59)||(8127-8184)
[»] scaffold0387 (1 HSPs)
scaffold0387 (1-59)||(6765-6822)
[»] scaffold0207 (1 HSPs)
scaffold0207 (1-59)||(11312-11369)
[»] scaffold0173 (1 HSPs)
scaffold0173 (1-59)||(5846-5903)
[»] scaffold0125 (1 HSPs)
scaffold0125 (1-59)||(43556-43613)
[»] scaffold0075 (1 HSPs)
scaffold0075 (1-59)||(34041-34098)
[»] scaffold0001 (1 HSPs)
scaffold0001 (1-59)||(164563-164620)
[»] scaffold0004 (1 HSPs)
scaffold0004 (1-62)||(28117-28178)
[»] scaffold1932 (2 HSPs)
scaffold1932 (6-62)||(944-1000)
scaffold1932 (16-59)||(982-1025)
[»] scaffold0521 (1 HSPs)
scaffold0521 (1-61)||(11743-11803)
[»] scaffold0389 (1 HSPs)
scaffold0389 (20-59)||(11282-11321)
[»] scaffold0357 (1 HSPs)
scaffold0357 (31-62)||(7034-7065)
[»] scaffold0342 (1 HSPs)
scaffold0342 (1-60)||(12916-12975)
[»] scaffold0338 (1 HSPs)
scaffold0338 (1-60)||(9634-9693)
[»] scaffold0080 (1 HSPs)
scaffold0080 (31-62)||(23282-23313)


Alignment Details
Target: chr8 (Bit Score: 58; Significance: 3e-25; HSPs: 27)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 58; E-Value: 3e-25
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 21197690 - 21197751
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
21197690 ttactagtgtagtaattagtattttaccgataagtgaccgttgctagtattttaccgttaag 21197751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 54; E-Value: 8e-23
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 23837909 - 23837848
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||    
23837909 ttactagtgtagtaattagtattttaccgttaagtgaccgttgttaatattttaccgttaag 23837848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 50; E-Value: 2e-20
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 21191144 - 21191201
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgt 58  Q
    |||||||||||||||||||||||||| || ||||||||||||||||||||||||||||    
21191144 ttactagtgtagtaattagtattttaacgataagtgaccgttgctagtattttaccgt 21191201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 47; E-Value: 1e-18
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 17285915 - 17285857
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    ||||||| ||| |||||||||||||||| ||||||||||||||||||||||||||||||    
17285915 ttactagggtaataattagtattttaccattaagtgaccgttgctagtattttaccgtt 17285857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 42; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 23151385 - 23151446
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||| |||||||||||||||||||||| |||||||| ||||| |||||||| |||||||||    
23151385 ttactggtgtagtaattagtattttaccattaagtgatcgttgttagtatttcaccgttaag 23151446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 42; E-Value: 0.000000000000001
Query Start/End: Original strand, 5 - 58
Target Start/End: Complemental strand, 26012168 - 26012115
Alignment:
5 tagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgt 58  Q
    |||||| || ||||||||||||||||||||||||||||| ||||||||||||||    
26012168 tagtgtggttattagtattttaccgttaagtgaccgttgttagtattttaccgt 26012115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 42; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 29307127 - 29307066
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    |||||||||| |||||||||||||||| ||||||||||||||| | |||||| |||||||||    
29307127 ttactagtgtggtaattagtattttactgttaagtgaccgttgttggtatttaaccgttaag 29307066  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 42; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 38534358 - 38534297
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||| ||||| |||||||||||||||||||||||| |||| ||||||||||| ||||||    
38534358 ttactagagtagtgattagtattttaccgttaagtgacagttggtagtattttactgttaag 38534297  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 40; E-Value: 0.00000000000002
Query Start/End: Original strand, 15 - 62
Target Start/End: Complemental strand, 5855279 - 5855232
Alignment:
15 attagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||||||||||| ||||||| ||||||||||||||||||    
5855279 attagtattttaccgttaagtaaccgttgttagtattttaccgttaag 5855232  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 39; E-Value: 0.00000000000007
Query Start/End: Original strand, 16 - 62
Target Start/End: Complemental strand, 15933964 - 15933918
Alignment:
16 ttagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||||||| |||||||||| ||||||||||||||||||    
15933964 ttagtattttaccgttacgtgaccgttgttagtattttaccgttaag 15933918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 38; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 33610591 - 33610652
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||||||||||  |  |||||||||| ||||||| ||||||||||||||||||    
33610591 ttactagtgtagtaattagttgtgaaccgttaagtaaccgttgttagtattttaccgttaag 33610652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 35; E-Value: 0.00000000002
Query Start/End: Original strand, 16 - 62
Target Start/End: Complemental strand, 33529092 - 33529046
Alignment:
16 ttagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    |||||||||||||||||||||| ||||  ||||||||||||||||||    
33529092 ttagtattttaccgttaagtgatcgttattagtattttaccgttaag 33529046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 34; E-Value: 0.00000000007
Query Start/End: Original strand, 10 - 59
Target Start/End: Original strand, 22735445 - 22735494
Alignment:
10 tagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    |||| ||||| ||||||||||||||||||||||| |||| ||||||||||    
22735445 tagttattagaattttaccgttaagtgaccgttgttagtgttttaccgtt 22735494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 33; E-Value: 0.0000000003
Query Start/End: Original strand, 19 - 59
Target Start/End: Original strand, 31193911 - 31193951
Alignment:
19 gtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    ||||||||||||||||||||||||  |||||||||||||||    
31193911 gtattttaccgttaagtgaccgttagtagtattttaccgtt 31193951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 33; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 60
Target Start/End: Original strand, 39446305 - 39446365
Alignment:
1 ttactagtgtagtaattagtattttaccg-ttaagtgaccgttgctagtattttaccgtta 60  Q
    ||||||| ||||||||||||||||||||| || ||||||||||| |  |||||||||||||    
39446305 ttactagagtagtaattagtattttaccgttttagtgaccgttggtgatattttaccgtta 39446365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 31; E-Value: 0.000000004
Query Start/End: Original strand, 17 - 59
Target Start/End: Original strand, 21197734 - 21197776
Alignment:
17 tagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    |||||||||||||||||||||| |||  |||||||||||||||    
21197734 tagtattttaccgttaagtgactgttaatagtattttaccgtt 21197776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 31; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 22148118 - 22148061
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    ||||||||||||| |||||| |||||||||| ||||||||||| |  ||||||||||||    
22148118 ttactagtgtagtgattagt-ttttaccgtttagtgaccgttggttatattttaccgtt 22148061  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 30; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 22981977 - 22981916
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||| || ||||||||| ||||||||||| |||||||||| |  |||||||||| ||||    
22981977 ttactagagtggtaattagtgttttaccgttacgtgaccgttgttgatattttaccgataag 22981916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 30; E-Value: 0.00000002
Query Start/End: Original strand, 5 - 62
Target Start/End: Complemental strand, 23158861 - 23158804
Alignment:
5 tagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    |||||| |||||||||| |  ||||||||||||| |||| | ||||||||||||||||    
23158861 tagtgtggtaattagtagtgaaccgttaagtgacagttgttggtattttaccgttaag 23158804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 30; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 23350857 - 23350796
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    |||||||| |||||||||||     ||||||||||||| |||| ||||||||||||||||||    
23350857 ttactagtatagtaattagttgagaaccgttaagtgactgttgttagtattttaccgttaag 23350796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 29; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 20653573 - 20653633
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaa 61  Q
    ||||||| ||| ||||||||||||||||||| |||||| |||| |  ||||||| ||||||    
20653573 ttactagagtaataattagtattttaccgtttagtgactgttggtgatattttatcgttaa 20653633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 29; E-Value: 0.00000007
Query Start/End: Original strand, 19 - 59
Target Start/End: Complemental strand, 23158819 - 23158779
Alignment:
19 gtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    ||||||||||||||||||| ||||  |||||||||||||||    
23158819 gtattttaccgttaagtgaacgttattagtattttaccgtt 23158779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 29; E-Value: 0.00000007
Query Start/End: Original strand, 26 - 62
Target Start/End: Original strand, 37652020 - 37652056
Alignment:
26 accgttaagtgaccgttgctagtattttaccgttaag 62  Q
    |||| ||||||||||||| ||||||||||||||||||    
37652020 accggtaagtgaccgttgttagtattttaccgttaag 37652056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 31 - 62
Target Start/End: Original strand, 19330924 - 19330955
Alignment:
31 taagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||| ||||||||||||||||||    
19330924 taagtgaccgttgttagtattttaccgttaag 19330955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 16 - 59
Target Start/End: Complemental strand, 23150444 - 23150401
Alignment:
16 ttagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    |||||||||||||||||||||| ||||  | |||||||||||||    
23150444 ttagtattttaccgttaagtgaacgttatttgtattttaccgtt 23150401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 16 - 59
Target Start/End: Original strand, 23151428 - 23151471
Alignment:
16 ttagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    ||||||||| |||||||||||| ||||  |||||||||||||||    
23151428 ttagtatttcaccgttaagtgatcgttattagtattttaccgtt 23151471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #27
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 16 - 59
Target Start/End: Original strand, 33610634 - 33610677
Alignment:
16 ttagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    ||||||||||||||||||||||  |||  |||||||||||||||    
33610634 ttagtattttaccgttaagtgatagttattagtattttaccgtt 33610677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 58; Significance: 3e-25; HSPs: 29)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 58; E-Value: 3e-25
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 11881757 - 11881818
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
11881757 ttactagtgtagtaattagtattttaccgttaagtgaccgttgttagtattttaccgttaag 11881818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 54; E-Value: 8e-23
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 19306489 - 19306428
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||    
19306489 ttactagtgtagtaattagtattttaccgttaagtgaccgttattagtattttaccgttaag 19306428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 49; E-Value: 8e-20
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 16880821 - 16880761
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaa 61  Q
    ||||||| |||||||| |||||||||||||||||||||||||| |||||||||||||||||    
16880821 ttactagagtagtaatcagtattttaccgttaagtgaccgttggtagtattttaccgttaa 16880761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 48; E-Value: 3e-19
Query Start/End: Original strand, 4 - 59
Target Start/End: Complemental strand, 15879075 - 15879020
Alignment:
4 ctagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    |||| ||||||||||||||||||||||||||||||| |||||||||||||||||||    
15879075 ctagggtagtaattagtattttaccgttaagtgaccattgctagtattttaccgtt 15879020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 47; E-Value: 1e-18
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 3576000 - 3576058
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    |||||||||| |||||||||||||||| ||||||||||||||| |||||||||||||||    
3576000 ttactagtgttgtaattagtattttacggttaagtgaccgttgttagtattttaccgtt 3576058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 46; E-Value: 5e-18
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 12032221 - 12032164
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgt 58  Q
    ||||||| |||||||||||||||||||||||||||||| |||| ||||||||||||||    
12032221 ttactagagtagtaattagtattttaccgttaagtgactgttgttagtattttaccgt 12032164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 46; E-Value: 5e-18
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 34560537 - 34560476
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    |||||||||||||  |||||||||||||||||||||||| ||| ||||||||||||||||||    
34560537 ttactagtgtagttgttagtattttaccgttaagtgaccattgttagtattttaccgttaag 34560476  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 42; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 17192252 - 17192191
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||| |||||||||| |||||||||||||||| ||||||| | ||||||||||||||||    
17192252 ttactagggtagtaattaatattttaccgttaagtaaccgttgttggtattttaccgttaag 17192191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 37; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 11060547 - 11060607
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaa 61  Q
    ||||||| |||||||||| |||||||||||| ||||||||||| ||  |||||||||||||    
11060547 ttactagagtagtaattaatattttaccgtttagtgaccgttggtaaaattttaccgttaa 11060607  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 37; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 12559780 - 12559840
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaa 61  Q
    ||||||| ||||||||| |||||||| |||||||||||||||| ||| |||||||| ||||    
12559780 ttactagagtagtaattggtattttatcgttaagtgaccgttggtagaattttaccattaa 12559840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 37; E-Value: 0.000000000001
Query Start/End: Original strand, 9 - 61
Target Start/End: Complemental strand, 40939826 - 40939774
Alignment:
9 gtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaa 61  Q
    ||||| ||||||||| ||||||| ||||||||||| |||||||||||||||||    
40939826 gtagtgattagtattataccgtttagtgaccgttggtagtattttaccgttaa 40939774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 36; E-Value: 0.000000000004
Query Start/End: Original strand, 1 - 60
Target Start/End: Original strand, 17522429 - 17522488
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtta 60  Q
    |||||||  ||| ||||| |||||||||||||||||||||||| ||| ||||||||||||    
17522429 ttactaggttagaaattaatattttaccgttaagtgaccgttggtagaattttaccgtta 17522488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 36; E-Value: 0.000000000004
Query Start/End: Original strand, 10 - 62
Target Start/End: Original strand, 47784306 - 47784360
Alignment:
10 tagtaattagtattttaccgttaagtgaccgttgctag--tattttaccgttaag 62  Q
    ||||||||||||||||||||||||||||| |||| |||  |||||||||||||||    
47784306 tagtaattagtattttaccgttaagtgactgttggtagtatattttaccgttaag 47784360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 34; E-Value: 0.00000000007
Query Start/End: Original strand, 10 - 55
Target Start/End: Complemental strand, 15521632 - 15521587
Alignment:
10 tagtaattagtattttaccgttaagtgaccgttgctagtattttac 55  Q
    |||| ||||||||||||||||||||||||||||| |||| ||||||    
15521632 tagttattagtattttaccgttaagtgaccgttgttagtgttttac 15521587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 34; E-Value: 0.00000000007
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 17205382 - 17205321
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||| |||||||||| ||||||||| |||||||| | ||| | ||||||||||||||||    
17205382 ttactagggtagtaattaatattttaccattaagtgatcattgttggtattttaccgttaag 17205321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 34; E-Value: 0.00000000007
Query Start/End: Original strand, 13 - 62
Target Start/End: Complemental strand, 39657220 - 39657171
Alignment:
13 taattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    |||||||||||||||||||| |||||||||| |  |||||||||||||||    
39657220 taattagtattttaccgttatgtgaccgttgttgatattttaccgttaag 39657171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 33; E-Value: 0.0000000003
Query Start/End: Original strand, 13 - 61
Target Start/End: Complemental strand, 14296132 - 14296084
Alignment:
13 taattagtattttaccgttaagtgaccgttgctagtattttaccgttaa 61  Q
    |||||| |||||||||||| ||| ||||||| |||||||||||||||||    
14296132 taattaatattttaccgtttagttaccgttggtagtattttaccgttaa 14296084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 33; E-Value: 0.0000000003
Query Start/End: Original strand, 13 - 61
Target Start/End: Complemental strand, 14301759 - 14301711
Alignment:
13 taattagtattttaccgttaagtgaccgttgctagtattttaccgttaa 61  Q
    |||||| |||||||||||| ||| ||||||| |||||||||||||||||    
14301759 taattaatattttaccgtttagttaccgttggtagtattttaccgttaa 14301711  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 32; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 60
Target Start/End: Complemental strand, 23493051 - 23492993
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtta 60  Q
    ||||||||||||| |||||| |||||||||| ||||||||||| |  |||||||||||||    
23493051 ttactagtgtagtgattagt-ttttaccgtttagtgaccgttggttatattttaccgtta 23492993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 32; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 60
Target Start/End: Complemental strand, 30207923 - 30207864
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtta 60  Q
    ||||||| ||||| |||| |||||||||||||||||||| ||| |  |||||||||||||    
30207923 ttactagggtagtcattaatattttaccgttaagtgaccattgttgatattttaccgtta 30207864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 31; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 14285655 - 14285598
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    |||| ||||||||||||||| |||||||||| ||||||||||| |  ||||||||||||    
14285655 ttaccagtgtagtaattagt-ttttaccgtttagtgaccgttggttatattttaccgtt 14285598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 31; E-Value: 0.000000004
Query Start/End: Original strand, 9 - 59
Target Start/End: Original strand, 17959888 - 17959938
Alignment:
9 gtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    ||||||||||||||||||| ||||||| ||||||  ||| |||||||||||    
17959888 gtagtaattagtattttacagttaagtaaccgttagtagcattttaccgtt 17959938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 31; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 48422258 - 48422220
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgacc 39  Q
    ||||||| |||||||||| ||||||||||||||||||||    
48422258 ttactagggtagtaattaatattttaccgttaagtgacc 48422220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 30; E-Value: 0.00000002
Query Start/End: Original strand, 10 - 59
Target Start/End: Complemental strand, 14081163 - 14081114
Alignment:
10 tagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    |||| ||||| ||||||| ||||||||||||||  |||||||||||||||    
14081163 tagttattagaattttactgttaagtgaccgttaatagtattttaccgtt 14081114  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 29; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 14304751 - 14304691
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaa 61  Q
    ||||||| ||| ||||||||||||||||||| |||||| |||| |  ||||||| ||||||    
14304751 ttactagagtaataattagtattttaccgtttagtgactgttggtgatattttatcgttaa 14304691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 31 - 62
Target Start/End: Original strand, 6224682 - 6224713
Alignment:
31 taagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||| ||||||||||||||||||    
6224682 taagtgaccgttgttagtattttaccgttaag 6224713  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 16 - 59
Target Start/End: Original strand, 11881800 - 11881843
Alignment:
16 ttagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    ||||||||||||||||||||| |||||  ||||| |||||||||    
11881800 ttagtattttaccgttaagtggccgttattagtaatttaccgtt 11881843  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 62
Target Start/End: Complemental strand, 18970576 - 18970541
Alignment:
27 ccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||| ||||||| ||||||||||||||||||    
18970576 ccgttaagtcaccgttgttagtattttaccgttaag 18970541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 20 - 59
Target Start/End: Complemental strand, 39657185 - 39657146
Alignment:
20 tattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    |||||||||||||||||||||||  ||||| |||||||||    
39657185 tattttaccgttaagtgaccgttattagtaatttaccgtt 39657146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 58; Significance: 3e-25; HSPs: 25)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 58; E-Value: 3e-25
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 2784 - 2845
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
2784 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtgttttaccgttaag 2845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 58; E-Value: 3e-25
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 2155367 - 2155428
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
2155367 ttactagtgtagtaattagtattttaccgataagtgaccgttgctagtattttaccgttaag 2155428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 42; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 24294061 - 24294122
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||| ||||||||||||||||||||||||||| || ||||||||| ||||||| |||||    
24294061 ttactagggtagtaattagtattttaccgttaagtaactgttgctagtgttttaccattaag 24294122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 41; E-Value: 0.000000000000004
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 22762831 - 22762890
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaa 61  Q
    ||||||| |||||||||| ||||| |||||||||||||||||| |||||||||||||||||    
22762831 ttactagagtagtaattaatattt-accgttaagtgaccgttggtagtattttaccgttaa 22762890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 40; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 60
Target Start/End: Original strand, 19668676 - 19668735
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtta 60  Q
    |||||||  |||||||||||||||||||||||||||||||||  ||||||||||| ||||    
19668676 ttactagaatagtaattagtattttaccgttaagtgaccgttaatagtattttactgtta 19668735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 38; E-Value: 0.0000000000003
Query Start/End: Original strand, 10 - 59
Target Start/End: Complemental strand, 723058 - 723009
Alignment:
10 tagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    |||| ||||||||||||||||||||||||||||| |||| ||||||||||    
723058 tagttattagtattttaccgttaagtgaccgttgttagtgttttaccgtt 723009  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 38; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 24885347 - 24885286
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||||||||||  |  |||||||||||||||||| ||||||||||| ||||||    
24885347 ttactagtgtagtaattagttgtgaaccgttaagtgaccgttgttagtattttactgttaag 24885286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 37; E-Value: 0.000000000001
Query Start/End: Original strand, 10 - 62
Target Start/End: Original strand, 22579411 - 22579463
Alignment:
10 tagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    |||||||| |||||||||||||| |||||||||| ||| ||||||||||||||    
22579411 tagtaatttgtattttaccgttaggtgaccgttggtagaattttaccgttaag 22579463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 35; E-Value: 0.00000000002
Query Start/End: Original strand, 9 - 59
Target Start/End: Complemental strand, 25306106 - 25306056
Alignment:
9 gtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    |||||||||||||||||||||||||||||  |||  |||||||||||||||    
25306106 gtagtaattagtattttaccgttaagtgattgttaatagtattttaccgtt 25306056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 33; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 60
Target Start/End: Original strand, 24086993 - 24087053
Alignment:
1 ttactagtgtagtaattagtattttaccg-ttaagtgaccgttgctagtattttaccgtta 60  Q
    ||||||| |||||||||| |||||||||| |||||||||||||| |  |||||||||||||    
24086993 ttactagagtagtaattaatattttaccgtttaagtgaccgttggtgatattttaccgtta 24087053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 32; E-Value: 0.000000001
Query Start/End: Original strand, 27 - 62
Target Start/End: Complemental strand, 7322199 - 7322164
Alignment:
27 ccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||||||| ||||||||||||||||||    
7322199 ccgttaagtgaccgttgatagtattttaccgttaag 7322164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 31; E-Value: 0.000000004
Query Start/End: Original strand, 17 - 59
Target Start/End: Original strand, 2828 - 2870
Alignment:
17 tagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    |||| |||||||||||||||||||||  |||||||||||||||    
2828 tagtgttttaccgttaagtgaccgttaatagtattttaccgtt 2870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 31; E-Value: 0.000000004
Query Start/End: Original strand, 17 - 59
Target Start/End: Complemental strand, 7322181 - 7322139
Alignment:
17 tagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    ||||||||||||||||||||||||||  |||||||||| ||||    
7322181 tagtattttaccgttaagtgaccgttagtagtattttatcgtt 7322139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 31; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 16936250 - 16936193
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    ||||||||||||| |||||| |||||||||| ||||||||||| |  ||||||||||||    
16936250 ttactagtgtagtgattagt-ttttaccgtttagtgaccgttggttatattttaccgtt 16936193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 31; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 17006910 - 17006853
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    ||||||||||||| |||||| |||||||||| ||||||||||| |  ||||||||||||    
17006910 ttactagtgtagtgattagt-ttttaccgtttagtgaccgttggttatattttaccgtt 17006853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 31; E-Value: 0.000000004
Query Start/End: Original strand, 10 - 60
Target Start/End: Original strand, 19433387 - 19433437
Alignment:
10 tagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtta 60  Q
    |||| |||||| |||||| ||||||||||||||| |||| |||||||||||    
19433387 tagttattagtgttttactgttaagtgaccgttgttagtgttttaccgtta 19433437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 31; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 22275425 - 22275368
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    |||||||||||||||||| | |||||||||| ||||||||||| |  ||||||||||||    
22275425 ttactagtgtagtaattaat-ttttaccgtttagtgaccgttggttatattttaccgtt 22275368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 31; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 23777630 - 23777687
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    ||||||||||||| |||||| |||||||||| ||||||||||| |  ||||||||||||    
23777630 ttactagtgtagtgattagt-ttttaccgtttagtgaccgttggttatattttaccgtt 23777687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 31; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 23821345 - 23821406
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctag-tattttaccgttaag 62  Q
    ||||||| ||| |||||||||||||||||||| ||||| |||| ||| |||||||||||||||    
23821345 ttactagggtaataattagtattttaccgttatgtgactgttg-tagatattttaccgttaag 23821406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 31; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 23830424 - 23830485
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctag-tattttaccgttaag 62  Q
    ||||||| ||| |||||||||||||||||||| ||||| |||| ||| |||||||||||||||    
23830424 ttactagggtaataattagtattttaccgttatgtgactgttg-tagatattttaccgttaag 23830485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 31; E-Value: 0.000000004
Query Start/End: Original strand, 5 - 55
Target Start/End: Original strand, 24340962 - 24341012
Alignment:
5 tagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttac 55  Q
    ||||||||||||||||||||||||||| |||||| |||  |||| ||||||    
24340962 tagtgtagtaattagtattttaccgtttagtgactgttaatagtgttttac 24341012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 31; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 25213736 - 25213679
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    ||||||||||||| |||||| |||||||||| ||||||||||| |  ||||||||||||    
25213736 ttactagtgtagtgattagt-ttttaccgtttagtgaccgttggttatattttaccgtt 25213679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 30; E-Value: 0.00000002
Query Start/End: Original strand, 10 - 59
Target Start/End: Complemental strand, 68662 - 68614
Alignment:
10 tagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    |||| ||||| ||||||||||||||||||||||| |||| ||||||||||    
68662 tagttattagaattttaccgttaagtgaccgttg-tagtgttttaccgtt 68614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 20 - 59
Target Start/End: Original strand, 23821392 - 23821431
Alignment:
20 tattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    |||||||||||||||||||||||  ||||| |||||||||    
23821392 tattttaccgttaagtgaccgttattagtaatttaccgtt 23821431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 20 - 59
Target Start/End: Original strand, 23830471 - 23830510
Alignment:
20 tattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    |||||||||||||||||||||||  ||||| |||||||||    
23830471 tattttaccgttaagtgaccgttattagtaatttaccgtt 23830510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 58; Significance: 3e-25; HSPs: 18)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 58; E-Value: 3e-25
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 17023686 - 17023625
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
17023686 ttactagtgtagtaattagtattttaccgttaagtgaccgttgttagtattttaccgttaag 17023625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 54; E-Value: 8e-23
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 17609610 - 17609549
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    |||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||    
17609610 ttactagtgtggtaattagtattttaccgttaagtgaccgttgttagtattttaccgttaag 17609549  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 54; E-Value: 8e-23
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 19603816 - 19603755
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||    
19603816 ttactagtgtagtaattaatattttaccgttaagtgaccgttgctagtattctaccgttaag 19603755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 50; E-Value: 2e-20
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 16646620 - 16646559
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||| ||||||||||||||||||||||||||||||||||| || |||||||||||||||    
16646620 ttactagggtagtaattagtattttaccgttaagtgaccgttggtaatattttaccgttaag 16646559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 47; E-Value: 1e-18
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 27675479 - 27675421
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    ||||||||||||||||||||||||||||||||||||| ||||  |||||||||||||||    
27675479 ttactagtgtagtaattagtattttaccgttaagtgatcgttaatagtattttaccgtt 27675421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 43; E-Value: 3e-16
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 51627232 - 51627290
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    ||||||| ||||||||||||||||||||||||||||||||||  ||||| |||||||||    
51627232 ttactagagtagtaattagtattttaccgttaagtgaccgttattagtaatttaccgtt 51627290  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 42; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 16657347 - 16657286
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||| |||||||||| || ||||||||||||||||||||| |||||||||||| |||||    
16657347 ttactagagtagtaattaatagtttaccgttaagtgaccgttggtagtattttaccattaag 16657286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 42; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 37233394 - 37233455
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    |||||||||| || |||||||||||||||||||||||| |||| | ||||||||||||||||    
37233394 ttactagtgtggttattagtattttaccgttaagtgactgttgttggtattttaccgttaag 37233455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 42; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 41219401 - 41219462
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||||||||||||||||| | || |||| |||||||||||||||||| |||||    
41219401 ttactagtgtagtaattagtattttactgataggtgatcgttgctagtattttaccattaag 41219462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 39; E-Value: 0.00000000000007
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 20177859 - 20177801
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    ||||||||||||||||||||||||||||||||||||| | ||  || ||||||||||||    
20177859 ttactagtgtagtaattagtattttaccgttaagtgatcattaataatattttaccgtt 20177801  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 38; E-Value: 0.0000000000003
Query Start/End: Original strand, 10 - 59
Target Start/End: Original strand, 22829000 - 22829049
Alignment:
10 tagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    |||| ||||||||||||||||||||||||||||| |||| ||||||||||    
22829000 tagttattagtattttaccgttaagtgaccgttgttagtgttttaccgtt 22829049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 33; E-Value: 0.0000000003
Query Start/End: Original strand, 14 - 62
Target Start/End: Original strand, 36355843 - 36355891
Alignment:
14 aattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||||| ||| |||||||| | ||||||||||||||||||    
36355843 aattagtattttaccattatgtgaccgtcggtagtattttaccgttaag 36355891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 32; E-Value: 0.000000001
Query Start/End: Original strand, 20 - 59
Target Start/End: Complemental strand, 16646573 - 16646534
Alignment:
20 tattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    |||||||||||||||||||||||  |||||||||||||||    
16646573 tattttaccgttaagtgaccgttaatagtattttaccgtt 16646534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 30; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 20954979 - 20955040
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||| |||||  | |||||||||||||||| ||||||||| || ||||||| |||||||    
20954979 ttactagggtagtggtcagtattttaccgttaaatgaccgttgttaatattttatcgttaag 20955040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 30; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 22142902 - 22142962
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    |||||||||| |||||||||| |  ||| |||||||||||||| ||||||||| ||||||||    
22142902 ttactagtgtggtaattagtagtgaaccattaagtgaccgttgttagtatttt-ccgttaag 22142962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 29; E-Value: 0.00000007
Query Start/End: Original strand, 26 - 62
Target Start/End: Original strand, 8537514 - 8537550
Alignment:
26 accgttaagtgaccgttgctagtattttaccgttaag 62  Q
    |||| ||||||||||||| ||||||||||||||||||    
8537514 accggtaagtgaccgttgttagtattttaccgttaag 8537550  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 29; E-Value: 0.00000007
Query Start/End: Original strand, 26 - 62
Target Start/End: Original strand, 8602753 - 8602789
Alignment:
26 accgttaagtgaccgttgctagtattttaccgttaag 62  Q
    |||| ||||||||||||| ||||||||||||||||||    
8602753 accggtaagtgaccgttgttagtattttaccgttaag 8602789  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 31 - 62
Target Start/End: Complemental strand, 21195654 - 21195623
Alignment:
31 taagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||| ||||||||||||||||||    
21195654 taagtgaccgttgttagtattttaccgttaag 21195623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0013 (Bit Score: 55; Significance: 2e-23; HSPs: 1)
Name: scaffold0013
Description:

Target: scaffold0013; HSP #1
Raw Score: 55; E-Value: 2e-23
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 36160 - 36102
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
36160 ttactagtgtagtaattagtattttaccgttaagtgaccgttgttagtattttaccgtt 36102  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1272 (Bit Score: 54; Significance: 8e-23; HSPs: 2)
Name: scaffold1272
Description:

Target: scaffold1272; HSP #1
Raw Score: 54; E-Value: 8e-23
Query Start/End: Original strand, 5 - 62
Target Start/End: Complemental strand, 986 - 929
Alignment:
5 tagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
986 tagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttatcgttaag 929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1272; HSP #2
Raw Score: 31; E-Value: 0.000000004
Query Start/End: Original strand, 17 - 59
Target Start/End: Complemental strand, 946 - 904
Alignment:
17 tagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    |||||||||| |||||||||||||||  |||||||||||||||    
946 tagtattttatcgttaagtgaccgttaatagtattttaccgtt 904  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0032 (Bit Score: 54; Significance: 8e-23; HSPs: 2)
Name: scaffold0032
Description:

Target: scaffold0032; HSP #1
Raw Score: 54; E-Value: 8e-23
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 93390 - 93451
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
93390 ttactagagtagtaattagtattttaccgttaagtgaccgttggtagtattttaccgttaag 93451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0032; HSP #2
Raw Score: 33; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 104159 - 104219
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaa 61  Q
    |||||||  |||||||||||  |  |||||||||||||||||| |||||||||||||||||    
104159 ttactagcatagtaattagtggtgaaccgttaagtgaccgttgttagtattttaccgttaa 104219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 54; Significance: 8e-23; HSPs: 19)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 54; E-Value: 8e-23
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 18381351 - 18381412
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||    
18381351 ttactagtgtagtaattagtattttaccgataagtgatcgttgctagtattttaccgttaag 18381412  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 51; E-Value: 5e-21
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 14152994 - 14152936
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    ||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||    
14152994 ttactagtgtagtaattagtattttaccgttaagtgaccgttattagtattttaccgtt 14152936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 50; E-Value: 2e-20
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 21623880 - 21623819
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||| ||||    
21623880 ttactagggtagtaattagtattttaccgttaagtgaccgttgttagtattttaccgctaag 21623819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 50; E-Value: 2e-20
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 22361303 - 22361364
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||| |||||||||| |||||||||||||||||||||||| ||||||||||||||||||    
22361303 ttactagggtagtaattaatattttaccgttaagtgaccgttgttagtattttaccgttaag 22361364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 46; E-Value: 5e-18
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 14128847 - 14128786
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||||||| |||||||||||||||||| |||||  ||||||||||||||||||    
14128847 ttactagtgtagtaattggtattttaccgttaagtggccgttattagtattttaccgttaag 14128786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 46; E-Value: 5e-18
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 17547220 - 17547281
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    |||||||||||||||||||||||||||| |||||| | ||||| ||||||||||||||||||    
17547220 ttactagtgtagtaattagtattttacctttaagtaatcgttgttagtattttaccgttaag 17547281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 42; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 18629147 - 18629208
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||||||||||  | ||||||||| ||||||||| ||||||||||||||||||    
18629147 ttactagtgtagtaattagttgtgtaccgttaaatgaccgttgttagtattttaccgttaag 18629208  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 37; E-Value: 0.000000000001
Query Start/End: Original strand, 4 - 59
Target Start/End: Original strand, 16887361 - 16887417
Alignment:
4 ctagtgtagtaattagtattttaccgttaagtgaccgttg-ctagtattttaccgtt 59  Q
    |||| |||||||||||||||||||||||||||||||||||  ||| |||||||||||    
16887361 ctagagtagtaattagtattttaccgttaagtgaccgttgtatagcattttaccgtt 16887417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 34; E-Value: 0.00000000007
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 27752125 - 27752064
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||| ||| ||||||||||||||||||||| ||||||||  |||| |||||||| ||||    
27752125 ttactagagtaataattagtattttaccgttaattgaccgttagtagtgttttaccgctaag 27752064  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 33; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 18399646 - 18399586
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaa 61  Q
    ||||||| ||| ||||||||||||||||||| ||||||| ||| |  ||||||||||||||    
18399646 ttactagagtaataattagtattttaccgtttagtgaccattggtgatattttaccgttaa 18399586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 33; E-Value: 0.0000000003
Query Start/End: Original strand, 18 - 62
Target Start/End: Complemental strand, 25654788 - 25654744
Alignment:
18 agtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    |||||||||||||||||||| ||||  ||||||||||||||||||    
25654788 agtattttaccgttaagtgatcgttattagtattttaccgttaag 25654744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 32; E-Value: 0.000000001
Query Start/End: Original strand, 16 - 59
Target Start/End: Original strand, 18629190 - 18629233
Alignment:
16 ttagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    |||||||||||||||||||||| ||||  |||||||||||||||    
18629190 ttagtattttaccgttaagtgatcgttattagtattttaccgtt 18629233  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 32; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 60
Target Start/End: Complemental strand, 25920293 - 25920234
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtta 60  Q
    |||||||  |||||||||||||||||||||| ||||||||||  ||||| |||| |||||    
25920293 ttactaggatagtaattagtattttaccgtttagtgaccgttattagtaatttatcgtta 25920234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 31; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 16299571 - 16299628
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    ||||||||||||| |||||| |||||||||| ||||||||||| |  ||||||||||||    
16299571 ttactagtgtagtgattagt-ttttaccgtttagtgaccgttggttatattttaccgtt 16299628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 30; E-Value: 0.00000002
Query Start/End: Original strand, 13 - 62
Target Start/End: Original strand, 25366797 - 25366846
Alignment:
13 taattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    |||||||||||||||||||| ||||||| || |  |||||||||||||||    
25366797 taattagtattttaccgttatgtgaccgatgttgatattttaccgttaag 25366846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 29; E-Value: 0.00000007
Query Start/End: Original strand, 6 - 58
Target Start/End: Original strand, 17082745 - 17082797
Alignment:
6 agtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgt 58  Q
    |||||||||||||||  |  |||||| ||||||||||| ||||||||||||||    
17082745 agtgtagtaattagtggtgaaccgtttagtgaccgttgttagtattttaccgt 17082797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 16 - 59
Target Start/End: Original strand, 21410631 - 21410674
Alignment:
16 ttagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    |||| ||||||||||||||||||||||  ||||| |||||||||    
21410631 ttagaattttaccgttaagtgaccgttattagtaatttaccgtt 21410674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 16 - 59
Target Start/End: Original strand, 22361346 - 22361389
Alignment:
16 ttagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    |||||||||||||||||||||| | ||  |||||||||||||||    
22361346 ttagtattttaccgttaagtgatcattaatagtattttaccgtt 22361389  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 20 - 59
Target Start/End: Original strand, 25366832 - 25366871
Alignment:
20 tattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    |||||||||||||||||||||||  ||||| |||||||||    
25366832 tattttaccgttaagtgaccgttattagtaatttaccgtt 25366871  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 54; Significance: 8e-23; HSPs: 23)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 54; E-Value: 8e-23
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 21222175 - 21222236
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    |||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||    
21222175 ttactagtgtggtaattagtattttaccgttaagtgaccgttgttagtattttaccgttaag 21222236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 52; E-Value: 1e-21
Query Start/End: Original strand, 1 - 60
Target Start/End: Complemental strand, 3674571 - 3674512
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtta 60  Q
    ||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||    
3674571 ttactagggtagtaattagtattttaccgttaagtgaccgttggtagtattttaccgtta 3674512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 50; E-Value: 2e-20
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 24224913 - 24224974
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    |||||||||| || ||||||||||||||||||||||||||||| ||||||||||||||||||    
24224913 ttactagtgtggttattagtattttaccgttaagtgaccgttgttagtattttaccgttaag 24224974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 46; E-Value: 5e-18
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 32965279 - 32965340
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||| |||||||||| |||||||| ||||||||||||||| ||||||||||||||||||    
32965279 ttactagggtagtaattaatattttactgttaagtgaccgttggtagtattttaccgttaag 32965340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 42; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 28902900 - 28902839
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||| |||||||||| || ||||||||||||||||||||| |||||||||||| |||||    
28902900 ttactagagtagtaattaatagtttaccgttaagtgaccgttggtagtattttaccattaag 28902839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 42; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 28939295 - 28939234
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||| |||||||||| || ||||||||||||||||||||| |||||||||||| |||||    
28939295 ttactagagtagtaattaatagtttaccgttaagtgaccgttggtagtattttaccattaag 28939234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 39; E-Value: 0.00000000000007
Query Start/End: Original strand, 16 - 62
Target Start/End: Complemental strand, 37984031 - 37983985
Alignment:
16 ttagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    |||||||||||||||||||||||||||| |||||| |||||||||||    
37984031 ttagtattttaccgttaagtgaccgttgttagtatcttaccgttaag 37983985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 37; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 23467141 - 23467081
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaa 61  Q
    ||||||| ||| |||||||||||||||||||| |||||||||| |  ||||||||||||||    
23467141 ttactagggtaataattagtattttaccgttatgtgaccgttgttgatattttaccgttaa 23467081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 36; E-Value: 0.000000000004
Query Start/End: Original strand, 7 - 62
Target Start/End: Original strand, 22053408 - 22053463
Alignment:
7 gtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||||||||||||||| |||||| |||  ||||||||||||| ||||    
22053408 gtgtagtaattagtattttaccgtttagtgactgttaatagtattttaccgctaag 22053463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 34; E-Value: 0.00000000007
Query Start/End: Original strand, 15 - 56
Target Start/End: Original strand, 21296753 - 21296794
Alignment:
15 attagtattttaccgttaagtgaccgttgctagtattttacc 56  Q
    ||||||||||||||||||||||||||||| |||| |||||||    
21296753 attagtattttaccgttaagtgaccgttgttagtgttttacc 21296794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 31; E-Value: 0.000000004
Query Start/End: Original strand, 16 - 62
Target Start/End: Original strand, 5450421 - 5450467
Alignment:
16 ttagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||| |||||||||| ||||  ||||||||||||||||||    
5450421 ttagtattttatcgttaagtgatcgttattagtattttaccgttaag 5450467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 31; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 7529594 - 7529537
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    |||||||||||||||||||| |||||||||| |||||| |||| |  ||||||||||||    
7529594 ttactagtgtagtaattagt-ttttaccgtttagtgactgttggttatattttaccgtt 7529537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 31; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 16106336 - 16106279
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    ||||||||||||| |||||| |||||||||| ||||||||||| |  ||||||||||||    
16106336 ttactagtgtagtgattagt-ttttaccgtttagtgaccgttgattatattttaccgtt 16106279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 31; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 16596182 - 16596124
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    ||||||| ||| | ||||||||||||| ||||||||||||||  ||||| |||||||||    
16596182 ttactagggtaatgattagtattttactgttaagtgaccgttattagtaatttaccgtt 16596124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 31; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 18777575 - 18777632
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    ||||||||||||| |||||| |||||||||| ||||||||||| |  ||||||||||||    
18777575 ttactagtgtagtgattagt-ttttaccgtttagtgaccgttggttatattttaccgtt 18777632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 30; E-Value: 0.00000002
Query Start/End: Original strand, 5 - 62
Target Start/End: Original strand, 18530641 - 18530698
Alignment:
5 tagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||||||||||||||||| ||| || |||  |||| |||||||| ||||    
18530641 tagtgtagtaattagtattttaccgtttagttactgttaatagtgttttaccgctaag 18530698  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 29; E-Value: 0.00000007
Query Start/End: Original strand, 9 - 60
Target Start/End: Complemental strand, 7729121 - 7729069
Alignment:
9 gtagtaattagtattttaccg-ttaagtgaccgttgctagtattttaccgtta 60  Q
    ||||||||||||||||||||| |||||||||| ||| |  |||||||||||||    
7729121 gtagtaattagtattttaccgtttaagtgaccattggtgatattttaccgtta 7729069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 29; E-Value: 0.00000007
Query Start/End: Original strand, 16 - 56
Target Start/End: Complemental strand, 23494584 - 23494544
Alignment:
16 ttagtattttaccgttaagtgaccgttgctagtattttacc 56  Q
    |||||||||||||||||||||||||||  ||||| ||||||    
23494584 ttagtattttaccgttaagtgaccgttattagtaatttacc 23494544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 31 - 62
Target Start/End: Complemental strand, 6457254 - 6457223
Alignment:
31 taagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||| ||||||||||||||||||    
6457254 taagtgaccgttgttagtattttaccgttaag 6457223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 60
Target Start/End: Complemental strand, 7425997 - 7425940
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtta 60  Q
    ||||||||||||| |||||| ||||||||||| |||||||||| |  |||||||||||||    
7425997 ttactagtgtagtgattagt-ttttaccgtta-gtgaccgttgattatattttaccgtta 7425940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 28
Target Start/End: Complemental strand, 25005523 - 25005496
Alignment:
1 ttactagtgtagtaattagtattttacc 28  Q
    ||||||||||||||||||||||||||||    
25005523 ttactagtgtagtaattagtattttacc 25005496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 31 - 62
Target Start/End: Complemental strand, 29918719 - 29918688
Alignment:
31 taagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||| ||||||||||||||||||    
29918719 taagtgaccgttgttagtattttaccgttaag 29918688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 56
Target Start/End: Complemental strand, 34939957 - 34939903
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttacc 56  Q
    ||||||||||||| |||||| |||||||||| ||||||||||| |  |||||||||    
34939957 ttactagtgtagtgattagt-ttttaccgtttagtgaccgttggttatattttacc 34939903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0025 (Bit Score: 50; Significance: 2e-20; HSPs: 2)
Name: scaffold0025
Description:

Target: scaffold0025; HSP #1
Raw Score: 50; E-Value: 2e-20
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 54015 - 53954
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||||| || ||||||    
54015 ttactagtgtagtaattagtattttaccgttaagtgaccgttgttagtatttcacagttaag 53954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0025; HSP #2
Raw Score: 34; E-Value: 0.00000000007
Query Start/End: Original strand, 5 - 62
Target Start/End: Complemental strand, 9539 - 9482
Alignment:
5 tagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||||||||||||||||| |||||| |||  |||| |||||||| ||||    
9539 tagtgtagtaattagtattttaccgtttagtgactgttaatagtgttttaccgctaag 9482  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 50; Significance: 2e-20; HSPs: 22)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 50; E-Value: 2e-20
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 16920245 - 16920188
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgt 58  Q
    ||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||    
16920245 ttactagggtagtaattagtattttaccgttaagtgaccgttgttagtattttaccgt 16920188  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 46; E-Value: 5e-18
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 9081314 - 9081253
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||| ||||||||||||| ||||||||||||||||||||| ||||||||||| ||||||    
9081314 ttactagggtagtaattagtactttaccgttaagtgaccgttggtagtattttactgttaag 9081253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 46; E-Value: 5e-18
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 13390065 - 13390004
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||| ||||||| ||||| |||||||||||||||||||||||||| |||||||||||||    
13390065 ttactagggtagtaagtagtactttaccgttaagtgaccgttgctagtgttttaccgttaag 13390004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 46; E-Value: 5e-18
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 16914493 - 16914554
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    |||||||||| || |||||||||||||||||||||||| |||| ||||||||||||||||||    
16914493 ttactagtgtggttattagtattttaccgttaagtgactgttgttagtattttaccgttaag 16914554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 42; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 14268438 - 14268499
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    |||||||||| || ||||||||||||||||||||||| ||||| | ||||||||||||||||    
14268438 ttactagtgtggttattagtattttaccgttaagtgatcgttgttggtattttaccgttaag 14268499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 42; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 48357325 - 48357264
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    |||||||||| || ||||||||||||||||||||||| ||||| | ||||||||||||||||    
48357325 ttactagtgtggttattagtattttaccgttaagtgatcgttgttggtattttaccgttaag 48357264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 40; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 56
Target Start/End: Complemental strand, 13378212 - 13378157
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttacc 56  Q
    ||||||| ||||||||||||||||||||||||||||||||||  |||||| |||||    
13378212 ttactagggtagtaattagtattttaccgttaagtgaccgttaatagtatgttacc 13378157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 38; E-Value: 0.0000000000003
Query Start/End: Original strand, 5 - 62
Target Start/End: Complemental strand, 15709847 - 15709790
Alignment:
5 tagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||||||||||||||||| |||||| |||  ||||||||||||| ||||    
15709847 tagtgtagtaattagtattttaccgtttagtgactgttaatagtattttaccgctaag 15709790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 37; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 12247660 - 12247720
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaa 61  Q
    ||||||| |||||||||| |||||||||||| |||||| |||| || ||||||||||||||    
12247660 ttactagagtagtaattaatattttaccgtttagtgactgttggtaatattttaccgttaa 12247720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 36; E-Value: 0.000000000004
Query Start/End: Original strand, 15 - 62
Target Start/End: Original strand, 34240786 - 34240833
Alignment:
15 attagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||||||||||||  ||||| ||||||||||||||||||    
34240786 attagtattttaccgttaagtggtcgttgttagtattttaccgttaag 34240833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 34; E-Value: 0.00000000007
Query Start/End: Original strand, 5 - 62
Target Start/End: Complemental strand, 36024832 - 36024775
Alignment:
5 tagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||||||||||||||||| |||||| |||  |||| |||||||| ||||    
36024832 tagtgtagtaattagtattttaccgtttagtgactgttaatagtgttttaccgctaag 36024775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 32; E-Value: 0.000000001
Query Start/End: Original strand, 16 - 59
Target Start/End: Complemental strand, 9611975 - 9611932
Alignment:
16 ttagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    ||||||| |||||||||||||||||||  |||||||||||||||    
9611975 ttagtatcttaccgttaagtgaccgttattagtattttaccgtt 9611932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 32; E-Value: 0.000000001
Query Start/End: Original strand, 16 - 59
Target Start/End: Complemental strand, 9839546 - 9839503
Alignment:
16 ttagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    ||||||| |||||||||||||||||||  |||||||||||||||    
9839546 ttagtatcttaccgttaagtgaccgttattagtattttaccgtt 9839503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 32; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 62
Target Start/End: Original strand, 14268484 - 14268527
Alignment:
19 gtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||||||||| ||||  ||||||||||||||||||    
14268484 gtattttaccgttaagtgatcgttaatagtattttaccgttaag 14268527  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 32; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 60
Target Start/End: Original strand, 16569546 - 16569605
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtta 60  Q
    ||||||| ||| |||||| |||||||||||| ||||||||||| |  |||||||||||||    
16569546 ttactagagtaataattaatattttaccgtttagtgaccgttggtgatattttaccgtta 16569605  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 32; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 60
Target Start/End: Complemental strand, 16596116 - 16596057
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtta 60  Q
    ||||||| ||| |||||| |||||||||||| ||||||||||| |  |||||||||||||    
16596116 ttactagagtaataattaatattttaccgtttagtgaccgttggtgatattttaccgtta 16596057  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 31; E-Value: 0.000000004
Query Start/End: Original strand, 17 - 59
Target Start/End: Complemental strand, 9081270 - 9081228
Alignment:
17 tagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    ||||||||||| ||||||||||||||  |||||||||||||||    
9081270 tagtattttactgttaagtgaccgttaatagtattttaccgtt 9081228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 31; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 18253430 - 18253487
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    ||||||||||||| |||||| |||||||||| ||||||||||| |  ||||||||||||    
18253430 ttactagtgtagtgattagt-ttttaccgtttagtgaccgttggtcatattttaccgtt 18253487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 31 - 62
Target Start/End: Complemental strand, 4485368 - 4485337
Alignment:
31 taagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||| ||||||||||||||||||    
4485368 taagtgaccgttgttagtattttaccgttaag 4485337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 31 - 62
Target Start/End: Original strand, 10332096 - 10332127
Alignment:
31 taagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||| ||||||||||||||||||    
10332096 taagtgaccgttgttagtattttaccgttaag 10332127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 26 - 61
Target Start/End: Complemental strand, 28722764 - 28722729
Alignment:
26 accgttaagtgaccgttgctagtattttaccgttaa 61  Q
    |||| ||||||||||||| |||||||||||||||||    
28722764 accggtaagtgaccgttgttagtattttaccgttaa 28722729  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 31 - 62
Target Start/End: Complemental strand, 31501822 - 31501791
Alignment:
31 taagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||| ||||||||||||||||||    
31501822 taagtgaccgttgttagtattttaccgttaag 31501791  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0700 (Bit Score: 46; Significance: 5e-18; HSPs: 1)
Name: scaffold0700
Description:

Target: scaffold0700; HSP #1
Raw Score: 46; E-Value: 5e-18
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 3207 - 3146
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||||||| ||||||||||||| ||||| ||||| ||||||||||||||||||    
3207 ttactagtgtagtaattcgtattttaccgttgagtgaacgttgttagtattttaccgttaag 3146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0483 (Bit Score: 46; Significance: 5e-18; HSPs: 2)
Name: scaffold0483
Description:

Target: scaffold0483; HSP #1
Raw Score: 46; E-Value: 5e-18
Query Start/End: Original strand, 5 - 62
Target Start/End: Complemental strand, 7369 - 7312
Alignment:
5 tagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||||||||||||||||||||||||| | |||||||||||| |||||||    
7369 tagtgtagtaattagtattttaccgttaagtgaccatagctagtattttatcgttaag 7312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0483; HSP #2
Raw Score: 32; E-Value: 0.000000001
Query Start/End: Original strand, 17 - 60
Target Start/End: Complemental strand, 7329 - 7286
Alignment:
17 tagtattttaccgttaagtgaccgttgctagtattttaccgtta 60  Q
    |||||||||| |||||||||||||||  ||||||||||||||||    
7329 tagtattttatcgttaagtgaccgttaatagtattttaccgtta 7286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0150 (Bit Score: 46; Significance: 5e-18; HSPs: 1)
Name: scaffold0150
Description:

Target: scaffold0150; HSP #1
Raw Score: 46; E-Value: 5e-18
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 29246 - 29185
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    |||||||||||||||||||||| ||||| ||||||||||||||||||| |||||| ||||||    
29246 ttactagtgtagtaattagtatcttaccattaagtgaccgttgctagtgttttactgttaag 29185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0010 (Bit Score: 46; Significance: 5e-18; HSPs: 2)
Name: scaffold0010
Description:

Target: scaffold0010; HSP #1
Raw Score: 46; E-Value: 5e-18
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 31730 - 31669
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    |||||||||| |||||||||||||||||||||  ||||||||| ||||||||||||||||||    
31730 ttactagtgtggtaattagtattttaccgttatatgaccgttgatagtattttaccgttaag 31669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0010; HSP #2
Raw Score: 38; E-Value: 0.0000000000003
Query Start/End: Original strand, 17 - 62
Target Start/End: Complemental strand, 31686 - 31641
Alignment:
17 tagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||||||||||||||||| |||||||||||| |||||    
31686 tagtattttaccgttaagtgaccgttgttagtattttaccattaag 31641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0327 (Bit Score: 42; Significance: 0.000000000000001; HSPs: 1)
Name: scaffold0327
Description:

Target: scaffold0327; HSP #1
Raw Score: 42; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 6377 - 6316
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||| |||||||||||||||||||| |||||||||||||| |  |||||||||||||||    
6377 ttactagagtagtaattagtattttacctttaagtgaccgttgttgatattttaccgttaag 6316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0138 (Bit Score: 42; Significance: 0.000000000000001; HSPs: 2)
Name: scaffold0138
Description:

Target: scaffold0138; HSP #1
Raw Score: 42; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 21967 - 22028
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||| ||||||||||||||||||||||||||||||| ||| |  |||||||||||||||    
21967 ttactagagtagtaattagtattttaccgttaagtgaccattgttgatattttaccgttaag 22028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0138; HSP #2
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 20 - 59
Target Start/End: Original strand, 22014 - 22053
Alignment:
20 tattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    |||||||||||||||||||||||  ||||| |||||||||    
22014 tattttaccgttaagtgaccgttattagtaatttaccgtt 22053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0123 (Bit Score: 42; Significance: 0.000000000000001; HSPs: 2)
Name: scaffold0123
Description:

Target: scaffold0123; HSP #1
Raw Score: 42; E-Value: 0.000000000000001
Query Start/End: Original strand, 9 - 62
Target Start/End: Complemental strand, 11575 - 11522
Alignment:
9 gtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||||||||| |||||||||| |||| ||||||||||||||||||    
11575 gtagtaattagtattttacggttaagtgacagttggtagtattttaccgttaag 11522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0123; HSP #2
Raw Score: 31; E-Value: 0.000000004
Query Start/End: Original strand, 17 - 59
Target Start/End: Complemental strand, 11539 - 11497
Alignment:
17 tagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    ||||||||||||||||||||||||||  ||| |||||||||||    
11539 tagtattttaccgttaagtgaccgttagtagcattttaccgtt 11497  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0016 (Bit Score: 42; Significance: 0.000000000000001; HSPs: 1)
Name: scaffold0016
Description:

Target: scaffold0016; HSP #1
Raw Score: 42; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 116095 - 116156
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    |||||||| |||||||||||||||||||||||||||||| ||| |  |||||||||||||||    
116095 ttactagtttagtaattagtattttaccgttaagtgaccattgttgatattttaccgttaag 116156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 42; Significance: 0.000000000000001; HSPs: 19)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 42; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 18277115 - 18277054
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    |||||| ||| || ||||||||||||||||||||||||||||  ||||||||||||||||||    
18277115 ttactattgtggttattagtattttaccgttaagtgaccgttattagtattttaccgttaag 18277054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 40885103 - 40885164
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||| |||||||||||||||||||||||||||| || ||| ||||| ||||||||||||    
40885103 ttactagagtagtaattagtattttaccgttaagtgcccattggtagtagtttaccgttaag 40885164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 42; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 47534617 - 47534678
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||| ||||||||||||||||| |||||| |||| |||||||| |||||||||    
47534617 ttactagtgtagtcattagtattttaccgtttagtgactgttgttagtatttaaccgttaag 47534678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 40; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 12244421 - 12244480
Alignment:
1 ttactagtgtagtaattagtatttt-accgttaagtgaccgttgctagtattttaccgtt 59  Q
    ||||||||||||||||||||||||| ||||||| |||||||||  |||||||||||||||    
12244421 ttactagtgtagtaattagtatttttaccgttacgtgaccgttagtagtattttaccgtt 12244480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 40; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 56
Target Start/End: Original strand, 18493676 - 18493731
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttacc 56  Q
    ||||||| ||||||||||||||| |||||||||||||||||| ||||| |||||||    
18493676 ttactagagtagtaattagtattctaccgttaagtgaccgttactagtgttttacc 18493731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 38; E-Value: 0.0000000000003
Query Start/End: Original strand, 9 - 62
Target Start/End: Original strand, 41165515 - 41165568
Alignment:
9 gtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||| ||| |||| ||||||||||||||||||| |||||||||||||    
41165515 gtagtaattagaattataccattaagtgaccgttgctagtgttttaccgttaag 41165568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 35; E-Value: 0.00000000002
Query Start/End: Original strand, 9 - 59
Target Start/End: Original strand, 52265085 - 52265135
Alignment:
9 gtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    |||||||||| |||||||||||||||||||||||  ||||| |||||||||    
52265085 gtagtaattaatattttaccgttaagtgaccgttattagtaatttaccgtt 52265135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 34; E-Value: 0.00000000007
Query Start/End: Original strand, 2 - 62
Target Start/End: Complemental strand, 7850682 - 7850621
Alignment:
2 tactagtgtagtaattagta-ttttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    |||||||||||||||||||| |||||||||| ||||||||||  |||| |||||||| ||||    
7850682 tactagtgtagtaattagtatttttaccgtttagtgaccgttaatagtgttttaccgctaag 7850621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 34; E-Value: 0.00000000007
Query Start/End: Original strand, 5 - 62
Target Start/End: Original strand, 10103823 - 10103880
Alignment:
5 tagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||||||||||||||||| |||||| |||  |||| |||||||| ||||    
10103823 tagtgtagtaattagtattttaccgtttagtgactgttaatagtgttttaccgctaag 10103880  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 34; E-Value: 0.00000000007
Query Start/End: Original strand, 5 - 62
Target Start/End: Original strand, 15674662 - 15674719
Alignment:
5 tagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||||||||||||||||| |||||| |||  |||| |||||||| ||||    
15674662 tagtgtagtaattagtattttaccgtttagtgactgttaatagtgttttaccgctaag 15674719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 34; E-Value: 0.00000000007
Query Start/End: Original strand, 5 - 62
Target Start/End: Complemental strand, 33241390 - 33241333
Alignment:
5 tagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||||||||||||||||| |||||| |||  |||| |||||||| ||||    
33241390 tagtgtagtaattagtattttaccgtttagtgactgttaatagtgttttaccgctaag 33241333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 31; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 19021155 - 19021098
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    ||||||||||||| |||||| |||||||||| ||||||||||| |  ||||||||||||    
19021155 ttactagtgtagtgattagt-ttttaccgtttagtgaccgttggttatattttaccgtt 19021098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 30; E-Value: 0.00000002
Query Start/End: Original strand, 10 - 59
Target Start/End: Complemental strand, 15045498 - 15045450
Alignment:
10 tagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    |||| ||||| ||||||||||||||||||||||| |||| ||||||||||    
15045498 tagttattagaattttaccgttaagtgaccgttg-tagtgttttaccgtt 15045450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 30; E-Value: 0.00000002
Query Start/End: Original strand, 10 - 59
Target Start/End: Original strand, 15108926 - 15108974
Alignment:
10 tagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    |||| ||||| ||||||||||||||||||||||| |||| ||||||||||    
15108926 tagttattagaattttaccgttaagtgaccgttg-tagtgttttaccgtt 15108974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 30; E-Value: 0.00000002
Query Start/End: Original strand, 5 - 62
Target Start/End: Complemental strand, 31133004 - 31132947
Alignment:
5 tagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    |||||||||||||||||||||| |||| |||||| |||  |||| |||||||| ||||    
31133004 tagtgtagtaattagtattttagcgtttagtgactgttaatagtgttttaccgctaag 31132947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 30; E-Value: 0.00000002
Query Start/End: Original strand, 10 - 59
Target Start/End: Original strand, 34177223 - 34177272
Alignment:
10 tagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    |||| ||||| ||||||||||||||||||||||  ||||| |||||||||    
34177223 tagttattagaattttaccgttaagtgaccgttattagtaatttaccgtt 34177272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 29; E-Value: 0.00000007
Query Start/End: Original strand, 3 - 59
Target Start/End: Complemental strand, 9795894 - 9795839
Alignment:
3 actagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    ||||||||||| |||||| |||||||||| ||||||||||| |  ||||||||||||    
9795894 actagtgtagtgattagt-ttttaccgtttagtgaccgttggttatattttaccgtt 9795839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 31 - 62
Target Start/End: Complemental strand, 38765358 - 38765327
Alignment:
31 taagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||| ||||||||||||||||||    
38765358 taagtgaccgttgttagtattttaccgttaag 38765327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 31 - 62
Target Start/End: Original strand, 41255966 - 41255997
Alignment:
31 taagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||| ||||||||||||||||||    
41255966 taagtgaccgttgttagtattttaccgttaag 41255997  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0554 (Bit Score: 40; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0554
Description:

Target: scaffold0554; HSP #1
Raw Score: 40; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 60
Target Start/End: Complemental strand, 2622 - 2563
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtta 60  Q
    |||||||  ||| ||||| |||||||||||||||||||||||||||| ||||||||||||    
2622 ttactagattagaaattaatattttaccgttaagtgaccgttgctagaattttaccgtta 2563  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0021 (Bit Score: 40; Significance: 0.00000000000002; HSPs: 3)
Name: scaffold0021
Description:

Target: scaffold0021; HSP #1
Raw Score: 40; E-Value: 0.00000000000002
Query Start/End: Original strand, 10 - 61
Target Start/End: Complemental strand, 16598 - 16547
Alignment:
10 tagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaa 61  Q
    ||||||||| |||||||||||||||||||||||| ||| |||||||||||||    
16598 tagtaattaatattttaccgttaagtgaccgttggtagaattttaccgttaa 16547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0021; HSP #2
Raw Score: 40; E-Value: 0.00000000000002
Query Start/End: Original strand, 10 - 61
Target Start/End: Complemental strand, 26129 - 26078
Alignment:
10 tagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaa 61  Q
    ||||||||| |||||||||||||||||||||||| ||| |||||||||||||    
26129 tagtaattaatattttaccgttaagtgaccgttggtagaattttaccgttaa 26078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0021; HSP #3
Raw Score: 37; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 12760 - 12700
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaa 61  Q
    |||||||  ||||||||| |||||||||||||| ||||||||| ||| |||||||||||||    
12760 ttactagattagtaattaatattttaccgttaactgaccgttggtagaattttaccgttaa 12700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0643 (Bit Score: 39; Significance: 0.00000000000007; HSPs: 1)
Name: scaffold0643
Description:

Target: scaffold0643; HSP #1
Raw Score: 39; E-Value: 0.00000000000007
Query Start/End: Original strand, 1 - 55
Target Start/End: Complemental strand, 193 - 139
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttac 55  Q
    ||||||| ||||||||||||||||||||||||||||||||||  ||||| |||||    
193 ttactagggtagtaattagtattttaccgttaagtgaccgttattagtaatttac 139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0058 (Bit Score: 39; Significance: 0.00000000000007; HSPs: 1)
Name: scaffold0058
Description:

Target: scaffold0058; HSP #1
Raw Score: 39; E-Value: 0.00000000000007
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 69875 - 69933
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    ||||||| ||||||||||||||||||||||||||| ||||||  |||||||||| ||||    
69875 ttactagagtagtaattagtattttaccgttaagtaaccgttaatagtattttatcgtt 69933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0151 (Bit Score: 38; Significance: 0.0000000000003; HSPs: 1)
Name: scaffold0151
Description:

Target: scaffold0151; HSP #1
Raw Score: 38; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 21954 - 22015
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||||||||||  |  ||||||||||||| |||| ||||||||||||||||||    
21954 ttactagtgtagtaattagttgtgaaccgttaagtgactgttgttagtattttaccgttaag 22015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0006 (Bit Score: 38; Significance: 0.0000000000003; HSPs: 1)
Name: scaffold0006
Description:

Target: scaffold0006; HSP #1
Raw Score: 38; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 196818 - 196878
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    |||||||||| || ||||||||||||||||||| ||| ||||| ||||||||||||||||||    
196818 ttactagtgtggttattagtattttaccgttaactga-cgttgttagtattttaccgttaag 196878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0031 (Bit Score: 37; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0031
Description:

Target: scaffold0031; HSP #1
Raw Score: 37; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 71320 - 71260
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaa 61  Q
    ||||||| ||| ||||||||||||||||||| ||||||||||| |  ||||||||||||||    
71320 ttactagagtaataattagtattttaccgtttagtgaccgttggtgatattttaccgttaa 71260  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0103 (Bit Score: 36; Significance: 0.000000000004; HSPs: 1)
Name: scaffold0103
Description:

Target: scaffold0103; HSP #1
Raw Score: 36; E-Value: 0.000000000004
Query Start/End: Original strand, 1 - 60
Target Start/End: Complemental strand, 34361 - 34302
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtta 60  Q
    |||||||  |||||||||||||||||||||| ||||||||||| |  |||||||||||||    
34361 ttactagattagtaattagtattttaccgtttagtgaccgttggtgatattttaccgtta 34302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0014 (Bit Score: 36; Significance: 0.000000000004; HSPs: 1)
Name: scaffold0014
Description:

Target: scaffold0014; HSP #1
Raw Score: 36; E-Value: 0.000000000004
Query Start/End: Original strand, 1 - 60
Target Start/End: Complemental strand, 160006 - 159947
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtta 60  Q
    ||||||| ||| |||||| |||||||||| ||||||||||||| |||| |||||||||||    
160006 ttactagagtaataattaatattttaccgataagtgaccgttggtagtgttttaccgtta 159947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0022 (Bit Score: 35; Significance: 0.00000000002; HSPs: 2)
Name: scaffold0022
Description:

Target: scaffold0022; HSP #1
Raw Score: 35; E-Value: 0.00000000002
Query Start/End: Original strand, 13 - 59
Target Start/End: Original strand, 102525 - 102571
Alignment:
13 taattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    ||||||||||||||||||||||||||||||  ||||| |||||||||    
102525 taattagtattttaccgttaagtgaccgttattagtaatttaccgtt 102571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0022; HSP #2
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 31 - 62
Target Start/End: Complemental strand, 132464 - 132433
Alignment:
31 taagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||| ||||||||||||||||||    
132464 taagtgaccgttgttagtattttaccgttaag 132433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1295 (Bit Score: 34; Significance: 0.00000000007; HSPs: 2)
Name: scaffold1295
Description:

Target: scaffold1295; HSP #1
Raw Score: 34; E-Value: 0.00000000007
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 812 - 751
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||| |||||||||| ||||||||||||| |||||| ||| |  |||||||||||||||    
812 ttactagggtagtaattaatattttaccgttacgtgacccttgttgatattttaccgttaag 751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1295; HSP #2
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 20 - 59
Target Start/End: Complemental strand, 765 - 726
Alignment:
20 tattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    |||||||||||||||||||||||  ||||| |||||||||    
765 tattttaccgttaagtgaccgttattagtaatttaccgtt 726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0610 (Bit Score: 34; Significance: 0.00000000007; HSPs: 1)
Name: scaffold0610
Description:

Target: scaffold0610; HSP #1
Raw Score: 34; E-Value: 0.00000000007
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 132 - 193
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||| ||||| ||||||||||||||||| ||| ||||||| | |||||||||| |||||    
132 ttactagagtagtgattagtattttaccgtttagttaccgttggtggtattttacccttaag 193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0507 (Bit Score: 34; Significance: 0.00000000007; HSPs: 1)
Name: scaffold0507
Description:

Target: scaffold0507; HSP #1
Raw Score: 34; E-Value: 0.00000000007
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 1078 - 1139
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||| |||||||||| ||||||||||||| ||||||||||    |||||||||||||||    
1078 ttactagggtagtaattaatattttaccgttacgtgaccgttgtcgatattttaccgttaag 1139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0120 (Bit Score: 34; Significance: 0.00000000007; HSPs: 1)
Name: scaffold0120
Description:

Target: scaffold0120; HSP #1
Raw Score: 34; E-Value: 0.00000000007
Query Start/End: Original strand, 5 - 42
Target Start/End: Original strand, 27566 - 27603
Alignment:
5 tagtgtagtaattagtattttaccgttaagtgaccgtt 42  Q
    ||||||||||||||||||||||||||| ||||||||||    
27566 tagtgtagtaattagtattttaccgtttagtgaccgtt 27603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0095 (Bit Score: 33; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0095
Description:

Target: scaffold0095; HSP #1
Raw Score: 33; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 60
Target Start/End: Original strand, 33267 - 33327
Alignment:
1 ttactagtgtagtaattagtattttaccg-ttaagtgaccgttgctagtattttaccgtta 60  Q
    ||||||| ||||||||||||||||||||| || ||||||||||| |  |||||||||||||    
33267 ttactagagtagtaattagtattttaccgttttagtgaccgttggtgatattttaccgtta 33327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0480 (Bit Score: 32; Significance: 0.000000001; HSPs: 1)
Name: scaffold0480
Description:

Target: scaffold0480; HSP #1
Raw Score: 32; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 56
Target Start/End: Original strand, 8450 - 8505
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttacc 56  Q
    |||||||  ||||||||||||||||||| |||||||||||||  ||||| ||||||    
8450 ttactagaatagtaattagtattttaccattaagtgaccgttattagtaatttacc 8505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0409 (Bit Score: 32; Significance: 0.000000001; HSPs: 2)
Name: scaffold0409
Description:

Target: scaffold0409; HSP #1
Raw Score: 32; E-Value: 0.000000001
Query Start/End: Original strand, 11 - 58
Target Start/End: Original strand, 925 - 972
Alignment:
11 agtaattagtattttaccgttaagtgaccgttgctagtattttaccgt 58  Q
    ||||||||||||||||||||||||||||| ||  ||| ||||||||||    
925 agtaattagtattttaccgttaagtgacctttaatagcattttaccgt 972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0409; HSP #2
Raw Score: 32; E-Value: 0.000000001
Query Start/End: Original strand, 11 - 58
Target Start/End: Original strand, 9180 - 9227
Alignment:
11 agtaattagtattttaccgttaagtgaccgttgctagtattttaccgt 58  Q
    ||||||||||||||||||||||||||||| ||  ||| ||||||||||    
9180 agtaattagtattttaccgttaagtgacctttaatagcattttaccgt 9227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0162 (Bit Score: 32; Significance: 0.000000001; HSPs: 1)
Name: scaffold0162
Description:

Target: scaffold0162; HSP #1
Raw Score: 32; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 62
Target Start/End: Original strand, 6607 - 6650
Alignment:
19 gtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||||||||| ||||  ||||||||||||||||||    
6607 gtattttaccgttaagtgatcgttattagtattttaccgttaag 6650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0118 (Bit Score: 32; Significance: 0.000000001; HSPs: 1)
Name: scaffold0118
Description:

Target: scaffold0118; HSP #1
Raw Score: 32; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 56
Target Start/End: Original strand, 34018 - 34072
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttacc 56  Q
    |||||||||||||||||||| |||||||||| ||||||||||| |  |||||||||    
34018 ttactagtgtagtaattagt-ttttaccgtttagtgaccgttggttatattttacc 34072  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0682 (Bit Score: 31; Significance: 0.000000004; HSPs: 1)
Name: scaffold0682
Description:

Target: scaffold0682; HSP #1
Raw Score: 31; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 8127 - 8184
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    |||||||||||||||||||| ||||||| || ||||||||||| |  ||||||||||||    
8127 ttactagtgtagtaattagt-ttttaccatttagtgaccgttggttatattttaccgtt 8184  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0387 (Bit Score: 31; Significance: 0.000000004; HSPs: 1)
Name: scaffold0387
Description:

Target: scaffold0387; HSP #1
Raw Score: 31; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 6765 - 6822
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    ||||||||||||| |||||| |||||||||| ||||||||||| |  ||||||||||||    
6765 ttactagtgtagtgattagt-ttttaccgtttagtgaccgttggtcatattttaccgtt 6822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0207 (Bit Score: 31; Significance: 0.000000004; HSPs: 1)
Name: scaffold0207
Description:

Target: scaffold0207; HSP #1
Raw Score: 31; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 11369 - 11312
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    |||||||||||||||||||| ||||||| || ||||||||||| |  ||||||||||||    
11369 ttactagtgtagtaattagt-ttttaccatttagtgaccgttggttatattttaccgtt 11312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0173 (Bit Score: 31; Significance: 0.000000004; HSPs: 1)
Name: scaffold0173
Description:

Target: scaffold0173; HSP #1
Raw Score: 31; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 5903 - 5846
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    ||||||||||||| |||||| |||||||||| ||||||||||| |  ||||||||||||    
5903 ttactagtgtagtgattagt-ttttaccgtttagtgaccgttggttatattttaccgtt 5846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0125 (Bit Score: 31; Significance: 0.000000004; HSPs: 1)
Name: scaffold0125
Description:

Target: scaffold0125; HSP #1
Raw Score: 31; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 43613 - 43556
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    ||||||||||||| |||||| |||||||||| ||||||||||| |  ||||||||||||    
43613 ttactagtgtagtgattagt-ttttaccgtttagtgaccgttggttatattttaccgtt 43556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0075 (Bit Score: 31; Significance: 0.000000004; HSPs: 1)
Name: scaffold0075
Description:

Target: scaffold0075; HSP #1
Raw Score: 31; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 34041 - 34098
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    ||||||||||||| |||||| |||||||||| ||||||||||| |  ||||||||||||    
34041 ttactagtgtagtgattagt-ttttaccgtttagtgaccgttggttatattttaccgtt 34098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0001 (Bit Score: 31; Significance: 0.000000004; HSPs: 1)
Name: scaffold0001
Description:

Target: scaffold0001; HSP #1
Raw Score: 31; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 164563 - 164620
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    ||||||||||||| |||||| |||||||||| ||||||||||| |  ||||||||||||    
164563 ttactagtgtagtgattagt-ttttaccgtttagtgaccgttggtcatattttaccgtt 164620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0004 (Bit Score: 30; Significance: 0.00000002; HSPs: 1)
Name: scaffold0004
Description:

Target: scaffold0004; HSP #1
Raw Score: 30; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 28178 - 28117
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    |||||||||| |||||||||  |  |||| ||||||| ||||| ||||||||||||||||||    
28178 ttactagtgtggtaattagttgtgaaccggtaagtgatcgttgttagtattttaccgttaag 28117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1932 (Bit Score: 29; Significance: 0.00000007; HSPs: 2)
Name: scaffold1932
Description:

Target: scaffold1932; HSP #1
Raw Score: 29; E-Value: 0.00000007
Query Start/End: Original strand, 6 - 62
Target Start/End: Original strand, 944 - 1000
Alignment:
6 agtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaag 62  Q
    |||||||||||||||  |  |||||| ||||||||||| ||| ||||||||||||||    
944 agtgtagtaattagtggtgaaccgtttagtgaccgttgttagcattttaccgttaag 1000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1932; HSP #2
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 16 - 59
Target Start/End: Original strand, 982 - 1025
Alignment:
16 ttagtattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    |||| ||||||||||||||||||||||  ||| |||||||||||    
982 ttagcattttaccgttaagtgaccgttagtagcattttaccgtt 1025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0521 (Bit Score: 29; Significance: 0.00000007; HSPs: 1)
Name: scaffold0521
Description:

Target: scaffold0521; HSP #1
Raw Score: 29; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 11803 - 11743
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgttaa 61  Q
    ||||||||||||||||||||  |  |||||| ||||||| ||| |||||||| ||||||||    
11803 ttactagtgtagtaattagtggtaaaccgttcagtgaccattgttagtatttcaccgttaa 11743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0389 (Bit Score: 28; Significance: 0.0000003; HSPs: 1)
Name: scaffold0389
Description:

Target: scaffold0389; HSP #1
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 20 - 59
Target Start/End: Complemental strand, 11321 - 11282
Alignment:
20 tattttaccgttaagtgaccgttgctagtattttaccgtt 59  Q
    |||||||||||||||||||||||  ||||| |||||||||    
11321 tattttaccgttaagtgaccgttattagtaatttaccgtt 11282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0357 (Bit Score: 28; Significance: 0.0000003; HSPs: 1)
Name: scaffold0357
Description:

Target: scaffold0357; HSP #1
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 31 - 62
Target Start/End: Complemental strand, 7065 - 7034
Alignment:
31 taagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||| ||||||||||||||||||||||    
7065 taagtgaccattgctagtattttaccgttaag 7034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0342 (Bit Score: 28; Significance: 0.0000003; HSPs: 1)
Name: scaffold0342
Description:

Target: scaffold0342; HSP #1
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 60
Target Start/End: Complemental strand, 12975 - 12916
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtta 60  Q
    ||||||| |||||||||||||||||||| || ||||  ||||| |  |||||||||||||    
12975 ttactagagtagtaattagtattttaccatttagtggtcgttggtgatattttaccgtta 12916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0338 (Bit Score: 28; Significance: 0.0000003; HSPs: 1)
Name: scaffold0338
Description:

Target: scaffold0338; HSP #1
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 60
Target Start/End: Complemental strand, 9693 - 9634
Alignment:
1 ttactagtgtagtaattagtattttaccgttaagtgaccgttgctagtattttaccgtta 60  Q
    ||||||| ||| ||||||   |||||||||| ||||||||||| || |||||||||||||    
9693 ttactagagtaataattaaggttttaccgtttagtgaccgttggtaatattttaccgtta 9634  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0080 (Bit Score: 28; Significance: 0.0000003; HSPs: 1)
Name: scaffold0080
Description:

Target: scaffold0080; HSP #1
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 31 - 62
Target Start/End: Original strand, 23282 - 23313
Alignment:
31 taagtgaccgttgctagtattttaccgttaag 62  Q
    ||||||||||||| ||||||||||||||||||    
23282 taagtgaccgttgttagtattttaccgttaag 23313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 93657 times since January 2019
Visitors: 2365