View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 454-NF4349-Insertion-22 (Length: 107)

Name: 454-NF4349-Insertion-22
Description: 454-NF4349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] 454-NF4349-Insertion-22
[»] chr7 (1 HSPs)
chr7 (4-107)||(48080608-48080711)

Alignment Details
Target: chr7 (Bit Score: 96; Significance: 1e-47; HSPs: 1)
Name: chr7

Target: chr7; HSP #1
Raw Score: 96; E-Value: 1e-47
Query Start/End: Original strand, 4 - 107
Target Start/End: Original strand, 48080608 - 48080711
4 aaatagaagttcttgaatgtttataaactttgagtgtttgagtgttcattgtacacaattgatgtttcaaccttgttttgaatttttgttgggacatttg 103  Q
    |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
48080608 aaatagaagttcttgattgtttataaactttgagtgtttgagtgttcattgtacacaattgatgtttcaaccttgttttgaatttttgttgggacatttt 48080707  T
104 ttag 107  Q
48080708 ttag 48080711  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC