View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 454-NF4349-Insertion-24 (Length: 108)

Name: 454-NF4349-Insertion-24
Description: 454-NF4349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] 454-NF4349-Insertion-24
[»] chr8 (3 HSPs)
chr8 (1-108)||(14183085-14183192)
chr8 (1-104)||(40717842-40717945)
chr8 (8-108)||(14192030-14192130)
[»] chr6 (1 HSPs)
chr6 (1-108)||(34302796-34302903)
[»] chr5 (2 HSPs)
chr5 (1-108)||(34665832-34665939)
chr5 (9-108)||(34646146-34646245)
[»] chr4 (1 HSPs)
chr4 (1-108)||(45645334-45645441)

Alignment Details
Target: chr8 (Bit Score: 104; Significance: 2e-52; HSPs: 3)
Name: chr8

Target: chr8; HSP #1
Raw Score: 104; E-Value: 2e-52
Query Start/End: Original strand, 1 - 108
Target Start/End: Original strand, 14183085 - 14183192
1 ctaaaactgtgataggatgtggaactgataatacagtgtcatttgaaggtgcaagttctggtatagttggccttggaggtggaccagcatctcttattac 100  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14183085 ctaaaactgtgataggatgtggaactgacaatacagtgtcatttgaaggtgcaagttctggtatagttggccttggaggtggaccagcatctcttattac 14183184  T
101 acaattgg 108  Q
14183185 acaattgg 14183192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 60; E-Value: 4e-26
Query Start/End: Original strand, 1 - 104
Target Start/End: Original strand, 40717842 - 40717945
1 ctaaaactgtgataggatgtggaactgataatacagtgtcatttgaaggtgcaagttctggtatagttggccttggaggtggaccagcatctcttattac 100  Q
    |||||||||||||||||||||||||  | ||||||||||| ||| |||||||||| |||||||||||||||||||||||||| || |  |||||||| ||    
40717842 ctaaaactgtgataggatgtggaaccaacaatacagtgtcgtttaaaggtgcaagctctggtatagttggccttggaggtggtcccgtgtctcttataac 40717941  T
101 acaa 104  Q
40717942 acaa 40717945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000001
Query Start/End: Original strand, 8 - 108
Target Start/End: Original strand, 14192030 - 14192130
8 tgtgataggatgtggaactgataatacagtgtcatttgaaggtgcaagttctggtatagttggccttggaggtggaccagcatctcttattacacaattg 107  Q
    ||||||||||||||||||| | ||||   |||| | |||||| ||||| |||||||| |||||| | ||| ||||||| || ||| |||| || ||||||    
14192030 tgtgataggatgtggaactaacaatattttgtcctatgaaggcgcaagctctggtatcgttggcttcggaagtggacccgcgtcttttatcactcaattg 14192129  T
108 g 108  Q
14192130 g 14192130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 48; Significance: 6e-19; HSPs: 1)
Name: chr6

Target: chr6; HSP #1
Raw Score: 48; E-Value: 6e-19
Query Start/End: Original strand, 1 - 108
Target Start/End: Original strand, 34302796 - 34302903
1 ctaaaactgtgataggatgtggaactgataatacagtgtcatttgaaggtgcaagttctggtatagttggccttggaggtggaccagcatctcttattac 100  Q
    |||||||||| ||||||||||||||| | |||| || ||| ||| || | | ||| |||||| |||||||||||||||||||||| |||||||| || ||    
34302796 ctaaaactgttataggatgtggaactaacaatatagggtcgtttaaacgcgtaagctctggtgtagttggccttggaggtggacctgcatctctaataac 34302895  T
101 acaattgg 108  Q
34302896 acaattgg 34302903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 44; Significance: 1e-16; HSPs: 2)
Name: chr5

Target: chr5; HSP #1
Raw Score: 44; E-Value: 1e-16
Query Start/End: Original strand, 1 - 108
Target Start/End: Original strand, 34665832 - 34665939
1 ctaaaactgtgataggatgtggaactgataatacagtgtcatttgaaggtgcaagttctggtatagttggccttggaggtggaccagcatctcttattac 100  Q
    ||||||| |||||||| ||||||||||||||| | | | | |||| ||||||||| ||||||||||||||||||||||| || || |  ||||| || ||    
34665832 ctaaaacagtgataggttgtggaactgataatgcggggacgtttggaggtgcaagctctggtatagttggccttggaggcgggccggtgtctctcataac 34665931  T
101 acaattgg 108  Q
34665932 acaattgg 34665939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.000000000009
Query Start/End: Original strand, 9 - 108
Target Start/End: Original strand, 34646146 - 34646245
9 gtgataggatgtggaactgataatacagtgtcatttgaaggtgcaagttctggtatagttggccttggaggtggaccagcatctcttattacacaattgg 108  Q
    |||||||| ||||||||||||||| | | | | |||| ||| ||||| ||||||||||||||||||||||| || || |  ||||| || ||||||||||    
34646146 gtgataggttgtggaactgataatgcggggacgtttggaggcgcaagctctggtatagttggccttggaggcgggccggtgtctctcataacacaattgg 34646245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 41; Significance: 0.000000000000009; HSPs: 1)
Name: chr4

Target: chr4; HSP #1
Raw Score: 41; E-Value: 0.000000000000009
Query Start/End: Original strand, 1 - 108
Target Start/End: Original strand, 45645334 - 45645441
1 ctaaaactgtgataggatgtggaactgataatacagtgtcatttgaaggtgcaagt-tctggtatagttggccttggaggtggaccagcatctcttatta 99  Q
    |||||||||||||||||||||||| | | ||||| | ||| |||| ||||||| |  ||||||||||| |||||||||||||||||||  ||||| || |    
45645334 ctaaaactgtgataggatgtggaaataacaatacgg-gtcgtttggaggtgcagggctctggtatagtgggccttggaggtggaccagtgtctctaataa 45645432  T
100 cacaattgg 108  Q
45645433 cacaattgg 45645441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 77619 times since January 2019
Visitors: 2276