View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 454-NF4349-Insertion-24 (Length: 108)

Name: 454-NF4349-Insertion-24
Description: 454-NF4349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 454-NF4349-Insertion-24
454-NF4349-Insertion-24
[»] chr8 (3 HSPs)
chr8 (1-108)||(14183085-14183192)
chr8 (1-104)||(40717842-40717945)
chr8 (8-108)||(14192030-14192130)
[»] chr6 (1 HSPs)
chr6 (1-108)||(34302796-34302903)
[»] chr5 (2 HSPs)
chr5 (1-108)||(34665832-34665939)
chr5 (9-108)||(34646146-34646245)
[»] chr4 (1 HSPs)
chr4 (1-108)||(45645334-45645441)


Alignment Details
Target: chr8 (Bit Score: 104; Significance: 2e-52; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 104; E-Value: 2e-52
Query Start/End: Original strand, 1 - 108
Target Start/End: Original strand, 14183085 - 14183192
Alignment:
1 ctaaaactgtgataggatgtggaactgataatacagtgtcatttgaaggtgcaagttctggtatagttggccttggaggtggaccagcatctcttattac 100  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14183085 ctaaaactgtgataggatgtggaactgacaatacagtgtcatttgaaggtgcaagttctggtatagttggccttggaggtggaccagcatctcttattac 14183184  T
101 acaattgg 108  Q
    ||||||||    
14183185 acaattgg 14183192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 60; E-Value: 4e-26
Query Start/End: Original strand, 1 - 104
Target Start/End: Original strand, 40717842 - 40717945
Alignment:
1 ctaaaactgtgataggatgtggaactgataatacagtgtcatttgaaggtgcaagttctggtatagttggccttggaggtggaccagcatctcttattac 100  Q
    |||||||||||||||||||||||||  | ||||||||||| ||| |||||||||| |||||||||||||||||||||||||| || |  |||||||| ||    
40717842 ctaaaactgtgataggatgtggaaccaacaatacagtgtcgtttaaaggtgcaagctctggtatagttggccttggaggtggtcccgtgtctcttataac 40717941  T
101 acaa 104  Q
    ||||    
40717942 acaa 40717945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000001
Query Start/End: Original strand, 8 - 108
Target Start/End: Original strand, 14192030 - 14192130
Alignment:
8 tgtgataggatgtggaactgataatacagtgtcatttgaaggtgcaagttctggtatagttggccttggaggtggaccagcatctcttattacacaattg 107  Q
    ||||||||||||||||||| | ||||   |||| | |||||| ||||| |||||||| |||||| | ||| ||||||| || ||| |||| || ||||||    
14192030 tgtgataggatgtggaactaacaatattttgtcctatgaaggcgcaagctctggtatcgttggcttcggaagtggacccgcgtcttttatcactcaattg 14192129  T
108 g 108  Q
    |    
14192130 g 14192130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 48; Significance: 6e-19; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 48; E-Value: 6e-19
Query Start/End: Original strand, 1 - 108
Target Start/End: Original strand, 34302796 - 34302903
Alignment:
1 ctaaaactgtgataggatgtggaactgataatacagtgtcatttgaaggtgcaagttctggtatagttggccttggaggtggaccagcatctcttattac 100  Q
    |||||||||| ||||||||||||||| | |||| || ||| ||| || | | ||| |||||| |||||||||||||||||||||| |||||||| || ||    
34302796 ctaaaactgttataggatgtggaactaacaatatagggtcgtttaaacgcgtaagctctggtgtagttggccttggaggtggacctgcatctctaataac 34302895  T
101 acaattgg 108  Q
    ||||||||    
34302896 acaattgg 34302903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 44; Significance: 1e-16; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 44; E-Value: 1e-16
Query Start/End: Original strand, 1 - 108
Target Start/End: Original strand, 34665832 - 34665939
Alignment:
1 ctaaaactgtgataggatgtggaactgataatacagtgtcatttgaaggtgcaagttctggtatagttggccttggaggtggaccagcatctcttattac 100  Q
    ||||||| |||||||| ||||||||||||||| | | | | |||| ||||||||| ||||||||||||||||||||||| || || |  ||||| || ||    
34665832 ctaaaacagtgataggttgtggaactgataatgcggggacgtttggaggtgcaagctctggtatagttggccttggaggcgggccggtgtctctcataac 34665931  T
101 acaattgg 108  Q
    ||||||||    
34665932 acaattgg 34665939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.000000000009
Query Start/End: Original strand, 9 - 108
Target Start/End: Original strand, 34646146 - 34646245
Alignment:
9 gtgataggatgtggaactgataatacagtgtcatttgaaggtgcaagttctggtatagttggccttggaggtggaccagcatctcttattacacaattgg 108  Q
    |||||||| ||||||||||||||| | | | | |||| ||| ||||| ||||||||||||||||||||||| || || |  ||||| || ||||||||||    
34646146 gtgataggttgtggaactgataatgcggggacgtttggaggcgcaagctctggtatagttggccttggaggcgggccggtgtctctcataacacaattgg 34646245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 41; Significance: 0.000000000000009; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 41; E-Value: 0.000000000000009
Query Start/End: Original strand, 1 - 108
Target Start/End: Original strand, 45645334 - 45645441
Alignment:
1 ctaaaactgtgataggatgtggaactgataatacagtgtcatttgaaggtgcaagt-tctggtatagttggccttggaggtggaccagcatctcttatta 99  Q
    |||||||||||||||||||||||| | | ||||| | ||| |||| ||||||| |  ||||||||||| |||||||||||||||||||  ||||| || |    
45645334 ctaaaactgtgataggatgtggaaataacaatacgg-gtcgtttggaggtgcagggctctggtatagtgggccttggaggtggaccagtgtctctaataa 45645432  T
100 cacaattgg 108  Q
    |||||||||    
45645433 cacaattgg 45645441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC