View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 454-NF4349-Insertion-25 (Length: 140)

Name: 454-NF4349-Insertion-25
Description: 454-NF4349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] 454-NF4349-Insertion-25
[»] chr2 (1 HSPs)
chr2 (1-140)||(12936039-12936178)

Alignment Details
Target: chr2 (Bit Score: 128; Significance: 1e-66; HSPs: 1)
Name: chr2

Target: chr2; HSP #1
Raw Score: 128; E-Value: 1e-66
Query Start/End: Original strand, 1 - 140
Target Start/End: Complemental strand, 12936178 - 12936039
1 gatgcatagtaaaaggaagtaatagtttgaaatatgaatgagaaagcaagatgtatctagttgatattgctcttgaatgccatcaaagacattcttacaa 100  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||    
12936178 gatgcatagtacaaggaagtaatagtttgaaatatgaatgagaaagcaagatgcatctagttgatattgctcttgaatgacatcaaagacattcttacaa 12936079  T
101 attgtatgattcgaaaactaagaacttgatggcaaacaga 140  Q
12936078 attgtatgattcgaaaactaagaacttgatggcaaacaga 12936039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 78117 times since January 2019
Visitors: 2276