View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 454-NF4349-Insertion-26 (Length: 96)

Name: 454-NF4349-Insertion-26
Description: 454-NF4349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] 454-NF4349-Insertion-26
[»] chr2 (1 HSPs)
chr2 (6-96)||(40508850-40508940)

Alignment Details
Target: chr2 (Bit Score: 83; Significance: 7e-40; HSPs: 1)
Name: chr2

Target: chr2; HSP #1
Raw Score: 83; E-Value: 7e-40
Query Start/End: Original strand, 6 - 96
Target Start/End: Original strand, 40508850 - 40508940
6 aatatttgaatcaaatacaagctcctttcaactagagagctcaaatacaagaataatgccaggggttcgtccagtagttgtataaggttgg 96  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||    
40508850 aatatttgaatcaaatacaagctcctttcaactagagagctcaaatacaagaataatgctaggggttcgtccagtagttgtagaaggttgg 40508940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 84091 times since January 2019
Visitors: 2323