View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 454-NF4349-Insertion-27 (Length: 112)

Name: 454-NF4349-Insertion-27
Description: 454-NF4349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 454-NF4349-Insertion-27
454-NF4349-Insertion-27
[»] chr5 (17 HSPs)
chr5 (1-112)||(30240894-30241005)
chr5 (7-109)||(30751143-30751245)
chr5 (7-109)||(30484898-30485000)
chr5 (7-109)||(30675795-30675897)
chr5 (7-109)||(30337032-30337134)
chr5 (7-111)||(29873669-29873773)
chr5 (7-109)||(30061869-30061971)
chr5 (10-111)||(29854806-29854907)
chr5 (7-109)||(30711935-30712037)
chr5 (13-111)||(30208017-30208115)
chr5 (46-111)||(30520171-30520236)
chr5 (46-111)||(30560511-30560576)
chr5 (13-109)||(30437295-30437391)
chr5 (7-99)||(30476882-30476974)
chr5 (32-86)||(30401597-30401651)
chr5 (13-85)||(17417181-17417253)
chr5 (46-110)||(17984386-17984450)
[»] chr4 (1 HSPs)
chr4 (7-109)||(20295089-20295191)
[»] chr7 (1 HSPs)
chr7 (13-109)||(26708814-26708910)
[»] chr3 (1 HSPs)
chr3 (13-95)||(25292460-25292542)
[»] chr1 (1 HSPs)
chr1 (47-110)||(7100902-7100965)


Alignment Details
Target: chr5 (Bit Score: 104; Significance: 2e-52; HSPs: 17)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 104; E-Value: 2e-52
Query Start/End: Original strand, 1 - 112
Target Start/End: Original strand, 30240894 - 30241005
Alignment:
1 gatgcgttgctcggagttgtgtttgataatttgaagtctctcctacaaaatgaatttgcaaccatttctggaatcaagtcaaaggctcaaaagctgtcag 100  Q
    ||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30240894 gatgcgttgatcggagttgtgtttgataacttgaagtctctcctacaaaatgaatttgcaaccatttctggaatcaagtcaaaggctcaaaagctgtcag 30240993  T
101 acaccttagata 112  Q
    ||||||||||||    
30240994 acaccttagata 30241005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 71; E-Value: 1e-32
Query Start/End: Original strand, 7 - 109
Target Start/End: Complemental strand, 30751245 - 30751143
Alignment:
7 ttgctcggagttgtgtttgataatttgaagtctctcctacaaaatgaatttgcaaccatttctggaatcaagtcaaaggctcaaaagctgtcagacacct 106  Q
    ||||| |||||||||||||| ||||||| ||||||||| |||||||||||| |||||||||||||||| |||||||||||||||||||| ||||||| ||    
30751245 ttgcttggagttgtgtttgaaaatttgacgtctctccttcaaaatgaattttcaaccatttctggaattaagtcaaaggctcaaaagctatcagacaact 30751146  T
107 tag 109  Q
    |||    
30751145 tag 30751143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 67; E-Value: 3e-30
Query Start/End: Original strand, 7 - 109
Target Start/End: Complemental strand, 30485000 - 30484898
Alignment:
7 ttgctcggagttgtgtttgataatttgaagtctctcctacaaaatgaatttgcaaccatttctggaatcaagtcaaaggctcaaaagctgtcagacacct 106  Q
    ||||| ||||||||||| || |||||||  |||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||| ||    
30485000 ttgcttggagttgtgttcgaaaatttgacatctctccttcaaaatgaattttcaaccatttctggaatcaagtcaaaggctcaaaagctatcagacaact 30484901  T
107 tag 109  Q
    |||    
30484900 tag 30484898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 67; E-Value: 3e-30
Query Start/End: Original strand, 7 - 109
Target Start/End: Original strand, 30675795 - 30675897
Alignment:
7 ttgctcggagttgtgtttgataatttgaagtctctcctacaaaatgaatttgcaaccatttctggaatcaagtcaaaggctcaaaagctgtcagacacct 106  Q
    ||||| |||||||||||||| ||||||| ||||||||| |||||||||||| ||||||||||||||||||||||||||| ||||||||| ||| ||| ||    
30675795 ttgcttggagttgtgtttgaaaatttgacgtctctccttcaaaatgaattttcaaccatttctggaatcaagtcaaaggttcaaaagctatcaaacaact 30675894  T
107 tag 109  Q
    |||    
30675895 tag 30675897  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 63; E-Value: 7e-28
Query Start/End: Original strand, 7 - 109
Target Start/End: Original strand, 30337032 - 30337134
Alignment:
7 ttgctcggagttgtgtttgataatttgaagtctctcctacaaaatgaatttgcaaccatttctggaatcaagtcaaaggctcaaaagctgtcagacacct 106  Q
    ||||| |||||||||||||| ||||||| | ||||||  |||||||||||| |||||||||||||||| |||||||||||||||||||| ||||||| ||    
30337032 ttgcttggagttgtgtttgaaaatttgacggctctccatcaaaatgaattttcaaccatttctggaattaagtcaaaggctcaaaagctatcagacaact 30337131  T
107 tag 109  Q
    |||    
30337132 tag 30337134  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 61; E-Value: 1e-26
Query Start/End: Original strand, 7 - 111
Target Start/End: Complemental strand, 29873773 - 29873669
Alignment:
7 ttgctcggagttgtgtttgataatttgaagtctctcctacaaaatgaatttgcaaccatttctggaatcaagtcaaaggctcaaaagctgtcagacacct 106  Q
    |||||||||||||||||||| ||||||| ||||||||| |||||||||||| | ||||||||||| ||||||||||||||| |||| || |||  |||||    
29873773 ttgctcggagttgtgtttgaaaatttgatgtctctccttcaaaatgaattttctaccatttctggtatcaagtcaaaggctgaaaaactatcaaccacct 29873674  T
107 tagat 111  Q
    |||||    
29873673 tagat 29873669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 59; E-Value: 2e-25
Query Start/End: Original strand, 7 - 109
Target Start/End: Complemental strand, 30061971 - 30061869
Alignment:
7 ttgctcggagttgtgtttgataatttgaagtctctcctacaaaatgaatttgcaaccatttctggaatcaagtcaaaggctcaaaagctgtcagacacct 106  Q
    ||||| |||||||||||||| ||||||| | ||||||| |||||||||||| |||||||||||||||| |||||||||| ||||||||| ||| ||| ||    
30061971 ttgcttggagttgtgtttgaaaatttgacggctctccttcaaaatgaattttcaaccatttctggaattaagtcaaaggttcaaaagctatcaaacaact 30061872  T
107 tag 109  Q
    |||    
30061871 tag 30061869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 58; E-Value: 7e-25
Query Start/End: Original strand, 10 - 111
Target Start/End: Complemental strand, 29854907 - 29854806
Alignment:
10 ctcggagttgtgtttgataatttgaagtctctcctacaaaatgaatttgcaaccatttctggaatcaagtcaaaggctcaaaagctgtcagacaccttag 109  Q
    ||||||||||||||| | ||||||| |||||||||||||| ||||||| ||||||||||| ||||||||||||||||| |||| || |||  ||||||||    
29854907 ctcggagttgtgtttcagaatttgacgtctctcctacaaagtgaattttcaaccatttctagaatcaagtcaaaggctgaaaaactatcaaccaccttag 29854808  T
110 at 111  Q
    ||    
29854807 at 29854806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 51; E-Value: 1e-20
Query Start/End: Original strand, 7 - 109
Target Start/End: Original strand, 30711935 - 30712037
Alignment:
7 ttgctcggagttgtgtttgataatttgaagtctctcctacaaaatgaatttgcaaccatttctggaatcaagtcaaaggctcaaaagctgtcagacacct 106  Q
    ||||| ||| |||| ||||| || |||| ||||||||| |||||||||||| | ||||||||||||||||| ||||||| ||||||||| ||||||| ||    
30711935 ttgcttggatttgtttttgaaaacttgacgtctctccttcaaaatgaattttctaccatttctggaatcaaatcaaaggttcaaaagctatcagacaact 30712034  T
107 tag 109  Q
    |||    
30712035 tag 30712037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 47; E-Value: 2e-18
Query Start/End: Original strand, 13 - 111
Target Start/End: Complemental strand, 30208115 - 30208017
Alignment:
13 ggagttgtgtttgataatttgaagtctctcctacaaaatgaatttgcaaccatttctggaatcaagtcaaaggctcaaaagctgtcagacaccttagat 111  Q
    |||||||||||  | ||||||||||||||  | ||||||||||| || |||||||||||||||||||| |||||||| ||||| |||  ||||||||||    
30208115 ggagttgtgttacagaatttgaagtctcttgttcaaaatgaattggccaccatttctggaatcaagtccaaggctcagaagctttcaaccaccttagat 30208017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 46; E-Value: 1e-17
Query Start/End: Original strand, 46 - 111
Target Start/End: Original strand, 30520171 - 30520236
Alignment:
46 caaaatgaatttgcaaccatttctggaatcaagtcaaaggctcaaaagctgtcagacaccttagat 111  Q
    ||||||||||||||||||||||||||||||||||| ||||||| |||||| |||  ||||||||||    
30520171 caaaatgaatttgcaaccatttctggaatcaagtccaaggctctaaagctatcaaccaccttagat 30520236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 46; E-Value: 1e-17
Query Start/End: Original strand, 46 - 111
Target Start/End: Original strand, 30560511 - 30560576
Alignment:
46 caaaatgaatttgcaaccatttctggaatcaagtcaaaggctcaaaagctgtcagacaccttagat 111  Q
    ||||||||||||||||||||||||||||||||||| ||||||| |||||| |||  ||||||||||    
30560511 caaaatgaatttgcaaccatttctggaatcaagtccaaggctctaaagctatcaaccaccttagat 30560576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 45; E-Value: 4e-17
Query Start/End: Original strand, 13 - 109
Target Start/End: Complemental strand, 30437391 - 30437295
Alignment:
13 ggagttgtgtttgataatttgaagtctctcctacaaaatgaatttgcaaccatttctggaatcaagtcaaaggctcaaaagctgtcagacaccttag 109  Q
    |||||||||||||| |||||||  ||||| || |||||||||||| | || |||||||||||||||||||||||| |||| || |||  ||||||||    
30437391 ggagttgtgtttgagaatttgatatctctgcttcaaaatgaattttctactatttctggaatcaagtcaaaggctgaaaacctatcaaccaccttag 30437295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 41; E-Value: 0.000000000000009
Query Start/End: Original strand, 7 - 99
Target Start/End: Complemental strand, 30476974 - 30476882
Alignment:
7 ttgctcggagttgtgtttgataatttgaagtctctcctacaaaatgaatttgcaaccatttctggaatcaagtcaaaggctcaaaagctgtca 99  Q
    ||||| |||||||| ||||| ||||||   |||||  | |||||||||||||||||||||||||||||||  ||||||||| ||||| |||||    
30476974 ttgctaggagttgtatttgagaatttgttatctcttgttcaaaatgaatttgcaaccatttctggaatcacatcaaaggctgaaaagttgtca 30476882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 39; E-Value: 0.0000000000001
Query Start/End: Original strand, 32 - 86
Target Start/End: Complemental strand, 30401651 - 30401597
Alignment:
32 tgaagtctctcctacaaaatgaatttgcaaccatttctggaatcaagtcaaaggc 86  Q
    |||| ||||||||||||| ||||||| | ||||||||||||||||||||||||||    
30401651 tgaattctctcctacaaagtgaattttctaccatttctggaatcaagtcaaaggc 30401597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 29; E-Value: 0.0000001
Query Start/End: Original strand, 13 - 85
Target Start/End: Original strand, 17417181 - 17417253
Alignment:
13 ggagttgtgtttgataatttgaagtctctcctacaaaatgaatttgcaaccatttctggaatcaagtcaaagg 85  Q
    |||||||||||||| ||||||   |||||  | ||||||||| ||||||||| || |||||| ||||||||||    
17417181 ggagttgtgtttgagaatttgttatctctggttcaaaatgaaattgcaaccacttttggaattaagtcaaagg 17417253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 29; E-Value: 0.0000001
Query Start/End: Original strand, 46 - 110
Target Start/End: Complemental strand, 17984450 - 17984386
Alignment:
46 caaaatgaatttgcaaccatttctggaatcaagtcaaaggctcaaaagctgtcagacaccttaga 110  Q
    |||||||||||||||||  | |||| |||||||||||||||| |||| || |||  |||||||||    
17984450 caaaatgaatttgcaactctatctgcaatcaagtcaaaggctgaaaaactatcaaccaccttaga 17984386  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 67; Significance: 3e-30; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 67; E-Value: 3e-30
Query Start/End: Original strand, 7 - 109
Target Start/End: Original strand, 20295089 - 20295191
Alignment:
7 ttgctcggagttgtgtttgataatttgaagtctctcctacaaaatgaatttgcaaccatttctggaatcaagtcaaaggctcaaaagctgtcagacacct 106  Q
    ||||| |||||||||| ||| ||||||| ||||||||| ||||||||||||||||||||||||||||||| ||||||||||| |||||| ||||||| ||    
20295089 ttgcttggagttgtgtctgaaaatttgacgtctctccttcaaaatgaatttgcaaccatttctggaatcaggtcaaaggctcgaaagctatcagacaact 20295188  T
107 tag 109  Q
    |||    
20295189 tag 20295191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 41; Significance: 0.000000000000009; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 41; E-Value: 0.000000000000009
Query Start/End: Original strand, 13 - 109
Target Start/End: Complemental strand, 26708910 - 26708814
Alignment:
13 ggagttgtgtttgataatttgaagtctctcctacaaaatgaatttgcaaccatttctggaatcaagtcaaaggctcaaaagctgtcagacaccttag 109  Q
    ||||||||||| || ||||||| |||||| || |||| ||||||| | ||||||| ||||||||||||||||||| |||| || |||  ||||||||    
26708910 ggagttgtgttcgagaatttgatgtctctgcttcaaattgaattttctaccatttatggaatcaagtcaaaggctgaaaacctatcaaccaccttag 26708814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 39; Significance: 0.0000000000001; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000001
Query Start/End: Original strand, 13 - 95
Target Start/End: Original strand, 25292460 - 25292542
Alignment:
13 ggagttgtgtttgataatttgaagtctctcctacaaaatgaatttgcaaccatttctggaatcaagtcaaaggctcaaaagct 95  Q
    |||||||| ||||| ||| ||  ||| || || |||||||||||||||||||||||| ||||||||||||| ||| |||||||    
25292460 ggagttgtatttgagaatatgttgtccctgcttcaaaatgaatttgcaaccatttctagaatcaagtcaaaagctgaaaagct 25292542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 28; Significance: 0.0000005; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 28; E-Value: 0.0000005
Query Start/End: Original strand, 47 - 110
Target Start/End: Complemental strand, 7100965 - 7100902
Alignment:
47 aaaatgaatttgcaaccatttctggaatcaagtcaaaggctcaaaagctgtcagacaccttaga 110  Q
    |||| |||||||||||  | ||||||||||||||||||||| |||| || |||  |||||||||    
7100965 aaaacgaatttgcaactctatctggaatcaagtcaaaggctgaaaaactatcaaccaccttaga 7100902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC