View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 454-NF4349-Insertion-4 (Length: 266)

Name: 454-NF4349-Insertion-4
Description: 454-NF4349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 454-NF4349-Insertion-4
454-NF4349-Insertion-4
[»] chr5 (6 HSPs)
chr5 (1-266)||(36934630-36934894)
chr5 (1-250)||(36963530-36963778)
chr5 (1-248)||(36946209-36946455)
chr5 (1-266)||(36952096-36952360)
chr5 (1-132)||(37081616-37081746)
chr5 (1-135)||(37071865-37071998)
[»] chr2 (1 HSPs)
chr2 (16-161)||(12495690-12495834)


Alignment Details
Target: chr5 (Bit Score: 190; Significance: 1e-103; HSPs: 6)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 266
Target Start/End: Complemental strand, 36934894 - 36934630
Alignment:
1 atgtgtccacatctagcagcaacatgcaaggcactatcgattgtttttgttaagtttgaacaaaagttttggagcacgttccattacaagattcacaatg 100  Q
    ||||||||| |||||||||||||||| ||||||||||| |||||||| |||||  ||||||||||||||||||||| |||| ||||||||||||||||||    
36934894 atgtgtccatatctagcagcaacatgtaaggcactatc-attgttttcgttaaacttgaacaaaagttttggagcatgttcaattacaagattcacaatg 36934796  T
101 tcatctttaccatacgaagctgcaatatgtagcactgtattttgcataggggtctcaatttttgttaaattagagaaatccaacaaattcgttgaaactc 200  Q
    ||||  ||||||||| || |||||||||||||||||||||||| |||||| ||||||||||||||||| ||||||||||||||||| |||||||||||||    
36934795 tcattattaccataccaaactgcaatatgtagcactgtattttccataggagtctcaatttttgttaatttagagaaatccaacaagttcgttgaaactc 36934696  T
201 catataccaagagatatgctttactaagcaaatcaatttgattgtcaaattcgcaacattttggaa 266  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||    
36934695 catataccaagagatatgctttactaagcaaatcaatttgattgtcaaatttgcaacattctggaa 36934630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 1 - 250
Target Start/End: Complemental strand, 36963778 - 36963530
Alignment:
1 atgtgtccacatctagcagcaacatgcaaggcactatcgattgtttttgttaagtttgaacaaaagttttggagcacgttccattacaagattcacaatg 100  Q
    |||||||||| ||| ||||||||||| ||||  ||||| |||||||||||| | | |||||||||||||||||||| |||| ||||||||||||||||||    
36963778 atgtgtccacctcttgcagcaacatgtaaggggctatc-attgtttttgttgaatgtgaacaaaagttttggagcatgttcaattacaagattcacaatg 36963680  T
101 tcatctttaccatacgaagctgcaatatgtagcactgtattttgcataggggtctcaatttttgttaaattagagaaatccaacaaattcgttgaaactc 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
36963679 tcatctttaccatacgaagctgcaatatgtagcactgtattttgcataggggtctcaatttttgttaaattagagaaatccaacaaattcgttgaacctc 36963580  T
201 catataccaagagatatgctttactaagcaaatcaatttgattgtcaaat 250  Q
    |||| |||||| ||||||||| ||| ||||||| || |||||||||||||    
36963579 catacaccaagtgatatgcttcactgagcaaattaacttgattgtcaaat 36963530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 1 - 248
Target Start/End: Complemental strand, 36946455 - 36946209
Alignment:
1 atgtgtccacatctagcagcaacatgcaaggcactatcgattgtttttgttaagtttgaacaaaagttttggagcacgttccattacaagattcacaatg 100  Q
    |||||||||| ||| ||||||||||| ||||  ||||| |||||||||||| | | |||||||||||||||||| | |||| ||||||||||||||||||    
36946455 atgtgtccacctcttgcagcaacatgtaaggggctatc-attgtttttgttgaatgtgaacaaaagttttggagaatgttcaattacaagattcacaatg 36946357  T
101 tcatctttaccatacgaagctgcaatatgtagcactgtattttgcataggggtctcaatttttgttaaattagagaaatccaacaaattcgttgaaactc 200  Q
    ||||  ||||||||||||||||||||||||| ||||||||||| | ||||||||||||||| |  |||||||||| || ||||||||||||||||| |||    
36946356 tcattattaccatacgaagctgcaatatgtaacactgtatttttcgtaggggtctcaatttctaataaattagaggaacccaacaaattcgttgaacctc 36946257  T
201 catataccaagagatatgctttactaagcaaatcaatttgattgtcaa 248  Q
    |||| |||||| ||||||||| ||||||||||| || |||||||||||    
36946256 catacaccaagtgatatgcttcactaagcaaattaacttgattgtcaa 36946209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 1 - 266
Target Start/End: Complemental strand, 36952360 - 36952096
Alignment:
1 atgtgtccacatctagcagcaacatgcaaggcactatcgattgtttttgttaagtttgaacaaaagttttggagcacgttccattacaagattcacaatg 100  Q
    |||||||||| ||| ||||||||||| ||||||||||| |||||||||||||| | |||||||||||||||||||| |||| | ||||||||||||||||    
36952360 atgtgtccacctcttgcagcaacatgtaaggcactatc-attgtttttgttaaatgtgaacaaaagttttggagcatgttcaactacaagattcacaatg 36952262  T
101 tcatctttaccatacgaagctgcaatatgtagcactgtattttgcataggggtctcaatttttgttaaattagagaaatccaacaaattcgttgaaactc 200  Q
     |||  ||||||| | ||||||||||||||||||| ||||||| || ||| |||||||||||  ||||||||| | || ||||||||||||||||||| |    
36952261 gcattattaccattccaagctgcaatatgtagcacggtatttttcacaggtgtctcaattttatttaaattagtggaacccaacaaattcgttgaaaccc 36952162  T
201 catataccaagagatatgctttactaagcaaatcaatttgattgtcaaattcgcaacattttggaa 266  Q
    |||| ||||||   ||||||| ||||| ||||| ||||||||| |||||||||||||| |||||||    
36952161 cataaaccaagttgtatgcttcactaatcaaattaatttgattatcaaattcgcaacagtttggaa 36952096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 132
Target Start/End: Original strand, 37081616 - 37081746
Alignment:
1 atgtgtccacatctagcagcaacatgcaaggcactatcgattgtttttgttaagtttgaacaaaagttttggagcacgttccattacaagattcacaatg 100  Q
    |||||||||| ||| ||||||| ||| || ||||| ||| |||||||  ||||  | ||||||||||||||||||| |||| ||||||||| |||||||     
37081616 atgtgtccacctcttgcagcaatatgtaacgcactctcg-ttgttttcattaacctcgaacaaaagttttggagcatgttcaattacaagactcacaatc 37081714  T
101 tcatctttaccatacgaagctgcaatatgtag 132  Q
    | ||| || |||||| ||||||  ||||||||    
37081715 ttatcattgccataccaagctgatatatgtag 37081746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 1 - 135
Target Start/End: Original strand, 37071865 - 37071998
Alignment:
1 atgtgtccacatctagcagcaacatgcaaggcactatcgattgtttttgttaagtttgaacaaaagttttggagcacgttccattacaagattcacaatg 100  Q
    |||||||||||||| ||||||| ||| || ||||| || ||||||||  ||||  | |||||||||| |||||||| |||| | ||||||| |||||||     
37071865 atgtgtccacatcttgcagcaatatgtaacgcactctc-attgttttcattaaactcgaacaaaagtgttggagcatgttcaactacaagactcacaatc 37071963  T
101 tcatctttaccatacgaagctgcaatatgtagcac 135  Q
    | ||| || |||| |  |||||| |||||||||||    
37071964 ttatcattgccattctgagctgctatatgtagcac 37071998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 16 - 161
Target Start/End: Original strand, 12495690 - 12495834
Alignment:
16 gcagcaacatgcaaggcactatcgattgtttttgttaagtttgaacaaaagttttggagcacgttccattacaagattcacaatgtcatctttaccatac 115  Q
    ||||||||||| || |||||||| |||||||||||||| ||| ||||||||||||||| ||||||| ||||||||||||||||| ||||  |||||||||    
12495690 gcagcaacatgaaatgcactatc-attgtttttgttaaatttaaacaaaagttttggaacacgttcaattacaagattcacaatttcattattaccatac 12495788  T
116 gaagctgcaatatgtagcactgtattttgcataggggtctcaattt 161  Q
     ||||||||||||||||||||||||||| |||||| ||||||||||    
12495789 caagctgcaatatgtagcactgtattttccataggagtctcaattt 12495834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC