View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 454-NF4349-Insertion-8 (Length: 158)

Name: 454-NF4349-Insertion-8
Description: 454-NF4349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 454-NF4349-Insertion-8
454-NF4349-Insertion-8
[»] chr2 (1 HSPs)
chr2 (1-158)||(28675885-28676042)


Alignment Details
Target: chr2 (Bit Score: 138; Significance: 2e-72; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 138; E-Value: 2e-72
Query Start/End: Original strand, 1 - 158
Target Start/End: Complemental strand, 28676042 - 28675885
Alignment:
1 aacttcatgtttgtgaatgtgcttgtgtgctgaaataaaagggcaatatagccaacagcaagaagtgtgatgattgttgaatggatgatttcatggctta 100  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||    
28676042 aacttaatgtttgtgaatgtgcttgtgtgctgaaataaaagggcaatatagccaacagcaagaagggtgatgattgttgaatggatgattttatggctta 28675943  T
101 gttatgatggttgttcaataggccattcaaattgttcaaccgatagggctgtaacttc 158  Q
    |||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||    
28675942 gttatgatggttgttcaatacgccattcaaattgttcaaccgatagtgctgtaacttc 28675885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 98557 times since January 2019
Visitors: 2275