View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 454-NF4349-Insertion-9 (Length: 172)

Name: 454-NF4349-Insertion-9
Description: 454-NF4349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] 454-NF4349-Insertion-9
[»] chr3 (1 HSPs)
chr3 (5-172)||(36671371-36671538)

Alignment Details
Target: chr3 (Bit Score: 140; Significance: 1e-73; HSPs: 1)
Name: chr3

Target: chr3; HSP #1
Raw Score: 140; E-Value: 1e-73
Query Start/End: Original strand, 5 - 172
Target Start/End: Original strand, 36671371 - 36671538
5 acaaacatgttacacaagaaccaaacctccatctcaaagtatcaagcagatgaccccatgtacttagagagattaacctcattaagaagcccaaaatatg 104  Q
    ||||||||||||||||||| |||||||||||||||||||||| | |||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
36671371 acaaacatgttacacaagagccaaacctccatctcaaagtattatgcagatgaccccatgtacttagagagattagcctcattaagaagcccaaaatatg 36671470  T
105 taaacgcacgaaaccaaccttacaatttaacaatctcttagccacttggaggaagaacttctttacat 172  Q
     ||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
36671471 caaaggcacgaaaccaaccttacaatttaacaatctcttagccactgggaggaagaacttctttacat 36671538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC