View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 454-NF4349-Insertion-9 (Length: 172)

Name: 454-NF4349-Insertion-9
Description: 454-NF4349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 454-NF4349-Insertion-9
454-NF4349-Insertion-9
[»] chr3 (1 HSPs)
chr3 (5-172)||(36671371-36671538)


Alignment Details
Target: chr3 (Bit Score: 140; Significance: 1e-73; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 140; E-Value: 1e-73
Query Start/End: Original strand, 5 - 172
Target Start/End: Original strand, 36671371 - 36671538
Alignment:
5 acaaacatgttacacaagaaccaaacctccatctcaaagtatcaagcagatgaccccatgtacttagagagattaacctcattaagaagcccaaaatatg 104  Q
    ||||||||||||||||||| |||||||||||||||||||||| | |||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
36671371 acaaacatgttacacaagagccaaacctccatctcaaagtattatgcagatgaccccatgtacttagagagattagcctcattaagaagcccaaaatatg 36671470  T
105 taaacgcacgaaaccaaccttacaatttaacaatctcttagccacttggaggaagaacttctttacat 172  Q
     ||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
36671471 caaaggcacgaaaccaaccttacaatttaacaatctcttagccactgggaggaagaacttctttacat 36671538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 84133 times since January 2019
Visitors: 2323