View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 454-NF4352-Insertion-1 (Length: 90)

Name: 454-NF4352-Insertion-1
Description: 454-NF4352
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 454-NF4352-Insertion-1
454-NF4352-Insertion-1
[»] chr5 (1 HSPs)
chr5 (5-90)||(38783337-38783422)
[»] chr1 (1 HSPs)
chr1 (5-58)||(5051043-5051096)
[»] chr4 (1 HSPs)
chr4 (5-57)||(51274347-51274399)


Alignment Details
Target: chr5 (Bit Score: 82; Significance: 2e-39; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 82; E-Value: 2e-39
Query Start/End: Original strand, 5 - 90
Target Start/End: Original strand, 38783337 - 38783422
Alignment:
5 atgaccctttcaacaatgatgaaaaatgtgacctcattaattttccaagtgatacaatatacatcttaagaggatattctttttca 90  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38783337 atgaccctttcaacaatgttgaaaaatgtgacctcattaattttccaagtgatacaatatacatcttaagaggatattctttttca 38783422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 42; Significance: 0.000000000000002; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.000000000000002
Query Start/End: Original strand, 5 - 58
Target Start/End: Complemental strand, 5051096 - 5051043
Alignment:
5 atgaccctttcaacaatgatgaaaaatgtgacctcattaattttccaagtgata 58  Q
    ||||||||||||||||||||||||| || ||| |||||||||||||||||||||    
5051096 atgaccctttcaacaatgatgaaaattgagacatcattaattttccaagtgata 5051043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 41; Significance: 0.000000000000007; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 41; E-Value: 0.000000000000007
Query Start/End: Original strand, 5 - 57
Target Start/End: Original strand, 51274347 - 51274399
Alignment:
5 atgaccctttcaacaatgatgaaaaatgtgacctcattaattttccaagtgat 57  Q
    |||||||||||||||||||||||||||||||  ||||||||||||| ||||||    
51274347 atgaccctttcaacaatgatgaaaaatgtgaaatcattaattttcctagtgat 51274399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 98470 times since January 2019
Visitors: 2275