View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 454-NF4352-Insertion-2 (Length: 282)

Name: 454-NF4352-Insertion-2
Description: 454-NF4352
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 454-NF4352-Insertion-2
454-NF4352-Insertion-2
[»] chr3 (75 HSPs)
chr3 (122-254)||(44107381-44107515)
chr3 (122-265)||(13525169-13525315)
chr3 (122-254)||(3917766-3917901)
chr3 (127-254)||(10473907-10474037)
chr3 (122-254)||(4232170-4232305)
chr3 (122-254)||(8381079-8381214)
chr3 (127-222)||(44879257-44879356)
chr3 (122-254)||(27396854-27396988)
chr3 (122-251)||(38127838-38127970)
chr3 (122-254)||(10228957-10229092)
chr3 (122-254)||(32960971-32961106)
chr3 (122-254)||(43897956-43898091)
chr3 (122-222)||(47410776-47410880)
chr3 (122-183)||(24751753-24751814)
chr3 (122-217)||(43605605-43605704)
chr3 (122-254)||(54097434-54097568)
chr3 (122-211)||(29212100-29212193)
chr3 (137-254)||(35359732-35359852)
chr3 (122-222)||(4833133-4833237)
chr3 (122-222)||(4976732-4976836)
chr3 (122-254)||(24910281-24910416)
chr3 (122-168)||(53583961-53584007)
chr3 (127-254)||(1242222-1242352)
chr3 (122-217)||(6583264-6583363)
chr3 (122-217)||(24650576-24650675)
chr3 (117-178)||(44037516-44037577)
chr3 (122-254)||(22371450-22371584)
chr3 (122-254)||(11029663-11029799)
chr3 (122-254)||(28170972-28171108)
chr3 (129-183)||(2558754-2558808)
chr3 (122-168)||(2687559-2687605)
chr3 (127-211)||(11312595-11312683)
chr3 (139-263)||(28196968-28197095)
chr3 (122-168)||(32590972-32591018)
chr3 (122-222)||(34397680-34397784)
chr3 (130-172)||(38085814-38085856)
chr3 (122-210)||(40418511-40418603)
chr3 (127-254)||(52256745-52256876)
chr3 (122-222)||(6083166-6083269)
chr3 (127-254)||(25118699-25118829)
chr3 (122-183)||(37124216-37124277)
chr3 (122-183)||(41464664-41464725)
chr3 (127-168)||(46311525-46311566)
chr3 (122-183)||(46838794-46838855)
chr3 (127-168)||(50238922-50238963)
chr3 (133-254)||(3440736-3440861)
chr3 (122-182)||(30553036-30553096)
chr3 (130-222)||(43967932-43968027)
chr3 (127-183)||(48191099-48191155)
chr3 (122-165)||(11249960-11250003)
chr3 (122-165)||(19921397-19921440)
chr3 (127-174)||(39172045-39172092)
chr3 (122-181)||(46894813-46894872)
chr3 (122-222)||(47069006-47069111)
chr3 (122-254)||(15003628-15003763)
chr3 (122-168)||(24250725-24250771)
chr3 (127-211)||(35069318-35069406)
chr3 (196-254)||(36518178-36518235)
chr3 (122-168)||(40193038-40193084)
chr3 (127-210)||(40840173-40840261)
chr3 (122-210)||(42296712-42296803)
chr3 (122-168)||(47408840-47408886)
chr3 (117-174)||(2900250-2900307)
chr3 (127-168)||(12948815-12948856)
chr3 (122-183)||(17500927-17500988)
chr3 (122-179)||(19961369-19961426)
chr3 (122-163)||(21402745-21402786)
chr3 (122-167)||(23878946-23878991)
chr3 (122-183)||(28266526-28266587)
chr3 (200-261)||(46316464-46316523)
chr3 (122-183)||(49285508-49285569)
chr3 (127-168)||(53669793-53669834)
chr3 (122-211)||(11751211-11751305)
chr3 (130-236)||(32635387-32635496)
chr3 (127-167)||(41921511-41921551)
[»] chr1 (60 HSPs)
chr1 (122-254)||(49500861-49500996)
chr1 (122-246)||(49948241-49948368)
chr1 (127-185)||(11797464-11797522)
chr1 (122-254)||(19338171-19338306)
chr1 (122-246)||(36586251-36586378)
chr1 (122-254)||(42630978-42631113)
chr1 (117-254)||(43676017-43676157)
chr1 (122-211)||(48314167-48314260)
chr1 (122-254)||(5598301-5598436)
chr1 (130-254)||(20164066-20164193)
chr1 (122-222)||(29005090-29005194)
chr1 (122-254)||(40958567-40958702)
chr1 (122-246)||(43086472-43086599)
chr1 (122-217)||(10635489-10635588)
chr1 (114-183)||(24119648-24119717)
chr1 (122-183)||(39787717-39787778)
chr1 (122-183)||(40685529-40685590)
chr1 (122-183)||(40809280-40809341)
chr1 (127-217)||(13555753-13555847)
chr1 (122-260)||(50248029-50248170)
chr1 (118-246)||(2112743-2112874)
chr1 (122-253)||(11786103-11786238)
chr1 (122-254)||(48391956-48392091)
chr1 (127-222)||(3315799-3315898)
chr1 (127-254)||(41445023-41445153)
chr1 (127-254)||(48731749-48731879)
chr1 (127-183)||(5790063-5790119)
chr1 (122-182)||(28999374-28999434)
chr1 (127-183)||(29511113-29511169)
chr1 (122-174)||(40503597-40503649)
chr1 (127-166)||(3840446-3840485)
chr1 (122-254)||(4126575-4126710)
chr1 (122-222)||(17068152-17068256)
chr1 (122-222)||(25820974-25821078)
chr1 (122-168)||(26261375-26261421)
chr1 (122-168)||(34010094-34010140)
chr1 (127-254)||(13018078-13018208)
chr1 (127-254)||(32880572-32880702)
chr1 (122-254)||(270316-270450)
chr1 (121-165)||(28381224-28381268)
chr1 (127-182)||(32947624-32947680)
chr1 (127-167)||(39467029-39467069)
chr1 (122-161)||(25083208-25083247)
chr1 (132-183)||(27078559-27078609)
chr1 (122-168)||(8214623-8214669)
chr1 (122-254)||(18089762-18089896)
chr1 (196-254)||(22561151-22561208)
chr1 (122-168)||(30455204-30455250)
chr1 (132-182)||(33845672-33845722)
chr1 (132-182)||(33948256-33948306)
chr1 (126-179)||(1800680-1800733)
chr1 (122-183)||(5322592-5322653)
chr1 (127-183)||(7204575-7204632)
chr1 (122-167)||(15906250-15906295)
chr1 (127-222)||(21522322-21522421)
chr1 (127-168)||(39522840-39522881)
chr1 (127-183)||(15104049-15104105)
chr1 (130-166)||(21897765-21897801)
chr1 (122-166)||(35010673-35010717)
chr1 (125-165)||(43500228-43500268)
[»] chr7 (55 HSPs)
chr7 (127-254)||(17895639-17895769)
chr7 (122-254)||(2228073-2228208)
chr7 (122-265)||(10060998-10061144)
chr7 (122-254)||(35157077-35157212)
chr7 (130-254)||(44327648-44327775)
chr7 (122-183)||(9379991-9380052)
chr7 (122-261)||(45041719-45041861)
chr7 (122-254)||(1323683-1323818)
chr7 (122-222)||(1573865-1573969)
chr7 (122-254)||(3497510-3497645)
chr7 (122-254)||(4106554-4106689)
chr7 (122-254)||(45236930-45237065)
chr7 (127-254)||(21226070-21226200)
chr7 (122-254)||(31299988-31300125)
chr7 (122-182)||(2354865-2354925)
chr7 (133-254)||(5508696-5508820)
chr7 (122-223)||(19306712-19306817)
chr7 (122-222)||(3861360-3861464)
chr7 (127-211)||(7312488-7312576)
chr7 (122-168)||(29151583-29151629)
chr7 (122-254)||(35849295-35849430)
chr7 (122-246)||(40809045-40809172)
chr7 (122-222)||(47584695-47584799)
chr7 (122-254)||(48612517-48612652)
chr7 (122-174)||(48729760-48729812)
chr7 (122-181)||(4887582-4887641)
chr7 (122-165)||(37117930-37117973)
chr7 (122-181)||(47459416-47459475)
chr7 (122-222)||(4069140-4069244)
chr7 (122-254)||(18944924-18945059)
chr7 (122-168)||(27396396-27396442)
chr7 (122-254)||(31717297-31717432)
chr7 (127-181)||(38261006-38261060)
chr7 (122-254)||(43723312-43723447)
chr7 (127-254)||(4674302-4674432)
chr7 (122-183)||(6596542-6596603)
chr7 (131-254)||(16816700-16816826)
chr7 (127-168)||(33512802-33512843)
chr7 (127-254)||(10166875-10167004)
chr7 (122-181)||(33228699-33228759)
chr7 (127-179)||(37410773-37410825)
chr7 (127-254)||(40656101-40656233)
chr7 (125-222)||(43133127-43133229)
chr7 (127-174)||(3043892-3043939)
chr7 (121-246)||(27339729-27339857)
chr7 (130-168)||(10703973-10704011)
chr7 (125-183)||(26336446-26336504)
chr7 (127-165)||(37919974-37920012)
chr7 (122-168)||(42557584-42557630)
chr7 (127-222)||(19258429-19258528)
chr7 (122-183)||(32251402-32251463)
chr7 (122-183)||(41780263-41780324)
chr7 (121-165)||(5841564-5841608)
chr7 (127-163)||(36280012-36280048)
chr7 (122-174)||(38930354-38930406)
[»] chr4 (69 HSPs)
chr4 (127-254)||(47462029-47462159)
chr4 (122-267)||(46488097-46488245)
chr4 (122-261)||(5396926-5397068)
chr4 (122-254)||(9569475-9569610)
chr4 (122-254)||(29894410-29894545)
chr4 (122-254)||(31375113-31375248)
chr4 (127-254)||(18813375-18813505)
chr4 (122-217)||(42154167-42154266)
chr4 (122-182)||(53398356-53398416)
chr4 (122-254)||(7512767-7512902)
chr4 (122-222)||(13389020-13389124)
chr4 (122-254)||(24550813-24550948)
chr4 (122-222)||(24712088-24712192)
chr4 (122-254)||(30044577-30044712)
chr4 (130-254)||(39284568-39284694)
chr4 (122-254)||(49882702-49882837)
chr4 (122-183)||(1982561-1982622)
chr4 (122-217)||(3848847-3848946)
chr4 (127-254)||(24407502-24407632)
chr4 (127-254)||(28033197-28033327)
chr4 (127-262)||(37050706-37050844)
chr4 (127-222)||(37166143-37166242)
chr4 (122-254)||(6487849-6487981)
chr4 (122-254)||(9064781-9064917)
chr4 (132-222)||(34684212-34684306)
chr4 (122-254)||(12821165-12821298)
chr4 (122-254)||(29428055-29428190)
chr4 (122-254)||(31263494-31263629)
chr4 (127-211)||(35828279-35828367)
chr4 (122-222)||(50779815-50779919)
chr4 (127-254)||(18371351-18371481)
chr4 (122-253)||(28010045-28010179)
chr4 (127-183)||(1033516-1033572)
chr4 (122-182)||(23974710-23974770)
chr4 (133-254)||(1052876-1053000)
chr4 (122-254)||(13632089-13632225)
chr4 (122-168)||(35273388-35273435)
chr4 (130-254)||(579235-579362)
chr4 (196-262)||(3802915-3802981)
chr4 (122-254)||(14285095-14285230)
chr4 (121-179)||(17815213-17815271)
chr4 (122-254)||(28983732-28983867)
chr4 (122-222)||(31435942-31436046)
chr4 (122-168)||(42856563-42856609)
chr4 (122-168)||(49535885-49535931)
chr4 (122-183)||(12694523-12694584)
chr4 (196-265)||(32233690-32233758)
chr4 (122-183)||(35318540-35318601)
chr4 (122-183)||(49319731-49319792)
chr4 (127-168)||(54907974-54908015)
chr4 (127-183)||(5880353-5880409)
chr4 (127-183)||(8017855-8017911)
chr4 (122-165)||(3084327-3084370)
chr4 (127-166)||(17846834-17846873)
chr4 (124-167)||(32662685-32662728)
chr4 (121-164)||(36608000-36608043)
chr4 (127-174)||(46194254-46194301)
chr4 (154-254)||(7944217-7944320)
chr4 (130-168)||(26440975-26441013)
chr4 (122-180)||(29648764-29648822)
chr4 (122-222)||(42412012-42412116)
chr4 (120-149)||(4431993-4432022)
chr4 (125-166)||(11673296-11673337)
chr4 (127-168)||(28187246-28187287)
chr4 (122-243)||(42116481-42116604)
chr4 (133-182)||(51281477-51281526)
chr4 (122-182)||(4379307-4379367)
chr4 (121-149)||(21156057-21156085)
chr4 (132-246)||(25586328-25586445)
[»] chr2 (62 HSPs)
chr2 (127-254)||(43461327-43461457)
chr2 (122-254)||(15897214-15897349)
chr2 (122-254)||(23497505-23497640)
chr2 (122-254)||(4014806-4014941)
chr2 (122-254)||(34667044-34667179)
chr2 (122-222)||(35476514-35476618)
chr2 (122-254)||(45049385-45049520)
chr2 (122-217)||(23080127-23080226)
chr2 (122-259)||(23957052-23957192)
chr2 (122-254)||(6731542-6731677)
chr2 (122-222)||(13267999-13268103)
chr2 (122-254)||(36754734-36754869)
chr2 (122-217)||(32023252-32023351)
chr2 (122-254)||(35687780-35687914)
chr2 (122-223)||(2287332-2287437)
chr2 (122-211)||(7975049-7975142)
chr2 (122-254)||(38490392-38490528)
chr2 (121-222)||(39070018-39070123)
chr2 (122-254)||(3048542-3048677)
chr2 (122-254)||(12236121-12236256)
chr2 (121-183)||(18469499-18469561)
chr2 (122-222)||(20251509-20251613)
chr2 (127-255)||(24381250-24381381)
chr2 (122-254)||(36794804-36794939)
chr2 (122-254)||(41164641-41164776)
chr2 (122-254)||(44948019-44948154)
chr2 (122-183)||(4772303-4772364)
chr2 (122-179)||(35706852-35706909)
chr2 (122-183)||(42007282-42007343)
chr2 (122-183)||(42160324-42160385)
chr2 (127-180)||(10720453-10720507)
chr2 (122-246)||(16534944-16535071)
chr2 (122-254)||(33607043-33607178)
chr2 (196-254)||(36685396-36685453)
chr2 (127-243)||(39310371-39310490)
chr2 (122-226)||(40592313-40592421)
chr2 (122-222)||(42200886-42200990)
chr2 (127-254)||(34481664-34481794)
chr2 (121-168)||(12221226-12221274)
chr2 (122-166)||(23458680-23458724)
chr2 (122-254)||(7957979-7958112)
chr2 (122-243)||(8859291-8859415)
chr2 (137-254)||(15920607-15920727)
chr2 (129-168)||(31054055-31054094)
chr2 (122-254)||(10392645-10392780)
chr2 (196-254)||(11816769-11816826)
chr2 (122-168)||(11816858-11816904)
chr2 (122-168)||(16010695-16010741)
chr2 (127-165)||(18368799-18368837)
chr2 (122-183)||(30854802-30854864)
chr2 (122-168)||(31516287-31516333)
chr2 (127-181)||(31819643-31819697)
chr2 (122-254)||(40812017-40812152)
chr2 (122-222)||(43035440-43035544)
chr2 (122-182)||(19134584-19134645)
chr2 (127-168)||(32120615-32120655)
chr2 (122-166)||(433138-433182)
chr2 (121-149)||(2349191-2349219)
chr2 (119-163)||(7437986-7438030)
chr2 (122-166)||(11011976-11012019)
chr2 (127-183)||(16368755-16368811)
chr2 (122-170)||(31525032-31525080)
[»] chr8 (75 HSPs)
chr8 (122-254)||(4430728-4430863)
chr8 (122-254)||(6317300-6317435)
chr8 (127-254)||(37295131-37295261)
chr8 (127-254)||(44814868-44814998)
chr8 (122-254)||(2733616-2733750)
chr8 (122-256)||(14188090-14188227)
chr8 (122-210)||(2442762-2442854)
chr8 (122-217)||(4694716-4694815)
chr8 (130-254)||(20150229-20150356)
chr8 (122-254)||(37708440-37708575)
chr8 (122-254)||(38070474-38070609)
chr8 (122-254)||(38953473-38953608)
chr8 (122-259)||(19649486-19649626)
chr8 (122-172)||(5895873-5895923)
chr8 (122-254)||(27928158-27928293)
chr8 (122-254)||(34711548-34711683)
chr8 (122-254)||(36586482-36586617)
chr8 (122-261)||(4977020-4977162)
chr8 (127-222)||(25893856-25893955)
chr8 (127-254)||(26690699-26690829)
chr8 (122-183)||(35421685-35421746)
chr8 (127-183)||(10096617-10096673)
chr8 (122-244)||(10286468-10286593)
chr8 (122-211)||(26737971-26738064)
chr8 (124-182)||(5682291-5682349)
chr8 (122-222)||(5704652-5704756)
chr8 (122-222)||(7772074-7772178)
chr8 (127-254)||(9998635-9998766)
chr8 (122-222)||(18040136-18040240)
chr8 (122-254)||(35810237-35810372)
chr8 (122-246)||(37817376-37817503)
chr8 (127-258)||(42922544-42922677)
chr8 (127-254)||(10617790-10617919)
chr8 (122-254)||(25063339-25063475)
chr8 (124-222)||(1766710-1766815)
chr8 (122-254)||(3054024-3054159)
chr8 (122-254)||(4312133-4312268)
chr8 (127-254)||(9569729-9569860)
chr8 (127-181)||(14243704-14243758)
chr8 (122-254)||(16395373-16395508)
chr8 (122-254)||(20662522-20662657)
chr8 (122-222)||(25199046-25199150)
chr8 (122-222)||(25250785-25250889)
chr8 (122-254)||(27544909-27545044)
chr8 (127-254)||(33067383-33067511)
chr8 (122-168)||(41562442-41562488)
chr8 (127-254)||(26675562-26675692)
chr8 (122-170)||(28372473-28372522)
chr8 (127-168)||(37953788-37953829)
chr8 (122-179)||(39333945-39334002)
chr8 (122-167)||(40744325-40744370)
chr8 (127-183)||(6845050-6845106)
chr8 (122-174)||(8547206-8547258)
chr8 (127-253)||(23681015-23681144)
chr8 (130-254)||(11565007-11565135)
chr8 (122-173)||(14725304-14725355)
chr8 (130-172)||(16816833-16816876)
chr8 (122-165)||(35222273-35222316)
chr8 (121-183)||(403665-403727)
chr8 (121-163)||(7432582-7432624)
chr8 (122-254)||(11098067-11098202)
chr8 (122-168)||(11100370-11100416)
chr8 (122-164)||(24420073-24420115)
chr8 (122-168)||(24654974-24655020)
chr8 (122-254)||(31639095-31639230)
chr8 (122-168)||(43820868-43820914)
chr8 (130-254)||(17649835-17649961)
chr8 (127-164)||(25213634-25213671)
chr8 (127-168)||(34540146-34540187)
chr8 (202-258)||(3673832-3673887)
chr8 (127-183)||(10006151-10006207)
chr8 (122-178)||(11265128-11265184)
chr8 (144-254)||(27817442-27817555)
chr8 (126-170)||(39068483-39068527)
chr8 (133-185)||(40999764-40999816)
[»] chr5 (75 HSPs)
chr5 (122-254)||(4164959-4165094)
chr5 (122-254)||(24652307-24652442)
chr5 (122-254)||(36136855-36136990)
chr5 (122-254)||(42448211-42448346)
chr5 (122-260)||(36726989-36727128)
chr5 (122-181)||(39143441-39143500)
chr5 (122-254)||(2103026-2103162)
chr5 (122-254)||(16496600-16496735)
chr5 (122-254)||(36569279-36569414)
chr5 (122-254)||(39150919-39151054)
chr5 (126-254)||(40595961-40596091)
chr5 (122-264)||(18473914-18474059)
chr5 (122-222)||(4617790-4617894)
chr5 (122-222)||(6672241-6672345)
chr5 (122-254)||(9053964-9054099)
chr5 (122-254)||(23311166-23311301)
chr5 (122-254)||(26802334-26802469)
chr5 (122-254)||(26809884-26810019)
chr5 (122-254)||(26824911-26825046)
chr5 (132-254)||(4429934-4430059)
chr5 (127-254)||(10393495-10393625)
chr5 (127-254)||(25328297-25328427)
chr5 (127-254)||(29119611-29119741)
chr5 (122-254)||(1277437-1277573)
chr5 (122-254)||(23074637-23074773)
chr5 (133-254)||(34930236-34930360)
chr5 (122-222)||(6029612-6029716)
chr5 (122-254)||(17869117-17869252)
chr5 (127-185)||(19836152-19836210)
chr5 (122-222)||(28143256-28143360)
chr5 (122-246)||(36319503-36319630)
chr5 (122-183)||(1244248-1244309)
chr5 (127-168)||(37940923-37940964)
chr5 (122-174)||(12878194-12878246)
chr5 (122-182)||(41562458-41562518)
chr5 (122-185)||(7179366-7179429)
chr5 (122-254)||(671052-671187)
chr5 (122-168)||(1269601-1269647)
chr5 (122-222)||(1287315-1287419)
chr5 (122-254)||(11968776-11968911)
chr5 (122-246)||(24051403-24051530)
chr5 (122-222)||(24443891-24443995)
chr5 (122-168)||(37142108-37142154)
chr5 (122-222)||(42068541-42068645)
chr5 (130-171)||(4228865-4228906)
chr5 (122-217)||(6041873-6041972)
chr5 (127-168)||(9902583-9902624)
chr5 (197-254)||(21067516-21067572)
chr5 (139-254)||(36854151-36854269)
chr5 (127-183)||(6053118-6053174)
chr5 (122-168)||(1612372-1612419)
chr5 (122-173)||(7153265-7153316)
chr5 (122-165)||(9068803-9068846)
chr5 (122-165)||(12707961-12708004)
chr5 (130-165)||(36185145-36185180)
chr5 (122-222)||(1650291-1650395)
chr5 (132-174)||(9362564-9362606)
chr5 (122-172)||(9640612-9640662)
chr5 (127-165)||(10070772-10070810)
chr5 (122-254)||(10165532-10165667)
chr5 (122-183)||(21728660-21728722)
chr5 (122-168)||(22620733-22620779)
chr5 (121-167)||(29401977-29402023)
chr5 (128-252)||(37191250-37191377)
chr5 (122-183)||(14107252-14107313)
chr5 (127-222)||(16371496-16371595)
chr5 (127-254)||(36245987-36246116)
chr5 (127-168)||(43150240-43150281)
chr5 (120-254)||(5276344-5276481)
chr5 (120-168)||(12638550-12638598)
chr5 (125-165)||(29069631-29069671)
chr5 (127-183)||(33028235-33028291)
chr5 (127-183)||(38682933-38682989)
chr5 (130-174)||(42337919-42337963)
chr5 (131-183)||(42653550-42653602)
[»] chr6 (43 HSPs)
chr6 (122-254)||(17534515-17534651)
chr6 (122-254)||(8448135-8448270)
chr6 (122-254)||(8456939-8457074)
chr6 (122-254)||(8939626-8939761)
chr6 (122-254)||(2314590-2314727)
chr6 (122-254)||(10181045-10181180)
chr6 (127-222)||(1241600-1241699)
chr6 (127-254)||(18861760-18861890)
chr6 (127-246)||(24571618-24571740)
chr6 (127-174)||(21513077-21513124)
chr6 (122-222)||(8329582-8329686)
chr6 (122-254)||(31205176-31205311)
chr6 (127-222)||(6266637-6266736)
chr6 (127-254)||(32107828-32107958)
chr6 (122-178)||(8116818-8116874)
chr6 (122-254)||(10330804-10330940)
chr6 (122-168)||(4996872-4996918)
chr6 (122-168)||(7098806-7098852)
chr6 (122-222)||(15953234-15953338)
chr6 (122-222)||(31057832-31057936)
chr6 (122-183)||(4083587-4083648)
chr6 (122-183)||(10263138-10263199)
chr6 (127-254)||(12795012-12795142)
chr6 (125-254)||(9727497-9727630)
chr6 (122-254)||(735445-735578)
chr6 (137-222)||(2959008-2959097)
chr6 (122-185)||(13540226-13540289)
chr6 (130-185)||(29479437-29479492)
chr6 (122-168)||(4480474-4480520)
chr6 (122-168)||(7098963-7099009)
chr6 (122-183)||(16496719-16496781)
chr6 (122-168)||(28594153-28594199)
chr6 (130-217)||(2301408-2301499)
chr6 (126-179)||(2746453-2746506)
chr6 (122-183)||(4891008-4891069)
chr6 (120-165)||(7974793-7974838)
chr6 (127-172)||(8487631-8487676)
chr6 (125-174)||(17546039-17546088)
chr6 (122-163)||(24647142-24647183)
chr6 (122-183)||(32643795-32643856)
chr6 (122-181)||(2018831-2018891)
chr6 (122-166)||(13507394-13507438)
chr6 (127-183)||(16244416-16244472)
[»] scaffold0402 (1 HSPs)
scaffold0402 (122-254)||(1234-1369)
[»] scaffold0778 (1 HSPs)
scaffold0778 (127-217)||(823-917)
[»] scaffold0595 (1 HSPs)
scaffold0595 (122-254)||(345-480)
[»] scaffold0287 (1 HSPs)
scaffold0287 (122-254)||(1051-1186)
[»] scaffold0432 (1 HSPs)
scaffold0432 (122-217)||(9367-9466)
[»] scaffold0457 (1 HSPs)
scaffold0457 (127-183)||(6784-6840)
[»] scaffold0013 (1 HSPs)
scaffold0013 (122-222)||(90569-90673)
[»] scaffold0008 (1 HSPs)
scaffold0008 (122-222)||(39337-39441)
[»] scaffold0179 (1 HSPs)
scaffold0179 (122-217)||(4044-4143)
[»] scaffold0061 (1 HSPs)
scaffold0061 (122-181)||(8928-8987)
[»] scaffold0014 (1 HSPs)
scaffold0014 (122-254)||(195740-195875)
[»] scaffold0057 (1 HSPs)
scaffold0057 (130-253)||(64291-64417)
[»] scaffold0515 (1 HSPs)
scaffold0515 (122-254)||(2478-2613)
[»] scaffold0306 (1 HSPs)
scaffold0306 (122-254)||(2478-2613)
[»] scaffold0242 (2 HSPs)
scaffold0242 (127-181)||(15063-15117)
scaffold0242 (127-181)||(23898-23952)
[»] scaffold0163 (1 HSPs)
scaffold0163 (122-168)||(26999-27045)
[»] scaffold0027 (1 HSPs)
scaffold0027 (127-168)||(19395-19437)
[»] scaffold0882 (1 HSPs)
scaffold0882 (127-168)||(3779-3820)
[»] scaffold0002 (1 HSPs)
scaffold0002 (127-183)||(411653-411709)


Alignment Details
Target: chr3 (Bit Score: 58; Significance: 2e-24; HSPs: 75)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 122 - 254
Target Start/End: Original strand, 44107381 - 44107515
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatacaaccccgg---ctccacttgtgtgtgtaagtttc 218  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||| ||| | |||||||| |  |||| |||   |||||||||||||||| |||||     
44107381 tccacaagttctagctcaactggcaaaatgttgaaattgttaggccggatgccatgaccggggtcgaacctcggtacctccacttgtgtgtgtgagttta 44107480  T
219 taataactgttgtcatttcctctatctaacaaaaaa 254  Q
    ||||| || |||||||||| ||||| || |||||||    
44107481 taatagct-ttgtcatttcgtctatttaccaaaaaa 44107515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 122 - 265
Target Start/End: Original strand, 13525169 - 13525315
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagttt 217  Q
    |||| |||||||||||||||||||||||||  ||||||||||||||| ||| | |||||||| | | ||||||||   |||||||||||||||| |||||    
13525169 tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt 13525268  T
218 ctaataactgttgtcatttcctctatctaacaaaaaatataaaataaa 265  Q
     ||||  || ||| |||||| |||||||| ||||||||| ||||||||    
13525269 ataatggct-ttgccatttcgtctatctaccaaaaaataaaaaataaa 13525315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 122 - 254
Target Start/End: Original strand, 3917766 - 3917901
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagttt 217  Q
    |||| |||||||||||||||||||||||||  ||||||||||||||| ||||| |||||||| | | ||||||||   |||||||||||||||| |||||    
3917766 tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt 3917865  T
218 ctaataactgttgtcatttcctctatctaacaaaaaa 254  Q
     ||||  || ||| |||||| |||||||| |||||||    
3917866 ataatggct-ttgccatttcgtctatctaccaaaaaa 3917901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 127 - 254
Target Start/End: Complemental strand, 10474037 - 10473907
Alignment:
127 aagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagtttctaat 222  Q
    ||||||||||||||||||||||||| |||||||||||||||| ||| | |||||||| | | ||||||||   |||||||||||||||| ||||| ||||    
10474037 aagtcctagctcaactggcaaaatgctgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 10473938  T
223 aactgttgtcatttcctctatctaacaaaaaa 254  Q
      || ||| |||||| |||||||| |||||||    
10473937 ggct-ttgccatttcatctatctaccaaaaaa 10473907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 122 - 254
Target Start/End: Complemental strand, 4232305 - 4232170
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagttt 217  Q
    |||| |||||||||||||||||||||||||  ||||||||||||||| ||| | |||||||| | | ||||||||   |||||||||||||||| |||||    
4232305 tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt 4232206  T
218 ctaataactgttgtcatttcctctatctaacaaaaaa 254  Q
     ||||  || ||| |||||| |||||||| |||||||    
4232205 ataatggct-ttgccatttcgtctatctaccaaaaaa 4232170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 122 - 254
Target Start/End: Original strand, 8381079 - 8381214
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagttt 217  Q
    |||| |||||||||||||||||||||||||  ||||||||||||||| ||| | |||||||| | | ||||||||   |||||||||||||||| |||||    
8381079 tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt 8381178  T
218 ctaataactgttgtcatttcctctatctaacaaaaaa 254  Q
     ||||  || ||| |||||| |||||||| |||||||    
8381179 ataatggct-ttgccatttcgtctatctaccaaaaaa 8381214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 127 - 222
Target Start/End: Complemental strand, 44879356 - 44879257
Alignment:
127 aagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatacaaccccgg----ctccacttgtgtgtgtaagtttctaat 222  Q
    ||||||||| |||||||||||||||| ||||||||||||||  ||||| |||||||| | |||||||||    |||||||||||||||| ||||| ||||    
44879356 aagtcctagttcaactggcaaaatgtcgaaattgttaggccagatgtcatgaccggggttcaaccccggtcacctccacttgtgtgtgtgagtttataat 44879257  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 122 - 254
Target Start/End: Original strand, 27396854 - 27396988
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatacaaccccgg---ctccacttgtgtgtgtaagtttc 218  Q
    |||| ||||||||||||||||| |||||||  ||||||||||||||| ||| | |||||||| | | | |||||   |||||||||||||||| |||||     
27396854 tccagaagtcctagctcaactgacaaaatgccgaaattgttaggccggatgccatgaccggggttcgaacccggtacctccacttgtgtgtgtgagttta 27396953  T
219 taataactgttgtcatttcctctatctaacaaaaaa 254  Q
    |||| ||| ||| |||||| |||||||| |||||||    
27396954 taatgact-ttgccatttcttctatctaccaaaaaa 27396988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 122 - 251
Target Start/End: Complemental strand, 38127970 - 38127838
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagttt 217  Q
    |||| |||||||||||||||||||||||||| ||||||||||||||| |||   |||||||| | | ||||||||   |||||||||||||||| |||||    
38127970 tccagaagtcctagctcaactggcaaaatgtcgaaattgttaggccggatgctatgaccggggttcgaaccccggttcctccacttgtgtgtgtgagttt 38127871  T
218 ctaataactgttgtcatttcctctatctaacaaa 251  Q
     ||||  || ||| |||||| |||||||| ||||    
38127870 ataatggct-ttgccatttcgtctatctaccaaa 38127838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 122 - 254
Target Start/End: Original strand, 10228957 - 10229092
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagttt 217  Q
    |||| ||||| || ||||||||||||||||   |||||||||||||||||||| |||||||| | | ||||||||   |||||||||||||||| |||||    
10228957 tccagaagtcttaactcaactggcaaaatgccaaaattgttaggccgaatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt 10229056  T
218 ctaataactgttgtcatttcctctatctaacaaaaaa 254  Q
     ||||  || ||| |||||| |||||||| |||||||    
10229057 ataatggct-ttgccatttcgtctatctaccaaaaaa 10229092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 122 - 254
Target Start/End: Complemental strand, 32961106 - 32960971
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagttt 217  Q
    |||| |||||||||||||||||||||||||  ||||||||||||||  ||| | |||||||| | | ||||||||   |||||||||||||||| |||||    
32961106 tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccagatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt 32961007  T
218 ctaataactgttgtcatttcctctatctaacaaaaaa 254  Q
     ||||  || ||| |||||| |||||||| |||||||    
32961006 ataatggct-ttgccatttcgtctatctaccaaaaaa 32960971  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 122 - 254
Target Start/End: Complemental strand, 43898091 - 43897956
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagttt 217  Q
    |||| ||||||||||||||| | |||||||  ||||||||||||||| ||| | |||||||||| | ||||||||   |||||||||||||||| |||||    
43898091 tccagaagtcctagctcaacagacaaaatgccgaaattgttaggccggatgccatgaccgggattcgaaccccggtacctccacttgtgtgtgtgagttt 43897992  T
218 ctaataactgttgtcatttcctctatctaacaaaaaa 254  Q
      ||| ||| ||| |||||| |||||||| |||||||    
43897991 acaatgact-ttgccatttcgtctatctaccaaaaaa 43897956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 122 - 222
Target Start/End: Complemental strand, 47410880 - 47410776
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagttt 217  Q
    |||| |||||||||||||||||||||||||| |||||||||||| || ||||| |||||||| | | ||||| ||   |||||||||||||||| |||||    
47410880 tccagaagtcctagctcaactggcaaaatgtcgaaattgttaggtcggatgtcatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagttt 47410781  T
218 ctaat 222  Q
     ||||    
47410780 ataat 47410776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 122 - 183
Target Start/End: Original strand, 24751753 - 24751814
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccggg 183  Q
    ||||||||||||||||||||||||||||||  ||||||||||||||| ||||| ||| ||||    
24751753 tccacaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgatcggg 24751814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 122 - 217
Target Start/End: Complemental strand, 43605704 - 43605605
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagttt 217  Q
    |||| ||||||||||||||||||||||||| |||| ||||||||||| ||| | |||||||| | | ||||||||   |||||||||||||||| |||||    
43605704 tccagaagtcctagctcaactggcaaaatgctgaatttgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt 43605605  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 122 - 254
Target Start/End: Complemental strand, 54097568 - 54097434
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg--ctccacttgtgtgtgtaagtttc 218  Q
    |||| |||||||||||||| ||||||||||  ||||||||||||||| ||| | |||||||| |   ||||||||  |||||||||||||||| |||||     
54097568 tccagaagtcctagctcaaatggcaaaatgccgaaattgttaggccggatgccatgaccggggttggaaccccggtcctccacttgtgtgtgtgagttta 54097469  T
219 taataactgttgtcatttcctctatctaacaaaaaa 254  Q
    ||||  || ||| |||||| ||||||||| ||||||    
54097468 taatggct-ttgccatttcgtctatctaataaaaaa 54097434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 122 - 211
Target Start/End: Complemental strand, 29212193 - 29212100
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgt 211  Q
    |||| |||||||||||||||||||||||||  ||||||||||||||| ||| | |||||||| | | ||||||||   ||||||||||||||||    
29212193 tccataagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgt 29212100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 137 - 254
Target Start/End: Original strand, 35359732 - 35359852
Alignment:
137 tcaactggcaaaatgttgaaattgttaggccgaatgtcgtgacc-gggatacaaccccgg---ctccacttgtgtgtgtaagtttctaataactgttgtc 232  Q
    |||||||||||||||  ||||||||||||||| ||| | ||||| ||| |  ||||||||   |||||||||||||||| ||||| |||| ||| |||||    
35359732 tcaactggcaaaatgccgaaattgttaggccggatgccatgaccagggttcgaaccccggtacctccacttgtgtgtgtgagtttataatgact-ttgtc 35359830  T
233 atttcctctatctaacaaaaaa 254  Q
    ||||| |||||||| |||||||    
35359831 atttcgtctatctaccaaaaaa 35359852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 122 - 222
Target Start/End: Complemental strand, 4833237 - 4833133
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagttt 217  Q
    |||| |||||||||||||||||||||||||  ||||||||||||||| ||| | |||||||| | | ||||||||   || ||||||||||||| |||||    
4833237 tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttgtgtgtgtgagttt 4833138  T
218 ctaat 222  Q
     ||||    
4833137 ataat 4833133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 122 - 222
Target Start/End: Complemental strand, 4976836 - 4976732
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagttt 217  Q
    |||| |||||||||||||||||||||||||   |||||||||||||| ||| | |||||||| | | ||||||||   |||||||||||||||| |||||    
4976836 tccagaagtcctagctcaactggcaaaatgccaaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgttagttt 4976737  T
218 ctaat 222  Q
     ||||    
4976736 ataat 4976732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 122 - 254
Target Start/End: Complemental strand, 24910416 - 24910281
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagttt 217  Q
    |||| |||||||||||||||||||||||||  ||||||||||||| | || || ||| |||| | | ||||||||   |||||||||||||||| |||||    
24910416 tccagaagtcctagctcaactggcaaaatgccgaaattgttaggctggatatcatgatcggggttcgaaccccggtacctccacttgtgtgtgtgagttt 24910317  T
218 ctaataactgttgtcatttcctctatctaacaaaaaa 254  Q
     ||||  || ||| |||||| |||||||| |||||||    
24910316 ataatggct-ttgccatttcgtctatctaccaaaaaa 24910281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 122 - 168
Target Start/End: Original strand, 53583961 - 53584007
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccg 168  Q
    |||| |||||||||||||||||||||||||| |||||||||||||||    
53583961 tccagaagtcctagctcaactggcaaaatgtcgaaattgttaggccg 53584007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 127 - 254
Target Start/End: Original strand, 1242222 - 1242352
Alignment:
127 aagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagtttctaat 222  Q
    |||||||||||||||||||||||||  |||||| |||||||| ||| | ||| |||| | | ||||||||   |||||||||||||||| ||||| ||||    
1242222 aagtcctagctcaactggcaaaatgccgaaattattaggccggatgccatgatcggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 1242321  T
223 aactgttgtcatttcctctatctaacaaaaaa 254  Q
      || ||| |||||| |||||||| |||||||    
1242322 ggct-ttgccatttcgtctatctaccaaaaaa 1242352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 122 - 217
Target Start/End: Complemental strand, 6583363 - 6583264
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagttt 217  Q
    |||| |||||||||||||||||||||||||  ||||||||||||||| ||| | ||| |||| | | ||||||||   |||||||||||||||| |||||    
6583363 tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgatcggggttcgaaccccggtgcctccacttgtgtgtgtgagttt 6583264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 122 - 217
Target Start/End: Complemental strand, 24650675 - 24650576
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagttt 217  Q
    |||| |||||||| ||||||||||||||||  ||||||||||||||| ||| | |||||||| | | ||||||||   |||||||||||||||| |||||    
24650675 tccagaagtcctacctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt 24650576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 117 - 178
Target Start/End: Complemental strand, 44037577 - 44037516
Alignment:
117 ataagtccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtga 178  Q
    |||| |||| |||||||||||||||||||||||||  |||||||||||| || |||||||||    
44037577 ataaatccagaagtcctagctcaactggcaaaatgccgaaattgttaggtcggatgtcgtga 44037516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 122 - 254
Target Start/End: Original strand, 22371450 - 22371584
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg--ctccacttgtgtgtgtaagtttc 218  Q
    |||| |||||||| ||||||||||||||||  ||||||||||||||| ||| | |||||||| | | |||| | |  ||||| ||||||||||||||||     
22371450 tccagaagtcctacctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccacagtcctccatttgtgtgtgtaagttta 22371549  T
219 taataactgttgtcatttcctctatctaacaaaaaa 254  Q
    ||||  || ||| |||||| |||||||| |||||||    
22371550 taatggct-ttgccatttcgtctatctaccaaaaaa 22371584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 122 - 254
Target Start/End: Original strand, 11029663 - 11029799
Alignment:
122 tccacaagtcctagctcaactggc-aaaatgttgaaattgttaggccgaatgtcgtgacc-gggatacaaccccgg---ctccacttgtgtgtgtaagtt 216  Q
    |||| ||||||||||||||||||| ||||||| ||||||||||||| | ||| | ||||| ||| |  ||||||||   |||||||||||||||| ||||    
11029663 tccagaagtcctagctcaactggcaaaaatgtcgaaattgttaggctggatgccatgaccagggttcgaaccccggtacctccacttgtgtgtgtgagtt 11029762  T
217 tctaataactgttgtcatttcctctatctaacaaaaaa 254  Q
    | ||||  || ||| |||||| |||||||| |||||||    
11029763 tataatggct-ttgccatttcgtctatctaccaaaaaa 11029799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 122 - 254
Target Start/End: Complemental strand, 28171108 - 28170972
Alignment:
122 tccacaagtcctagctcaactggc-aaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagtt 216  Q
    |||| ||||||||||||||||||| ||||||  ||||||||||||||| ||| | |||||||| | | ||||||||   ||| |||||||||||| ||||    
28171108 tccagaagtcctagctcaactggcaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggcacctctacttgtgtgtgtgagtt 28171009  T
217 tctaataactgttgtcatttcctctatctaacaaaaaa 254  Q
    | ||||  || ||| |||||| |||||||| |||||||    
28171008 tataatggct-ttgccatttcgtctatctaccaaaaaa 28170972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 129 - 183
Target Start/End: Original strand, 2558754 - 2558808
Alignment:
129 gtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccggg 183  Q
    ||||||||||||||||||||||| ||||||||||||| || ||||| ||| ||||    
2558754 gtcctagctcaactggcaaaatgctgaaattgttaggtcggatgtcatgatcggg 2558808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 122 - 168
Target Start/End: Original strand, 2687559 - 2687605
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccg 168  Q
    |||| |||||||||||||||||||||||||  |||||||||||||||    
2687559 tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccg 2687605  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #32
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 127 - 211
Target Start/End: Original strand, 11312595 - 11312683
Alignment:
127 aagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgt 211  Q
    |||||||||||||||||||||||||  ||||||||||||||| |||   |||||||| | | ||||||||   ||||||||||||||||    
11312595 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgctatgaccggggttcgaaccccggtacctccacttgtgtgtgt 11312683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #33
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 139 - 263
Target Start/End: Complemental strand, 28197095 - 28196968
Alignment:
139 aactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagtttctaataactgttgtcat 234  Q
    |||||||||||||  ||||||||||||||| ||||| |||||||| | | ||||||||   |||||||||||||||| ||||| ||||  || |||  ||    
28197095 aactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataatggct-ttgcaat 28196997  T
235 ttcctctatctaacaaaaaatataaaata 263  Q
    ||| |||||||| ||||||| | ||||||    
28196996 ttcgtctatctaccaaaaaaaaaaaaata 28196968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #34
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 122 - 168
Target Start/End: Original strand, 32590972 - 32591018
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccg 168  Q
    |||| |||||||||||||||||| ||||||| |||||||||||||||    
32590972 tccagaagtcctagctcaactggtaaaatgtcgaaattgttaggccg 32591018  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #35
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 122 - 222
Target Start/End: Original strand, 34397680 - 34397784
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccg---gctccacttgtgtgtgtaagttt 217  Q
    |||| ||||||||| |||||||||||||||  ||||||||||||||| ||||| | |||||| | | |||||||    |||||||||||||||| |||||    
34397680 tccagaagtcctagttcaactggcaaaatgccgaaattgttaggccggatgtcataaccggggttcgaaccccgatacctccacttgtgtgtgtgagttt 34397779  T
218 ctaat 222  Q
     ||||    
34397780 ataat 34397784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #36
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 130 - 172
Target Start/End: Original strand, 38085814 - 38085856
Alignment:
130 tcctagctcaactggcaaaatgttgaaattgttaggccgaatg 172  Q
    |||||||||||||| |||||||| |||||||||||||||||||    
38085814 tcctagctcaactgacaaaatgtcgaaattgttaggccgaatg 38085856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #37
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 122 - 210
Target Start/End: Complemental strand, 40418603 - 40418511
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtg 210  Q
    |||| ||||||||||||||| || |||||| ||||||||||||||| |||||| ||| |||| | | ||||||||   |||||||||||||||    
40418603 tccagaagtcctagctcaacaggaaaaatgctgaaattgttaggccaaatgtcatgatcggggttcgaaccccggtacctccacttgtgtgtg 40418511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #38
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 127 - 254
Target Start/End: Complemental strand, 52256876 - 52256745
Alignment:
127 aagtcctagctcaactggcaaaa-tgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagtttctaa 221  Q
    |||| |||||||||||||||||| ||| || |||||||||| | ||| | |||||||| | | ||||||||   |||||||||||||||| ||||| |||    
52256876 aagttctagctcaactggcaaaaatgtcgatattgttaggctggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataa 52256777  T
222 taactgttgtcatttcctctatctaacaaaaaa 254  Q
    | ||| ||| |||||| |||||||| |||||||    
52256776 tgact-ttgccatttcgtctatctaccaaaaaa 52256745  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #39
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 122 - 222
Target Start/End: Complemental strand, 6083269 - 6083166
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatacaaccccgg---ctccacttgtgtgtgtaagtttc 218  Q
    |||| |||||||||||||||| ||||||||  ||||||||||||||| ||  | |||||||| |  ||| ||||   |||||||||||||||| |||||     
6083269 tccagaagtcctagctcaactagcaaaatgccgaaattgttaggccggataccatgaccgggttcgaactccggtacctccacttgtgtgtgtgagttta 6083170  T
219 taat 222  Q
    ||||    
6083169 taat 6083166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #40
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 127 - 254
Target Start/End: Complemental strand, 25118829 - 25118699
Alignment:
127 aagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgacc-gggatacaaccccgg---ctccacttgtgtgtgtaagtttctaat 222  Q
    ||||| |||||||||| ||||||||| ||||||||||||||| ||| | ||||| ||| |  ||||||||   |||||| ||||||||| | ||| ||||    
25118829 aagtcttagctcaactagcaaaatgtcgaaattgttaggccggatgccatgaccagggttcgaaccccggtacctccacctgtgtgtgtgaatttataat 25118730  T
223 aactgttgtcatttcctctatctaacaaaaaa 254  Q
     | | |||||||||| |||||||| |||||||    
25118729 ga-ttttgtcatttcgtctatctaccaaaaaa 25118699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #41
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 122 - 183
Target Start/End: Original strand, 37124216 - 37124277
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccggg 183  Q
    |||| ||||| |||||| ||||||||||||  ||||||||||||||||||| | ||||||||    
37124216 tccagaagtcatagctctactggcaaaatgccgaaattgttaggccgaatgccatgaccggg 37124277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #42
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 122 - 183
Target Start/End: Original strand, 41464664 - 41464725
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccggg 183  Q
    |||| |||||||||||||||||||||||||  |||||||||||| || ||| | ||||||||    
41464664 tccagaagtcctagctcaactggcaaaatgccgaaattgttaggtcggatgccatgaccggg 41464725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #43
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 127 - 168
Target Start/End: Complemental strand, 46311566 - 46311525
Alignment:
127 aagtcctagctcaactggcaaaatgttgaaattgttaggccg 168  Q
    |||||||||||||||||| ||||||| |||||||||||||||    
46311566 aagtcctagctcaactggtaaaatgtcgaaattgttaggccg 46311525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #44
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 122 - 183
Target Start/End: Complemental strand, 46838855 - 46838794
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccggg 183  Q
    |||| |||||||||||||||||| ||||||  ||||||||||||||| ||| | ||||||||    
46838855 tccagaagtcctagctcaactggaaaaatgccgaaattgttaggccggatgccatgaccggg 46838794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #45
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 127 - 168
Target Start/End: Complemental strand, 50238963 - 50238922
Alignment:
127 aagtcctagctcaactggcaaaatgttgaaattgttaggccg 168  Q
    |||||||||||||||||| ||||||| |||||||||||||||    
50238963 aagtcctagctcaactggtaaaatgtcgaaattgttaggccg 50238922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #46
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 133 - 254
Target Start/End: Original strand, 3440736 - 3440861
Alignment:
133 tagctcaactggcaaaa-tgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagtttctaataactg 227  Q
    ||||||||||||||||| ||  ||||||||||||||| ||| | |||||||| | | ||||||||   |||||||||||||||| ||||| ||||  ||     
3440736 tagctcaactggcaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataatggct- 3440834  T
228 ttgtcatttcctctatctaacaaaaaa 254  Q
    ||| |||||| |||||||| |||||||    
3440835 ttgccatttcgtctatctaccaaaaaa 3440861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #47
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 122 - 182
Target Start/End: Complemental strand, 30553096 - 30553036
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgg 182  Q
    |||| |||||||||||||||||||||||||  ||||||||||| ||| ||| | |||||||    
30553096 tccagaagtcctagctcaactggcaaaatgccgaaattgttagaccggatgccatgaccgg 30553036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #48
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 130 - 222
Target Start/End: Original strand, 43967932 - 43968027
Alignment:
130 tcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtga-ccgggatacaaccccgg--ctccacttgtgtgtgtaagtttctaat 222  Q
    ||||||||||||||| ||| || |||||||||||||||| ||||| ||| | ||| |  ||||||||  |||||||||||||||| ||||| ||||    
43967932 tcctagctcaactggtaaagtgctgaaattgttaggccggatgtcatgatcagggttcgaaccccggtactccacttgtgtgtgtgagtttataat 43968027  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #49
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 127 - 183
Target Start/End: Original strand, 48191099 - 48191155
Alignment:
127 aagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccggg 183  Q
    |||||||||||||||||  ||||||  ||||||||||||||| ||||| ||||||||    
48191099 aagtcctagctcaactgctaaaatgccgaaattgttaggccggatgtcatgaccggg 48191155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #50
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 122 - 165
Target Start/End: Original strand, 11249960 - 11250003
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttagg 165  Q
    ||||||||||||||||||||||| ||||||  ||||||||||||    
11249960 tccacaagtcctagctcaactggtaaaatgcagaaattgttagg 11250003  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #51
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 122 - 165
Target Start/End: Complemental strand, 19921440 - 19921397
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttagg 165  Q
    |||| |||||||||||||| |||||||||| |||||||||||||    
19921440 tccagaagtcctagctcaattggcaaaatgctgaaattgttagg 19921397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #52
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 127 - 174
Target Start/End: Original strand, 39172045 - 39172092
Alignment:
127 aagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtc 174  Q
    ||||||||||  ||||||||||||||  ||||||||||||||||||||    
39172045 aagtcctagcataactggcaaaatgtcaaaattgttaggccgaatgtc 39172092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #53
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 122 - 181
Target Start/End: Original strand, 46894813 - 46894872
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccg 181  Q
    |||| ||||||||||||||||| |||||| | ||||||||||||||| ||| | ||||||    
46894813 tccagaagtcctagctcaactgacaaaatatcgaaattgttaggccggatgccatgaccg 46894872  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #54
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 122 - 222
Target Start/End: Original strand, 47069006 - 47069111
Alignment:
122 tccacaagtcctagctcaactggc-aaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagtt 216  Q
    |||| ||||| ||||||||||||| ||||||  ||||||||||||||| ||| | |||||||| | | ||||||||   |||||||||||||||| ||||    
47069006 tccagaagtcttagctcaactggcaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtt 47069105  T
217 tctaat 222  Q
    | ||||    
47069106 tataat 47069111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #55
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 122 - 254
Target Start/End: Original strand, 15003628 - 15003763
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagttt 217  Q
    |||| ||||||||| |||||||||||||||   ||||||||||| || ||||| |||||||| | | ||||||||   |||||| | ||||||| |||||    
15003628 tccagaagtcctagttcaactggcaaaatgccaaaattgttaggtcggatgtcatgaccggggttcgaaccccggtacctccacctatgtgtgtgagttt 15003727  T
218 ctaataactgttgtcatttcctctatctaacaaaaaa 254  Q
     ||||  || ||| |||||| |||||||| |||||||    
15003728 ataatggct-ttgccatttcgtctatctaccaaaaaa 15003763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #56
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 122 - 168
Target Start/End: Original strand, 24250725 - 24250771
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccg 168  Q
    |||| |||||||||||||| ||||||||||  |||||||||||||||    
24250725 tccagaagtcctagctcaattggcaaaatgccgaaattgttaggccg 24250771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #57
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 127 - 211
Target Start/End: Original strand, 35069318 - 35069406
Alignment:
127 aagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgt 211  Q
    ||||| ||| |||||||||||||||  ||||||||||||||| ||| | |||||||| | | ||||||||   ||||||||||||||||    
35069318 aagtcttagttcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgt 35069406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #58
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 196 - 254
Target Start/End: Original strand, 36518178 - 36518235
Alignment:
196 ctccacttgtgtgtgtaagtttctaataactgttgtcatttcctctatctaacaaaaaa 254  Q
    |||||||||||||||| ||||| |||| ||| |||||||||| ||||||||| ||||||    
36518178 ctccacttgtgtgtgtgagtttataatgact-ttgtcatttcgtctatctaaaaaaaaa 36518235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #59
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 122 - 168
Target Start/End: Complemental strand, 40193084 - 40193038
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccg 168  Q
    |||| ||||||||||| |||||| ||||||| |||||||||||||||    
40193084 tccagaagtcctagcttaactggtaaaatgtcgaaattgttaggccg 40193038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #60
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 127 - 210
Target Start/End: Original strand, 40840173 - 40840261
Alignment:
127 aagtcctagctcaactggc-aaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtg 210  Q
    ||||||||||||||||||| ||||||  ||||||||||||||| ||| | |||||||| | | ||||||||   |||||||||||||||    
40840173 aagtcctagctcaactggcaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtg 40840261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #61
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 122 - 210
Target Start/End: Original strand, 42296712 - 42296803
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtg 210  Q
    |||| ||||||||||||||||| |||||||   |||||||||||||| ||||| |||||||| | | ||||||||   |||||||||||||||    
42296712 tccagaagtcctagctcaactg-caaaatgccaaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtg 42296803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #62
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 122 - 168
Target Start/End: Original strand, 47408840 - 47408886
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccg 168  Q
    |||| |||||||||||||||| ||||||||  |||||||||||||||    
47408840 tccagaagtcctagctcaactagcaaaatgccgaaattgttaggccg 47408886  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #63
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 174
Target Start/End: Original strand, 2900250 - 2900307
Alignment:
117 ataagtccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtc 174  Q
    |||| |||| |||||||||||| ||||||||||||  |||||||||| |||| |||||    
2900250 ataaatccagaagtcctagctccactggcaaaatgccgaaattgttaagccggatgtc 2900307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #64
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 127 - 168
Target Start/End: Original strand, 12948815 - 12948856
Alignment:
127 aagtcctagctcaactggcaaaatgttgaaattgttaggccg 168  Q
    |||||||||||||||||| ||||||  |||||||||||||||    
12948815 aagtcctagctcaactggtaaaatgacgaaattgttaggccg 12948856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #65
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 122 - 183
Target Start/End: Original strand, 17500927 - 17500988
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccggg 183  Q
    |||| |||||||| ||||||||| ||||||  ||||||||||||||| ||| | ||||||||    
17500927 tccagaagtcctaactcaactggaaaaatgccgaaattgttaggccggatgccatgaccggg 17500988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #66
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 122 - 179
Target Start/End: Original strand, 19961369 - 19961426
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgac 179  Q
    |||| |||||||| |||||||| |||||||| |||||||||||| || ||||| ||||    
19961369 tccagaagtcctaactcaactgacaaaatgtcgaaattgttaggtcggatgtcatgac 19961426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #67
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 122 - 163
Target Start/End: Complemental strand, 21402786 - 21402745
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgtta 163  Q
    |||| |||||||||||||||||||||||||  ||||||||||    
21402786 tccagaagtcctagctcaactggcaaaatgccgaaattgtta 21402745  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #68
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 122 - 167
Target Start/End: Original strand, 23878946 - 23878991
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggcc 167  Q
    ||||||||||||||||||||||| ||||||   |||||||||||||    
23878946 tccacaagtcctagctcaactggaaaaatgcctaaattgttaggcc 23878991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #69
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 122 - 183
Target Start/End: Original strand, 28266526 - 28266587
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccggg 183  Q
    |||| ||||||||||||||||| |||||||  ||||||||||||| | ||| | ||||||||    
28266526 tccagaagtcctagctcaactgacaaaatgccgaaattgttaggctggatgccatgaccggg 28266587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #70
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 200 - 261
Target Start/End: Complemental strand, 46316523 - 46316464
Alignment:
200 acttgtgtgtgtaagtttctaataactgttgtcatttcctctatctaacaaaaaatataaaa 261  Q
    |||||||||||| ||||| |||||||| |||||||||| ||||||| |||||||| ||||||    
46316523 acttgtgtgtgtgagtttataataact-ttgtcatttcgtctatct-acaaaaaaaataaaa 46316464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #71
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 122 - 183
Target Start/End: Original strand, 49285508 - 49285569
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccggg 183  Q
    |||| |||||||| ||| |||| |||||||| |||||||||||| |||||||  ||||||||    
49285508 tccagaagtcctaactccactgacaaaatgtcgaaattgttaggtcgaatgttttgaccggg 49285569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #72
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 127 - 168
Target Start/End: Complemental strand, 53669834 - 53669793
Alignment:
127 aagtcctagctcaactggcaaaatgttgaaattgttaggccg 168  Q
    |||| ||||||||||||| |||||| ||||||||||||||||    
53669834 aagttctagctcaactggtaaaatgctgaaattgttaggccg 53669793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #73
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 122 - 211
Target Start/End: Original strand, 11751211 - 11751305
Alignment:
122 tccacaagtcctagctcaactggc-aaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgt 211  Q
    |||| ||||||||||||||||||| ||||||  ||||||||||||||| ||| | | |||||| | | ||||||||   ||||||||||||||||    
11751211 tccataagtcctagctcaactggcaaaaatgccgaaattgttaggccggatgccatcaccggggttcgaaccccggtacctccacttgtgtgtgt 11751305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #74
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 130 - 236
Target Start/End: Original strand, 32635387 - 32635496
Alignment:
130 tcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagtttctaataac 225  Q
    |||||||| |||||||||||||| |||||| ||||| || ||||| ||| |||| | | ||||||||   |||||||||||||||  ||||| |||| ||    
32635387 tcctagcttaactggcaaaatgtcgaaattattaggtcggatgtcatgatcggggttcgaaccccggtacctccacttgtgtgtgcgagtttataatgac 32635486  T
226 tgttgtcattt 236  Q
    | |||||||||    
32635487 t-ttgtcattt 32635496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #75
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 127 - 167
Target Start/End: Original strand, 41921511 - 41921551
Alignment:
127 aagtcctagctcaactggcaaaatgttgaaattgttaggcc 167  Q
    |||||||||||||||||| ||||||  ||||||||||||||    
41921511 aagtcctagctcaactggtaaaatgccgaaattgttaggcc 41921551  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 55; Significance: 1e-22; HSPs: 60)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 122 - 254
Target Start/End: Original strand, 49500861 - 49500996
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccg-ggatacaaccccgg---ctccacttgtgtgtgtaagttt 217  Q
    ||||||||||||||||||||||||||||||  ||||||||||||||| ||||| ||| || || |  ||||||||   |||||||||||||||| |||||    
49500861 tccacaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgatcgaggttcgaaccccggtacctccacttgtgtgtgtgagttt 49500960  T
218 ctaataactgttgtcatttcctctatctaacaaaaaa 254  Q
     ||||| || |||||||||| |||||||| |||||||    
49500961 ataatagct-ttgtcatttcgtctatctaccaaaaaa 49500996  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 122 - 246
Target Start/End: Original strand, 49948241 - 49948368
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagttt 217  Q
    |||| |||||||||||||||||||||||||| ||||||||||||||| ||| | |||||||||| | |||||| |   |||||||||||||||| |||||    
49948241 tccagaagtcctagctcaactggcaaaatgtcgaaattgttaggccggatgccatgaccgggattcgaaccccagtacctccacttgtgtgtgtgagttt 49948340  T
218 ctaataactgttgtcatttcctctatcta 246  Q
     |||| ||| |||||||||| ||||||||    
49948341 ataatgact-ttgtcatttcgtctatcta 49948368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 127 - 185
Target Start/End: Complemental strand, 11797522 - 11797464
Alignment:
127 aagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggat 185  Q
    |||||||| ||||||||||||||||| ||||||||||||||||||||| ||||||||||    
11797522 aagtcctaactcaactggcaaaatgtcgaaattgttaggccgaatgtcatgaccgggat 11797464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 122 - 254
Target Start/End: Complemental strand, 19338306 - 19338171
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagttt 217  Q
    |||| |||||||||||||||||||||||||  ||||||||||||||| ||| | |||||||| | | ||||||||   |||||||||||||||| |||||    
19338306 tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt 19338207  T
218 ctaataactgttgtcatttcctctatctaacaaaaaa 254  Q
     ||||  || ||| |||||| |||||||| |||||||    
19338206 ataatggct-ttgccatttcgtctatctaccaaaaaa 19338171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 122 - 246
Target Start/End: Original strand, 36586251 - 36586378
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagttt 217  Q
    ||||||||||||| ||||||||| ||||||| ||||||||||||||| ||| ||||| |||| | | ||||||||   |||||||||||||||| |||||    
36586251 tccacaagtcctaactcaactggtaaaatgtcgaaattgttaggccggatgccgtgatcggggttcgaaccccggtacctccacttgtgtgtgtgagttt 36586350  T
218 ctaataactgttgtcatttcctctatcta 246  Q
     ||||  || |||||||||| ||||||||    
36586351 ataatggct-ttgtcatttcatctatcta 36586378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 122 - 254
Target Start/End: Complemental strand, 42631113 - 42630978
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccg---gctccacttgtgtgtgtaagttt 217  Q
    |||| |||||||||||||||||||||||||  ||||||||||||||| ||| | ||| |||| | | |||||||    |||||||||||||||| |||||    
42631113 tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgatcggggttcgaaccccgatacctccacttgtgtgtgtgagttt 42631014  T
218 ctaataactgttgtcatttcctctatctaacaaaaaa 254  Q
     |||| ||| |||||||||| |||||||| |||||||    
42631013 ataatgact-ttgtcatttcgtctatctatcaaaaaa 42630978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 117 - 254
Target Start/End: Complemental strand, 43676157 - 43676017
Alignment:
117 ataagtccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgta 212  Q
    |||| |||| |||||||||||||||||||||||||  ||||||||||||||| ||| | |||||||| | | ||||||||   || |||||||||||||     
43676157 ataaatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttgtgtgtgtg 43676058  T
213 agtttctaataactgttgtcatttcctctatctaacaaaaaa 254  Q
    ||||| ||||  || ||| |||||| |||||||| |||||||    
43676057 agtttataatggct-ttgccatttcgtctatctaccaaaaaa 43676017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 122 - 211
Target Start/End: Original strand, 48314167 - 48314260
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgt 211  Q
    |||| |||||||||||||||||||||||||  ||||||||||||||| ||||| |||||||| | | ||||||||   ||||||||||||||||    
48314167 tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgt 48314260  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 122 - 254
Target Start/End: Original strand, 5598301 - 5598436
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgg-gatacaaccccgg---ctccacttgtgtgtgtaagttt 217  Q
    |||| |||||||||||||||||| ||||||  |||||||||||| || ||||| ||||||| | |  ||||||||   |||||||||||||||| |||||    
5598301 tccagaagtcctagctcaactggaaaaatgccgaaattgttaggtcggatgtcatgaccggagttcgaaccccggtacctccacttgtgtgtgtgagttt 5598400  T
218 ctaataactgttgtcatttcctctatctaacaaaaaa 254  Q
     ||||  || |||||||||| ||||||||| ||||||    
5598401 ataatggct-ttgtcatttcgtctatctaaaaaaaaa 5598436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 130 - 254
Target Start/End: Complemental strand, 20164193 - 20164066
Alignment:
130 tcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagtttctaataac 225  Q
    ||||||||||||||||||||||  ||||||||||||||| ||| | |||||||| | | ||||||||   |||||||||||||||| ||||| ||||  |    
20164193 tcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataatggc 20164094  T
226 tgttgtcatttcctctatctaacaaaaaa 254  Q
    | ||| |||||| |||||||| |||||||    
20164093 t-ttgccatttcgtctatctaccaaaaaa 20164066  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 122 - 222
Target Start/End: Original strand, 29005090 - 29005194
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagttt 217  Q
    |||| |||||||||||||||||||||||||  ||||||||||||||| ||| | |||||||| | | ||||||||   |||||||||||||||| |||||    
29005090 tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt 29005189  T
218 ctaat 222  Q
     ||||    
29005190 ataat 29005194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 122 - 254
Target Start/End: Complemental strand, 40958702 - 40958567
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagttt 217  Q
    |||| |||||||||||||||||||||||||  ||||||||||||||| ||| | |||||||| | | || |||||   |||||||||||||||| |||||    
40958702 tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaatcccggtacctccacttgtgtgtgtgagttt 40958603  T
218 ctaataactgttgtcatttcctctatctaacaaaaaa 254  Q
     ||||  || ||| |||||| |||||||| |||||||    
40958602 ataatggct-ttgccatttcgtctatctaccaaaaaa 40958567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 122 - 246
Target Start/End: Complemental strand, 43086599 - 43086472
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagttt 217  Q
    |||| |||||||||||||||||||||||||  ||||||||||||||| ||| | ||| |||| | | ||||||||   |||||||||||||||| |||||    
43086599 tccataagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgatcggggttcgaaccccggtacctccacttgtgtgtgtgagttt 43086500  T
218 ctaataactgttgtcatttcctctatcta 246  Q
     ||||  || |||||||||| ||||||||    
43086499 ataatggct-ttgtcatttcgtctatcta 43086472  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 122 - 217
Target Start/End: Original strand, 10635489 - 10635588
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagttt 217  Q
    |||| |||||||||||||||||||||||||  ||||||||||||||| ||| | |||||||| | | ||||||||   |||||||||||||||| |||||    
10635489 tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt 10635588  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 114 - 183
Target Start/End: Original strand, 24119648 - 24119717
Alignment:
114 aatataagtccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccggg 183  Q
    ||||||| | || |||||||||||||||||||||||||  ||||||||||||||| ||||| ||||||||    
24119648 aatataaattcagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggg 24119717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 122 - 183
Target Start/End: Complemental strand, 39787778 - 39787717
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccggg 183  Q
    ||||||||||||||||||||||| ||||||| ||||||||||| ||||||| | ||||||||    
39787778 tccacaagtcctagctcaactggtaaaatgtcgaaattgttagaccgaatgccatgaccggg 39787717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 122 - 183
Target Start/End: Original strand, 40685529 - 40685590
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccggg 183  Q
    |||| |||||||||||||||||||||||||| |||||||||||| || ||||| ||||||||    
40685529 tccagaagtcctagctcaactggcaaaatgtcgaaattgttaggtcggatgtcatgaccggg 40685590  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 122 - 183
Target Start/End: Complemental strand, 40809341 - 40809280
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccggg 183  Q
    |||| |||||||||||||||||||||||||  ||||||||||||||| ||||| ||||||||    
40809341 tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggg 40809280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 127 - 217
Target Start/End: Complemental strand, 13555847 - 13555753
Alignment:
127 aagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagttt 217  Q
    |||||||||||||||||||||||||  |||||| |||||||| ||||| |||||||| | | ||||||||   |||||||||||||||| |||||    
13555847 aagtcctagctcaactggcaaaatgccgaaattattaggccggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt 13555753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 122 - 260
Target Start/End: Original strand, 50248029 - 50248170
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccg-ggatacaaccccg---gctccacttgtgtgtgtaagttt 217  Q
    |||| |||||||||||||||||  ||||||| ||||||||||||||| ||||| |||||| || |  |||||||    |||||||||||||||| |||||    
50248029 tccagaagtcctagctcaactgataaaatgtcgaaattgttaggccggatgtcatgaccgaggttcgaaccccgatacctccacttgtgtgtgtgagttt 50248128  T
218 ctaataactgttgtcatttcctctatctaacaaaaaatataaa 260  Q
     ||||  || ||| |||||| |||||||| ||||||| |||||    
50248129 ataatggct-ttgccatttcgtctatctaccaaaaaaaataaa 50248170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 118 - 246
Target Start/End: Original strand, 2112743 - 2112874
Alignment:
118 taagtccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaa 213  Q
    ||||||||||||||||||||||||| |||||||| |||||| |||||| || | ||| |||||||| | | |||||  |   |||||||||||||||| |    
2112743 taagtccacaagtcctagctcaactagcaaaatgatgaaatcgttaggtcggacgtcatgaccggggttcgaacccatgtacctccacttgtgtgtgtga 2112842  T
214 gtttctaataactgttgtcatttcctctatcta 246  Q
    |||| ||||  || |||||||||| ||||||||    
2112843 gtttataatggct-ttgtcatttcgtctatcta 2112874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 122 - 253
Target Start/End: Original strand, 11786103 - 11786238
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaag-tt 216  Q
    ||||||||| ||||||||||||  |||||| |||||||||||||||| ||||| || | ||| | | ||||||||   |||||||||||||||| || ||    
11786103 tccacaagttctagctcaactgataaaatgctgaaattgttaggccggatgtcatggctggggttcaaaccccggtacctccacttgtgtgtgtgagttt 11786202  T
217 tctaataactgttgtcatttcctctatctaacaaaaa 253  Q
    | |||| ||| |||||||||| ||||||||| |||||    
11786203 tataatgact-ttgtcatttcgtctatctaaaaaaaa 11786238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 122 - 254
Target Start/End: Original strand, 48391956 - 48392091
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgacc-gggatacaaccccgg---ctccacttgtgtgtgtaagttt 217  Q
    |||| |||||||||||||||||||||||||  ||||||||||||||| ||| | ||||| ||| |  ||||||||   |||||||| ||||||| |||||    
48391956 tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccagggttcgaaccccggtacctccacttatgtgtgtgagttt 48392055  T
218 ctaataactgttgtcatttcctctatctaacaaaaaa 254  Q
     ||||  || ||| |||||| |||||||| |||||||    
48392056 ataatggct-ttgccatttcgtctatctaccaaaaaa 48392091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 127 - 222
Target Start/End: Original strand, 3315799 - 3315898
Alignment:
127 aagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagtttctaat 222  Q
    |||||||||||||||||||||||||  || |||||||||||| ||| | ||||| |||| | ||||||||   |||||||||||||||| ||||| ||||    
3315799 aagtcctagctcaactggcaaaatgccgacattgttaggccggatgccatgaccaggattcgaaccccggtacctccacttgtgtgtgtgagtttataat 3315898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 127 - 254
Target Start/End: Complemental strand, 41445153 - 41445023
Alignment:
127 aagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgg-gatacaaccccgg---ctccacttgtgtgtgtaagtttctaat 222  Q
    |||||||||||||||||||||||||  || |||||||||||| ||||| ||| ||| | |  ||||||||   |||||||||||||||| ||||| | ||    
41445153 aagtcctagctcaactggcaaaatgccgacattgttaggccggatgtcatgatcggagttcgaaccccggtacctccacttgtgtgtgtgagtttattat 41445054  T
223 aactgttgtcatttcctctatctaacaaaaaa 254  Q
      || ||| |||||| ||||||||||||||||    
41445053 ggct-ttgccatttcgtctatctaacaaaaaa 41445023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 127 - 254
Target Start/End: Complemental strand, 48731879 - 48731749
Alignment:
127 aagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagtttctaat 222  Q
    ||||||||||||||||| |||||||  ||||||||||||||  ||| | |||||||| | | ||||||||   ||| |||||||||||| ||||| ||||    
48731879 aagtcctagctcaactgacaaaatgccgaaattgttaggccagatgccatgaccggggttcgaaccccggtacctctacttgtgtgtgtgagtttataat 48731780  T
223 aactgttgtcatttcctctatctaacaaaaaa 254  Q
      || |||||||||| |||||||| |||||||    
48731779 ggct-ttgtcatttcgtctatctaccaaaaaa 48731749  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 127 - 183
Target Start/End: Original strand, 5790063 - 5790119
Alignment:
127 aagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccggg 183  Q
    ||||||||||| |||||||||||||  ||||||||||||||| ||||| ||||||||    
5790063 aagtcctagcttaactggcaaaatgccgaaattgttaggccggatgtcatgaccggg 5790119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #28
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 122 - 182
Target Start/End: Original strand, 28999374 - 28999434
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgg 182  Q
    |||| |||||||||||||||||||||||||  ||||||||||||||| ||| | |||||||    
28999374 tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg 28999434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #29
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 127 - 183
Target Start/End: Original strand, 29511113 - 29511169
Alignment:
127 aagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccggg 183  Q
    |||||||||||||| ||| ||||||  ||||||||||||||||||||| ||||||||    
29511113 aagtcctagctcaattggtaaaatgacgaaattgttaggccgaatgtcatgaccggg 29511169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #30
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 122 - 174
Target Start/End: Original strand, 40503597 - 40503649
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtc 174  Q
    |||| |||| |||||||||||| |||||||||||||||||||||||| |||||    
40503597 tccagaagttctagctcaactgacaaaatgttgaaattgttaggccggatgtc 40503649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #31
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 127 - 166
Target Start/End: Complemental strand, 3840485 - 3840446
Alignment:
127 aagtcctagctcaactggcaaaatgttgaaattgttaggc 166  Q
    |||||||||||||||||||||||||| |||||||||||||    
3840485 aagtcctagctcaactggcaaaatgtcgaaattgttaggc 3840446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #32
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 122 - 254
Target Start/End: Original strand, 4126575 - 4126710
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtga-ccgggatacaaccccgg---ctccacttgtgtgtgtaagttt 217  Q
    |||| ||||||||||||||||| |||||||  ||||||||||||||| ||| | ||| | ||| |  ||||||||   |||||||||||||||| |||||    
4126575 tccagaagtcctagctcaactgacaaaatgcggaaattgttaggccggatgccatgatcagggttcgaaccccggtacctccacttgtgtgtgtgagttt 4126674  T
218 ctaataactgttgtcatttcctctatctaacaaaaaa 254  Q
     ||||  || ||| |||||| |||||||| |||||||    
4126675 ataatgcct-ttgccatttcgtctatctaccaaaaaa 4126710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #33
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 122 - 222
Target Start/End: Original strand, 17068152 - 17068256
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagttt 217  Q
    |||| |||||||||||||||||| ||||||  ||||||||||||||| ||| | ||| |||| | | ||||||||   |||||||||||||||| |||||    
17068152 tccagaagtcctagctcaactggtaaaatgccgaaattgttaggccggatgccatgagcggggttcgaaccccggtacctccacttgtgtgtgtgagttt 17068251  T
218 ctaat 222  Q
     ||||    
17068252 ataat 17068256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #34
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 122 - 222
Target Start/End: Complemental strand, 25821078 - 25820974
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagttt 217  Q
    |||| |||||||||||||||||  ||||||| ||||||||||||||| ||| | |||||||| | | ||||| ||   |||||||||||||||| |||||    
25821078 tccagaagtcctagctcaactgataaaatgtcgaaattgttaggccggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagttt 25820979  T
218 ctaat 222  Q
     ||||    
25820978 ataat 25820974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #35
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 122 - 168
Target Start/End: Complemental strand, 26261421 - 26261375
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccg 168  Q
    ||||||||||||||||||||||| ||||||  |||||||||||||||    
26261421 tccacaagtcctagctcaactggaaaaatgccgaaattgttaggccg 26261375  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #36
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 122 - 168
Target Start/End: Original strand, 34010094 - 34010140
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccg 168  Q
    |||| ||||| |||||||||||||||||||| |||||||||||||||    
34010094 tccagaagtcttagctcaactggcaaaatgtcgaaattgttaggccg 34010140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #37
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 127 - 254
Target Start/End: Original strand, 13018078 - 13018208
Alignment:
127 aagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagtttctaat 222  Q
    ||||| |||||||||||||||| ||  ||||||||||| ||| ||| | |||||||| | | ||||||||   |||||||||| ||||| ||||| ||||    
13018078 aagtcttagctcaactggcaaagtgccgaaattgttagaccggatgccatgaccggggttcgaaccccggtacctccacttgtatgtgtcagtttataat 13018177  T
223 aactgttgtcatttcctctatctaacaaaaaa 254  Q
      || |||||||||| |||||||| |||||||    
13018178 ggct-ttgtcatttcgtctatctaccaaaaaa 13018208  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #38
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 127 - 254
Target Start/End: Complemental strand, 32880702 - 32880572
Alignment:
127 aagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccg---gctccacttgtgtgtgtaagtttctaat 222  Q
    |||||||| ||||||||||||||||  ||||||||||||||| ||| | |||| ||| | | |||||||    |||||||||||||||| ||||| ||||    
32880702 aagtcctaactcaactggcaaaatgccgaaattgttaggccggatgccatgactggggttcgaaccccgctacctccacttgtgtgtgtgagtttataat 32880603  T
223 aactgttgtcatttcctctatctaacaaaaaa 254  Q
      || |||||||| | |||||||| |||||||    
32880602 ggct-ttgtcattccgtctatctaccaaaaaa 32880572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #39
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 122 - 254
Target Start/End: Complemental strand, 270450 - 270316
Alignment:
122 tccacaagtcctagctcaactggc-aaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagtt 216  Q
    |||| ||||||||||||||||||| ||||||  ||||||||||||||| ||| | |||||||| | | ||||||||   |||||||||||||||  ||||    
270450 tccagaagtcctagctcaactggcaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtg--agtt 270353  T
217 tctaataactgttgtcatttcctctatctaacaaaaaa 254  Q
    | ||||  || ||| |||||| |||||||| |||||||    
270352 tataatggct-ttgccatttcgtctatctaccaaaaaa 270316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #40
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 121 - 165
Target Start/End: Original strand, 28381224 - 28381268
Alignment:
121 gtccacaagtcctagctcaactggcaaaatgttgaaattgttagg 165  Q
    ||||| ||||||||||||||||||| |||||| ||||||||||||    
28381224 gtccataagtcctagctcaactggctaaatgtcgaaattgttagg 28381268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #41
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 127 - 182
Target Start/End: Original strand, 32947624 - 32947680
Alignment:
127 aagtcctagctcaactggcaaaa-tgttgaaattgttaggccgaatgtcgtgaccgg 182  Q
    ||||||||||||||||| ||||| |||| |||||||||||||||| ||| |||||||    
32947624 aagtcctagctcaactgacaaaaatgttaaaattgttaggccgaacgtcttgaccgg 32947680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #42
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 127 - 167
Target Start/End: Original strand, 39467029 - 39467069
Alignment:
127 aagtcctagctcaactggcaaaatgttgaaattgttaggcc 167  Q
    ||||||||||||||||||||||||| | |||||||||||||    
39467029 aagtcctagctcaactggcaaaatggtaaaattgttaggcc 39467069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #43
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 122 - 161
Target Start/End: Complemental strand, 25083247 - 25083208
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgt 161  Q
    |||| ||||||||||||||||||||||||| |||||||||    
25083247 tccagaagtcctagctcaactggcaaaatgctgaaattgt 25083208  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #44
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 132 - 183
Target Start/End: Original strand, 27078559 - 27078609
Alignment:
132 ctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccggg 183  Q
    |||||||||||| |||||||| ||||||||||||||| ||||| ||||||||    
27078559 ctagctcaactg-caaaatgtcgaaattgttaggccggatgtcatgaccggg 27078609  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #45
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 122 - 168
Target Start/End: Original strand, 8214623 - 8214669
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccg 168  Q
    |||| |||||||||||||||||| ||||| | |||||||||||||||    
8214623 tccagaagtcctagctcaactggaaaaatatcgaaattgttaggccg 8214669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #46
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 122 - 254
Target Start/End: Complemental strand, 18089896 - 18089762
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagttt 217  Q
    |||| ||||| ||| ||||||| |||||||  ||||||||||||||| ||||| |||||||| | | ||||||||   |||||||||||| ||| |||||    
18089896 tccagaagtcttagttcaactgacaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccacttgtgt-tgtgagttt 18089798  T
218 ctaataactgttgtcatttcctctatctaacaaaaaa 254  Q
     ||||  || ||| |||||| |||||||| |||||||    
18089797 ataatggct-ttgccatttcgtctatctaccaaaaaa 18089762  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #47
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 196 - 254
Target Start/End: Complemental strand, 22561208 - 22561151
Alignment:
196 ctccacttgtgtgtgtaagtttctaataactgttgtcatttcctctatctaacaaaaaa 254  Q
    |||||||||||||||| ||||| |||||||| |||||||||  ||||||||| ||||||    
22561208 ctccacttgtgtgtgtgagtttataataact-ttgtcattttgtctatctaaaaaaaaa 22561151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #48
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 122 - 168
Target Start/End: Original strand, 30455204 - 30455250
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccg 168  Q
    |||| |||||||||||||||||  ||||||| |||||||||||||||    
30455204 tccagaagtcctagctcaactgataaaatgtcgaaattgttaggccg 30455250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #49
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 132 - 182
Target Start/End: Complemental strand, 33845722 - 33845672
Alignment:
132 ctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgg 182  Q
    ||||||||||||||||||||  ||||||||||| ||| ||||| |||||||    
33845722 ctagctcaactggcaaaatgccgaaattgttagaccggatgtcatgaccgg 33845672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #50
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 132 - 182
Target Start/End: Original strand, 33948256 - 33948306
Alignment:
132 ctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgg 182  Q
    ||||||||||||||||||||  ||||||||||| ||| ||||| |||||||    
33948256 ctagctcaactggcaaaatgccgaaattgttagaccggatgtcatgaccgg 33948306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #51
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 126 - 179
Target Start/End: Complemental strand, 1800733 - 1800680
Alignment:
126 caagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgac 179  Q
    ||||||||||||||||||  |||||||| |||||||||| ||| | ||||||||    
1800733 caagtcctagctcaactgataaaatgttaaaattgttagaccggacgtcgtgac 1800680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #52
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 122 - 183
Target Start/End: Original strand, 5322592 - 5322653
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccggg 183  Q
    |||| |||| |||||||||||| ||||||| |||||||||||||| | || || ||||||||    
5322592 tccagaagttctagctcaactgacaaaatgctgaaattgttaggctggatatcatgaccggg 5322653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #53
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 127 - 183
Target Start/End: Complemental strand, 7204632 - 7204575
Alignment:
127 aagtcctagctcaactggc-aaaatgttgaaattgttaggccgaatgtcgtgaccggg 183  Q
    ||||||||||||||||||| ||||||  |||||||||||||||||  || ||||||||    
7204632 aagtcctagctcaactggcaaaaatgccgaaattgttaggccgaacatcatgaccggg 7204575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #54
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 122 - 167
Target Start/End: Complemental strand, 15906295 - 15906250
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggcc 167  Q
    |||| |||||||||||||||| ||||||||  ||||||||||||||    
15906295 tccagaagtcctagctcaactagcaaaatgccgaaattgttaggcc 15906250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #55
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 127 - 222
Target Start/End: Original strand, 21522322 - 21522421
Alignment:
127 aagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagtttctaat 222  Q
    |||||||||||||| ||||||| ||  |||||||||||| || ||| | |||||||| | | ||||||||   |||||||||||||||| ||||| ||||    
21522322 aagtcctagctcaattggcaaagtgccgaaattgttaggtcggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 21522421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #56
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 127 - 168
Target Start/End: Complemental strand, 39522881 - 39522840
Alignment:
127 aagtcctagctcaactggcaaaatgttgaaattgttaggccg 168  Q
    |||||||| ||||||||||||||||  |||||||||||||||    
39522881 aagtcctaactcaactggcaaaatgcagaaattgttaggccg 39522840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #57
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 127 - 183
Target Start/End: Original strand, 15104049 - 15104105
Alignment:
127 aagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccggg 183  Q
    ||||||||||||||||| |||||||   |||||||||||||| ||||| ||| ||||    
15104049 aagtcctagctcaactgacaaaatgccaaaattgttaggccggatgtcatgatcggg 15104105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #58
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 130 - 166
Target Start/End: Complemental strand, 21897801 - 21897765
Alignment:
130 tcctagctcaactggcaaaatgttgaaattgttaggc 166  Q
    |||||||||||||| |||||||| |||||||||||||    
21897801 tcctagctcaactgacaaaatgtcgaaattgttaggc 21897765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #59
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 122 - 166
Target Start/End: Complemental strand, 35010717 - 35010673
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggc 166  Q
    |||| |||||||||||||||| ||||||||  |||||||||||||    
35010717 tccagaagtcctagctcaactagcaaaatgccgaaattgttaggc 35010673  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #60
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 125 - 165
Target Start/End: Complemental strand, 43500268 - 43500228
Alignment:
125 acaagtcctagctcaactggcaaaatgttgaaattgttagg 165  Q
    ||||||| |||||||||||| ||||||| ||||||||||||    
43500268 acaagtcttagctcaactggtaaaatgtcgaaattgttagg 43500228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 54; Significance: 5e-22; HSPs: 55)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 127 - 254
Target Start/End: Original strand, 17895639 - 17895769
Alignment:
127 aagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagtttctaat 222  Q
    ||||||||||||||||||||||||| |||||||||||||||| ||| | |||||||| | | ||||||||   |||||||||||||||| ||||| ||||    
17895639 aagtcctagctcaactggcaaaatgctgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 17895738  T
223 aactgttgtcatttcctctatctaacaaaaaa 254  Q
      || |||||||||| |||||||| |||||||    
17895739 ggct-ttgtcatttcgtctatctaccaaaaaa 17895769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 122 - 254
Target Start/End: Complemental strand, 2228208 - 2228073
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagttt 217  Q
    |||| ||||| |||||||||||||||||||| ||||||||||||||| ||||| |||||||| | | || |||||   |||||||||| ||||| |||||    
2228208 tccagaagtcgtagctcaactggcaaaatgtcgaaattgttaggccggatgtcatgaccggggttcgaatcccggtacctccacttgtatgtgtgagttt 2228109  T
218 ctaataactgttgtcatttcctctatctaacaaaaaa 254  Q
     |||| ||| |||||||||| |||||||| |||||||    
2228108 ataatgact-ttgtcatttcgtctatctaccaaaaaa 2228073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 122 - 265
Target Start/End: Complemental strand, 10061144 - 10060998
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagttt 217  Q
    ||||||||||||||||||||||||||||||  ||||||||||||||| ||| | |||||||| | | || |||||   |||||||||||||||| |||||    
10061144 tccacaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaatcccggtacctccacttgtgtgtgtgagttt 10061045  T
218 ctaataactgttgtcatttcctctatctaacaaaaaatataaaataaa 265  Q
     ||||  || ||| |||||| ||||||||  |||||| ||||||||||    
10061044 ataatggct-ttgccatttcgtctatctattaaaaaaaataaaataaa 10060998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 122 - 254
Target Start/End: Complemental strand, 35157212 - 35157077
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagttt 217  Q
    |||| |||||||||||||||||||||||||  ||||||||||||||| ||||| |||||||| | | ||||||||   |||||||| ||||||| |||||    
35157212 tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccacttatgtgtgtgagttt 35157113  T
218 ctaataactgttgtcatttcctctatctaacaaaaaa 254  Q
     ||||  || ||| |||||| |||||||| |||||||    
35157112 ataatggct-ttgccatttcgtctatctaccaaaaaa 35157077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 130 - 254
Target Start/End: Original strand, 44327648 - 44327775
Alignment:
130 tcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aacccc---ggctccacttgtgtgtgtaagtttctaataac 225  Q
    |||||||||||||||||||||||  |||||||||||||| ||||| ||||||| || | ||||||     |||||||||||||||| ||||| ||||| |    
44327648 tcctagctcaactggcaaaatgtcaaaattgttaggccggatgtcatgaccggaattcgaaccccaatacctccacttgtgtgtgtgagtttataatagc 44327747  T
226 tgttgtcatttcctctatctaacaaaaaa 254  Q
    | |||||||||| |||||||| |||||||    
44327748 t-ttgtcatttcgtctatctaccaaaaaa 44327775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 122 - 183
Target Start/End: Original strand, 9379991 - 9380052
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccggg 183  Q
    |||| |||||||||||||||||||||||||| ||||||||||||||| ||||| ||||||||    
9379991 tccagaagtcctagctcaactggcaaaatgtcgaaattgttaggccggatgtcatgaccggg 9380052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 122 - 261
Target Start/End: Complemental strand, 45041861 - 45041719
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagttt 217  Q
    |||| ||||| |||||||||||||||||||  |||||||||||| || ||| | |||||||| | | ||||||||   |||||||||||||||| |||||    
45041861 tccagaagtcttagctcaactggcaaaatgccgaaattgttaggtcggatgccttgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt 45041762  T
218 ctaataactgttgtcatttcctctatctaacaaaaaatataaaa 261  Q
     |||| ||| ||| |||||| |||||||| ||||||| ||||||    
45041761 ataatgact-ttgccatttcgtctatctaccaaaaaaaataaaa 45041719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 122 - 254
Target Start/End: Original strand, 1323683 - 1323818
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgacc-gggatacaaccccgg---ctccacttgtgtgtgtaagttt 217  Q
    |||| |||||||||||||||||||||||||  ||| ||||||||||| ||||| ||||| ||| |  ||||| ||   |||||||||||||||| |||||    
1323683 tccagaagtcctagctcaactggcaaaatgccgaatttgttaggccggatgtcatgaccagggttcgaacccaggtacctccacttgtgtgtgtgagttt 1323782  T
218 ctaataactgttgtcatttcctctatctaacaaaaaa 254  Q
     |||| ||| ||| |||||| |||||||| |||||||    
1323783 ataatgact-ttgccatttcgtctatctaccaaaaaa 1323818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 122 - 222
Target Start/End: Complemental strand, 1573969 - 1573865
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagttt 217  Q
    |||| |||||||||||||||||| ||||||  ||||||||||||||| ||| | |||||||| | | ||||||||   ||||||||||||||||||||||    
1573969 tccagaagtcctagctcaactggtaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtaagttt 1573870  T
218 ctaat 222  Q
     ||||    
1573869 ataat 1573865  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 122 - 254
Target Start/End: Complemental strand, 3497645 - 3497510
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagttt 217  Q
    |||| |||||||||||||||||||||||||  ||||||||||||||| ||| | |||||||| | | ||||| ||   |||||||||||||||| |||||    
3497645 tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagttt 3497546  T
218 ctaataactgttgtcatttcctctatctaacaaaaaa 254  Q
     ||||  || ||| |||||| |||||||| |||||||    
3497545 ataatggct-ttgccatttcgtctatctaccaaaaaa 3497510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 122 - 254
Target Start/End: Original strand, 4106554 - 4106689
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagttt 217  Q
    |||| |||||||||||||||||| ||||||  ||||||||||||||| ||| | |||||||| | | ||||||||   |||||||||||||||| |||||    
4106554 tccagaagtcctagctcaactggtaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt 4106653  T
218 ctaataactgttgtcatttcctctatctaacaaaaaa 254  Q
     ||||  || ||| |||||| |||||||| |||||||    
4106654 ataatggct-ttgccatttcatctatctaccaaaaaa 4106689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 122 - 254
Target Start/End: Original strand, 45236930 - 45237065
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccg---gctccacttgtgtgtgtaagttt 217  Q
    |||| |||||||||||||||||||||||||  ||||||||||||||| ||||| |||||||| | | |||||||    |||||||||||| ||| |||||    
45236930 tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccgatacctccacttgtgtatgtgagttt 45237029  T
218 ctaataactgttgtcatttcctctatctaacaaaaaa 254  Q
     ||||  || ||| |||||| |||||||| |||||||    
45237030 ataatggct-ttgccatttcgtctatctaccaaaaaa 45237065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 127 - 254
Target Start/End: Original strand, 21226070 - 21226200
Alignment:
127 aagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagtttctaat 222  Q
    |||||||| ||||||||||||||||  ||||||||||||||| ||| | |||||||| | | ||||||||   |||||||||||||||| ||||| ||||    
21226070 aagtcctatctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 21226169  T
223 aactgttgtcatttcctctatctaacaaaaaa 254  Q
      || ||| |||||| |||||||| |||||||    
21226170 gtct-ttgccatttcatctatctaccaaaaaa 21226200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 122 - 254
Target Start/End: Complemental strand, 31300125 - 31299988
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccact--tgtgtgtgtaagt 215  Q
    |||| ||||||||||| |||||||||||||  |||||||||| |||| ||||| |||||||| | | |||| |||   |||||||  ||||||||| |||    
31300125 tccagaagtcctagctaaactggcaaaatgccgaaattgttaagccggatgtcatgaccggggttcgaacctcggtacctccacttatgtgtgtgtgagt 31300026  T
216 ttctaataactgttgtcatttcctctatctaacaaaaaa 254  Q
    || |||||||| |||||||||| |||||||| |||||||    
31300025 ttataataact-ttgtcatttcgtctatctaccaaaaaa 31299988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 122 - 182
Target Start/End: Complemental strand, 2354925 - 2354865
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgg 182  Q
    |||| |||||||||||||||||||||||||  ||||||||||||||| ||||| |||||||    
2354925 tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccgg 2354865  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 133 - 254
Target Start/End: Original strand, 5508696 - 5508820
Alignment:
133 tagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagtttctaataactgt 228  Q
    |||||||||||||||||||  ||||||||||||||| ||| | |||||||| | | ||||||||   |||||||||||||||| ||||| ||||  || |    
5508696 tagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttgtaatggct-t 5508794  T
229 tgtcatttcctctatctaacaaaaaa 254  Q
    || |||||| |||||||| |||||||    
5508795 tgccatttcgtctatctaccaaaaaa 5508820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 122 - 223
Target Start/End: Original strand, 19306712 - 19306817
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagttt 217  Q
    |||| |||||||||||||||||||||||||  |||||| |||||||| ||| | |||||||| | | ||||||||   |||||||||||||||| |||||    
19306712 tccagaagtcctagctcaactggcaaaatgccgaaattattaggccggatgccatgaccggggttcgaaccccggttcctccacttgtgtgtgtgagttt 19306811  T
218 ctaata 223  Q
     |||||    
19306812 ataata 19306817  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 122 - 222
Target Start/End: Complemental strand, 3861464 - 3861360
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagttt 217  Q
    |||| ||||||||| | |||||||||||||| ||||||||||||||| ||||| ||| |||| | | ||||||||   |||||||||||||||| |||||    
3861464 tccagaagtcctagtttaactggcaaaatgtcgaaattgttaggccggatgtcatgatcggggttcgaaccccggtacctccacttgtgtgtgtgagttt 3861365  T
218 ctaat 222  Q
     ||||    
3861364 ataat 3861360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 127 - 211
Target Start/End: Complemental strand, 7312576 - 7312488
Alignment:
127 aagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgt 211  Q
    |||||||||||||||||||||||||   |||||||||||||| ||||| |||||||| | | ||||||||   ||||||||||||||||    
7312576 aagtcctagctcaactggcaaaatgccaaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgt 7312488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 122 - 168
Target Start/End: Original strand, 29151583 - 29151629
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccg 168  Q
    |||| ||||||||||||||||||||||||| ||||||||||||||||    
29151583 tccagaagtcctagctcaactggcaaaatgctgaaattgttaggccg 29151629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 122 - 254
Target Start/End: Original strand, 35849295 - 35849430
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagttt 217  Q
    |||| |||||||||||||||||||||| ||  ||||||||||||||| ||| | |||||||| | | ||||||||   ||| |||||||||||| |||||    
35849295 tccagaagtcctagctcaactggcaaagtgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctctacttgtgtgtgtgagttt 35849394  T
218 ctaataactgttgtcatttcctctatctaacaaaaaa 254  Q
     ||||  || ||| |||||| |||||||| |||||||    
35849395 ataatggct-ttgccatttcgtctatctaccaaaaaa 35849430  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 122 - 246
Target Start/End: Original strand, 40809045 - 40809172
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgacc-gggatacaaccccgg---ctccacttgtgtgtgtaagttt 217  Q
    |||| |||||||||||||||||||||||||  ||| ||||||||||| ||||| ||||| ||| |  ||||| ||   |||||||||||||||| |||||    
40809045 tccagaagtcctagctcaactggcaaaatgccgaatttgttaggccggatgtcatgaccagggttcgaaccctggtacctccacttgtgtgtgtgagttt 40809144  T
218 ctaataactgttgtcatttcctctatcta 246  Q
     |||| ||| ||| |||||| ||||||||    
40809145 ataatgact-ttgccatttcgtctatcta 40809172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 122 - 222
Target Start/End: Complemental strand, 47584799 - 47584695
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagttt 217  Q
    |||| |||||||||||||||||||||||||| || |||||||||||| ||| | |||||||| | | ||||||||   |||||||| ||||||| |||||    
47584799 tccagaagtcctagctcaactggcaaaatgtcgacattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttatgtgtgtgagttt 47584700  T
218 ctaat 222  Q
     ||||    
47584699 ataat 47584695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 122 - 254
Target Start/End: Original strand, 48612517 - 48612652
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagttt 217  Q
    |||| |||||||||||||||||||||||||  ||||||||||||||| ||| | |||||||| | | ||||||||   || ||||| ||||||| |||||    
48612517 tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttt 48612616  T
218 ctaataactgttgtcatttcctctatctaacaaaaaa 254  Q
     ||||  || ||| |||||| |||||||| |||||||    
48612617 ataatggct-ttgccatttcgtctatctaccaaaaaa 48612652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 122 - 174
Target Start/End: Complemental strand, 48729812 - 48729760
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtc 174  Q
    |||| |||||||||||||||||||||||||  ||||||||||||||| |||||    
48729812 tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtc 48729760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 122 - 181
Target Start/End: Complemental strand, 4887641 - 4887582
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccg 181  Q
    |||| |||||||||||||||||||||||||  ||||||||||||||| ||| | ||||||    
4887641 tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg 4887582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 122 - 165
Target Start/End: Complemental strand, 37117973 - 37117930
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttagg 165  Q
    |||| ||||||||||||||||| |||||||||||||||||||||    
37117973 tccagaagtcctagctcaactgacaaaatgttgaaattgttagg 37117930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 122 - 181
Target Start/End: Original strand, 47459416 - 47459475
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccg 181  Q
    |||| ||||| |||||||||||| ||||||| ||||||||||||||| ||||| ||||||    
47459416 tccaaaagtcatagctcaactggtaaaatgtcgaaattgttaggccggatgtcatgaccg 47459475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 122 - 222
Target Start/End: Complemental strand, 4069244 - 4069140
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagttt 217  Q
    |||| |||||||| |||||||||||||||   ||||||||||||||| ||| | |||||||| | | ||||||||   |||||||||||||||| |||||    
4069244 tccagaagtcctaactcaactggcaaaataccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt 4069145  T
218 ctaat 222  Q
     ||||    
4069144 ataat 4069140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #30
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 122 - 254
Target Start/End: Original strand, 18944924 - 18945059
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagttt 217  Q
    |||| ||||||||| |||||||||||||||  ||||||||||||||| || || |||||||| | | ||||| ||   |||||||| ||||||| |||||    
18944924 tccagaagtcctagttcaactggcaaaatgccgaaattgttaggccggatatcatgaccggggttcgaaccctggtacctccacttatgtgtgtgagttt 18945023  T
218 ctaataactgttgtcatttcctctatctaacaaaaaa 254  Q
     ||||  || ||| |||||| |||||||| |||||||    
18945024 ataatggct-ttgccatttcatctatctaccaaaaaa 18945059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #31
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 122 - 168
Target Start/End: Complemental strand, 27396442 - 27396396
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccg 168  Q
    |||| |||||||||||||||||||||||||  |||||||||||||||    
27396442 tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccg 27396396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #32
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 122 - 254
Target Start/End: Original strand, 31717297 - 31717432
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagttt 217  Q
    |||| |||||||||||||||||| ||||||  ||||||||||||||| ||| | |||||||| | | ||| ||||   |||||||| ||||||| |||||    
31717297 tccagaagtcctagctcaactggtaaaatgccgaaattgttaggccggatgccatgaccggggttcgaactccggtacctccacttatgtgtgtgagttt 31717396  T
218 ctaataactgttgtcatttcctctatctaacaaaaaa 254  Q
     ||||  || ||| |||||| |||||||| |||||||    
31717397 ataatggct-ttgccatttcgtctatctaccaaaaaa 31717432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #33
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 127 - 181
Target Start/End: Original strand, 38261006 - 38261060
Alignment:
127 aagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccg 181  Q
    ||||||||||||||||| |||||||| ||||||||||||||| ||| | ||||||    
38261006 aagtcctagctcaactgacaaaatgtcgaaattgttaggccggatgccatgaccg 38261060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #34
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 122 - 254
Target Start/End: Original strand, 43723312 - 43723447
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagttt 217  Q
    ||||||||||||||||| ||||||||||||   ||||||||| |||| ||||| |||  ||| | | ||||||||   |||||||||||||||| |||||    
43723312 tccacaagtcctagctcgactggcaaaatgccaaaattgttaagccggatgtcatgattggggttcgaaccccggttcctccacttgtgtgtgtgagttt 43723411  T
218 ctaataactgttgtcatttcctctatctaacaaaaaa 254  Q
     ||||  || ||| |||||| |||||||| |||||||    
43723412 ataatggct-ttgccatttcgtctatctaccaaaaaa 43723447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #35
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 127 - 254
Target Start/End: Complemental strand, 4674432 - 4674302
Alignment:
127 aagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagtttctaat 222  Q
    |||||||||||||||||||||||||  |||||||||| | |  || || |||||||| | | ||||||||   |||||||||||||||| ||||| ||||    
4674432 aagtcctagctcaactggcaaaatgccgaaattgttaagtcagatatcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 4674333  T
223 aactgttgtcatttcctctatctaacaaaaaa 254  Q
      || ||| |||||| |||||||| |||||||    
4674332 ggct-ttgccatttcgtctatctaccaaaaaa 4674302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #36
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 122 - 183
Target Start/End: Original strand, 6596542 - 6596603
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccggg 183  Q
    |||| |||||||||||||||||||||||||   |||||||||||||| ||| | ||||||||    
6596542 tccagaagtcctagctcaactggcaaaatgccaaaattgttaggccggatgccatgaccggg 6596603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #37
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 131 - 254
Target Start/End: Original strand, 16816700 - 16816826
Alignment:
131 cctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagtttctaataact 226  Q
    ||||| |||||||||||||||  ||||||||||||||| ||| | |||||||| | | |||| |||   |||||||||||||||| ||||| ||||  ||    
16816700 cctagttcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccgcggtacctccacttgtgtgtgtgagtttataatggct 16816799  T
227 gttgtcatttcctctatctaacaaaaaa 254  Q
     ||| |||||| |||||||| |||||||    
16816800 -ttgccatttcgtctatctaccaaaaaa 16816826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #38
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 127 - 168
Target Start/End: Original strand, 33512802 - 33512843
Alignment:
127 aagtcctagctcaactggcaaaatgttgaaattgttaggccg 168  Q
    |||||||||||||||||||||||||  |||||||||||||||    
33512802 aagtcctagctcaactggcaaaatgccgaaattgttaggccg 33512843  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #39
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 127 - 254
Target Start/End: Original strand, 10166875 - 10167004
Alignment:
127 aagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatacaaccccgg---ctccacttgtgtgtgtaagtttctaata 223  Q
    |||||||||||||||||  ||||||  ||||||||||||||| ||| | |||||||| |  ||| | ||   |||||||||||| ||| ||||| ||||     
10166875 aagtcctagctcaactgataaaatgccgaaattgttaggccggatgccatgaccgggttcgaactctggtacctccacttgtgtatgtgagtttataatg 10166974  T
224 actgttgtcatttcctctatctaacaaaaaa 254  Q
     || |||||||||| |||||||| |||||||    
10166975 gct-ttgtcatttcgtctatctatcaaaaaa 10167004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #40
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 122 - 181
Target Start/End: Original strand, 33228699 - 33228759
Alignment:
122 tccacaagtcctagctcaactggc-aaaatgttgaaattgttaggccgaatgtcgtgaccg 181  Q
    |||| ||||||||||||||||||| ||||||| ||||||||||||||| ||| | ||||||    
33228699 tccagaagtcctagctcaactggcaaaaatgtcgaaattgttaggccggatgccatgaccg 33228759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #41
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 127 - 179
Target Start/End: Complemental strand, 37410825 - 37410773
Alignment:
127 aagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgac 179  Q
    ||||| |||||||||||||||||||  ||||||||||||||| ||||| ||||    
37410825 aagtcttagctcaactggcaaaatgccgaaattgttaggccggatgtcatgac 37410773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #42
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 127 - 254
Target Start/End: Complemental strand, 40656233 - 40656101
Alignment:
127 aagtcctagctcaactggc--aaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagtttcta 220  Q
    |||||||||||||||||||  ||||||  || |||||||||||| ||| | |||||||| | | ||||||||   |||||||||||||||| ||||| ||    
40656233 aagtcctagctcaactggcaaaaaatgccgatattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttata 40656134  T
221 ataactgttgtcatttcctctatctaacaaaaaa 254  Q
    ||  || ||| |||||| ||||||||| ||||||    
40656133 atggct-ttgccatttcgtctatctaaaaaaaaa 40656101  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #43
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 125 - 222
Target Start/End: Complemental strand, 43133229 - 43133127
Alignment:
125 acaagtcctagctcaactggcaaaa-tgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagtttct 219  Q
    |||||||||||||||| |||||||| |   ||||||||||||| ||||||| |||||||| | | ||||||||   |||||||||||||||| ||||| |    
43133229 acaagtcctagctcaaatggcaaaaataccgaaattgttaggctgaatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttat 43133130  T
220 aat 222  Q
    |||    
43133129 aat 43133127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #44
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 127 - 174
Target Start/End: Complemental strand, 3043939 - 3043892
Alignment:
127 aagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtc 174  Q
    |||||||||||||| ||  ||||||||||||||||||||||| |||||    
3043939 aagtcctagctcaattgataaaatgttgaaattgttaggccggatgtc 3043892  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #45
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 121 - 246
Target Start/End: Complemental strand, 27339857 - 27339729
Alignment:
121 gtccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccg-ggatacaaccccgg---ctccacttgtgtgtgtaagtt 216  Q
    |||||||||||||||||||| || |||||| || |||||||||| ||| ||||  ||||||  | |  |||| |||   |||||||||||||||| ||||    
27339857 gtccacaagtcctagctcaagtgacaaaatattaaaattgttagaccggatgttatgaccgtagttcaaacctcggtatctccacttgtgtgtgtgagtt 27339758  T
217 tctaataactgttgtcatttcctctatcta 246  Q
    | |||| ||| |||||||||| ||||||||    
27339757 tataatgact-ttgtcatttcgtctatcta 27339729  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #46
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 130 - 168
Target Start/End: Complemental strand, 10704011 - 10703973
Alignment:
130 tcctagctcaactggcaaaatgttgaaattgttaggccg 168  Q
    ||||||||||||||||||||||  |||||||||||||||    
10704011 tcctagctcaactggcaaaatgccgaaattgttaggccg 10703973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #47
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 125 - 183
Target Start/End: Complemental strand, 26336504 - 26336446
Alignment:
125 acaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccggg 183  Q
    |||||| ||||||||||||| |||||| ||||||||||| || | ||||| ||||||||    
26336504 acaagttctagctcaactggtaaaatggtgaaattgttaagctggatgtcatgaccggg 26336446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #48
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 127 - 165
Target Start/End: Original strand, 37919974 - 37920012
Alignment:
127 aagtcctagctcaactggcaaaatgttgaaattgttagg 165  Q
    |||||||||||||||||||||||| | ||||||||||||    
37919974 aagtcctagctcaactggcaaaatatcgaaattgttagg 37920012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #49
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 122 - 168
Target Start/End: Complemental strand, 42557630 - 42557584
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccg 168  Q
    |||| |||||||||||||| ||||||||||  |||||||||||||||    
42557630 tccataagtcctagctcaattggcaaaatgccgaaattgttaggccg 42557584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #50
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 127 - 222
Target Start/End: Original strand, 19258429 - 19258528
Alignment:
127 aagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagtttctaat 222  Q
    ||||||| |||||||| | ||||||  ||||||||||||||| ||| | |||||||| | | ||||||||   |||||||||||||||| ||||| ||||    
19258429 aagtcctggctcaactagaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 19258528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #51
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 122 - 183
Target Start/End: Complemental strand, 32251463 - 32251402
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccggg 183  Q
    |||| ||||||||| |||||||||||||||  |||||||||| | || ||||| ||||||||    
32251463 tccagaagtcctagttcaactggcaaaatgccgaaattgttaagtcggatgtcatgaccggg 32251402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #52
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 122 - 183
Target Start/End: Original strand, 41780263 - 41780324
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccggg 183  Q
    |||| |||||||| ||||||| ||||||||| ||||||||||||  | ||||| ||||||||    
41780263 tccagaagtcctaactcaactagcaaaatgtcgaaattgttaggttggatgtcatgaccggg 41780324  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #53
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 121 - 165
Target Start/End: Complemental strand, 5841608 - 5841564
Alignment:
121 gtccacaagtcctagctcaactggcaaaatgttgaaattgttagg 165  Q
    |||||||||||||||||||| ||| ||||| | ||||||||||||    
5841608 gtccacaagtcctagctcaattggtaaaatatcgaaattgttagg 5841564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #54
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 127 - 163
Target Start/End: Complemental strand, 36280048 - 36280012
Alignment:
127 aagtcctagctcaactggcaaaatgttgaaattgtta 163  Q
    |||||||||||||||||||||||||  ||||||||||    
36280048 aagtcctagctcaactggcaaaatgccgaaattgtta 36280012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #55
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 122 - 174
Target Start/End: Complemental strand, 38930406 - 38930354
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtc 174  Q
    |||| |||||||||||||| ||||||| |||  |||||||||||| |||||||    
38930406 tccagaagtcctagctcaattggcaaagtgtcaaaattgttaggctgaatgtc 38930354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 54; Significance: 5e-22; HSPs: 69)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 127 - 254
Target Start/End: Complemental strand, 47462159 - 47462029
Alignment:
127 aagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagtttctaat 222  Q
    |||||||||||||||||||||||||  ||||||||||||||| ||| | |||||||| | | ||||||||   |||||||||||||||| ||||| ||||    
47462159 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 47462060  T
223 aactgttgtcatttcctctatctaacaaaaaa 254  Q
     ||| |||||||||| |||||||| |||||||    
47462059 gact-ttgtcatttcgtctatctaccaaaaaa 47462029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 122 - 267
Target Start/End: Complemental strand, 46488245 - 46488097
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagttt 217  Q
    |||| |||||||||||||||||||||||||  ||||||||||||||| ||||| |||||||| | | ||||||||   |||||||||||||||| |||||    
46488245 tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcaaaccccggtacctccacttgtgtgtgtgagttt 46488146  T
218 ctaataactgttgtcatttcctctatctaacaaaaaatataaaataaaca 267  Q
     ||||  || ||| |||||| |||||||| ||||||| | |||| |||||    
46488145 ataatggct-ttgccatttcgtctatctaccaaaaaaaaaaaaaaaaaca 46488097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 122 - 261
Target Start/End: Complemental strand, 5397068 - 5396926
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagttt 217  Q
    |||| |||||||||||||||||||||||||  ||||||||||||||| ||||| |||||||| | | ||||||||   |||||||||||||||| |||||    
5397068 tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt 5396969  T
218 ctaataactgttgtcatttcctctatctaacaaaaaatataaaa 261  Q
     ||||  || ||| |||||| | |||||| ||||||| ||||||    
5396968 ataatggct-ttgccatttcgtgtatctaccaaaaaaaataaaa 5396926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 122 - 254
Target Start/End: Original strand, 9569475 - 9569610
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagttt 217  Q
    |||| |||||||||||||||||||||||||  ||||||||||||||| ||||| |||||||| | | ||||| ||   |||||||||||||||| |||||    
9569475 tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagttt 9569574  T
218 ctaataactgttgtcatttcctctatctaacaaaaaa 254  Q
     ||||  || ||| |||||| |||||||| |||||||    
9569575 ataatggct-ttgccatttcgtctatctatcaaaaaa 9569610  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 122 - 254
Target Start/End: Original strand, 29894410 - 29894545
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagttt 217  Q
    |||| |||||||||||||||||||||||||| |||||| ||||| || ||||| |||||||| | | ||||| ||   |||||||||||||||| |||||    
29894410 tccagaagtcctagctcaactggcaaaatgtcgaaattattaggtcggatgtcatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagttt 29894509  T
218 ctaataactgttgtcatttcctctatctaacaaaaaa 254  Q
     ||||| || ||| |||||| |||||||| |||||||    
29894510 ataatagct-ttgccatttcgtctatctaccaaaaaa 29894545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 122 - 254
Target Start/End: Original strand, 31375113 - 31375248
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagttt 217  Q
    |||| |||||||| |||||||| |||||||| |||||| |||||||  ||| | |||||||| | | ||||||||   ||||||||||||||||||||||    
31375113 tccagaagtcctaactcaactgccaaaatgtcgaaattattaggccagatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtaagttt 31375212  T
218 ctaataactgttgtcatttcctctatctaacaaaaaa 254  Q
     |||| ||| |||||||||| ||||||||| ||||||    
31375213 ataatgact-ttgtcatttcgtctatctaaaaaaaaa 31375248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 127 - 254
Target Start/End: Original strand, 18813375 - 18813505
Alignment:
127 aagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagtttctaat 222  Q
    |||||||| ||||||||||||||||  ||||||||||||||| ||||| |||||||| | | ||||||||   |||||||||||||||| ||||| ||||    
18813375 aagtcctaactcaactggcaaaatgccgaaattgttaggccggatgtcatgaccgggcttcgaaccccggtacctccacttgtgtgtgtgagtttataat 18813474  T
223 aactgttgtcatttcctctatctaacaaaaaa 254  Q
      || ||| |||||| |||||||| |||||||    
18813475 ggct-ttgccatttcgtctatctaccaaaaaa 18813505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 122 - 217
Target Start/End: Complemental strand, 42154266 - 42154167
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagttt 217  Q
    |||| |||||||||||||||||||||||||  ||||||||||||||| ||||| |||||||| | | ||||||||   |||||||||||||||| |||||    
42154266 tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt 42154167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 122 - 182
Target Start/End: Complemental strand, 53398416 - 53398356
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgg 182  Q
    |||||||||  |||||||||||||||||||||||||||||||||| ||||||| |||||||    
53398416 tccacaagttttagctcaactggcaaaatgttgaaattgttaggctgaatgtcatgaccgg 53398356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 122 - 254
Target Start/End: Original strand, 7512767 - 7512902
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagttt 217  Q
    |||| |||||||||||||||||||||||||   |||||||||||||| ||| | |||||||| | | ||||||||   |||||||||||||||| |||||    
7512767 tccagaagtcctagctcaactggcaaaatgccaaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt 7512866  T
218 ctaataactgttgtcatttcctctatctaacaaaaaa 254  Q
     ||||  || ||| |||||| |||||||| |||||||    
7512867 ataatggct-ttgccatttcgtctatctaccaaaaaa 7512902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 122 - 222
Target Start/End: Original strand, 13389020 - 13389124
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagttt 217  Q
    |||| ||||||||||||||||||||||||| ||||||||||||| || ||||| |||||||| | | ||||||||   |||||||| ||||||| |||||    
13389020 tccagaagtcctagctcaactggcaaaatgctgaaattgttaggtcggatgtcatgaccggggttcgaaccccggtacctccacttatgtgtgtgagttt 13389119  T
218 ctaat 222  Q
     ||||    
13389120 ataat 13389124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 122 - 254
Target Start/End: Original strand, 24550813 - 24550948
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagttt 217  Q
    |||| ||||| |||||||||||||||||||  ||||||||||||||| ||||| ||| |||| | | ||||||||   |||||||||||||||| |||||    
24550813 tccagaagtcttagctcaactggcaaaatgccgaaattgttaggccggatgtcatgatcggggttcgaaccccggtacctccacttgtgtgtgtgagttt 24550912  T
218 ctaataactgttgtcatttcctctatctaacaaaaaa 254  Q
     ||||  || ||| |||||| |||||||||| |||||    
24550913 ataatggct-ttgccatttcgtctatctaaccaaaaa 24550948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 122 - 222
Target Start/End: Original strand, 24712088 - 24712192
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagttt 217  Q
    |||| |||||||||||||||||||||||||  |||||||||||| || ||||| |||||||| | | ||||||||   |||||||||||||||| |||||    
24712088 tccagaagtcctagctcaactggcaaaatgccgaaattgttaggtcggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt 24712187  T
218 ctaat 222  Q
     ||||    
24712188 ataat 24712192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 122 - 254
Target Start/End: Complemental strand, 30044712 - 30044577
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagttt 217  Q
    |||| |||||||||||||||||||||||||  ||||||||||||||| ||| | ||| |||| | | ||||||||   |||||||||||||||| |||||    
30044712 tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgatcggggttcgaaccccggtacctccacttgtgtgtgtgagttt 30044613  T
218 ctaataactgttgtcatttcctctatctaacaaaaaa 254  Q
     ||||  || ||| |||||| |||||||| |||||||    
30044612 ataatggct-ttgccatttcgtctatctaccaaaaaa 30044577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 130 - 254
Target Start/End: Complemental strand, 39284694 - 39284568
Alignment:
130 tcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagtttctaataac 225  Q
    ||||||||||||||||||| ||  ||||||||||||||| ||||| |||||||| | | ||||||||   |||||||||||||||| ||||| |||| |     
39284694 tcctagctcaactggcaaa-tgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat-ag 39284597  T
226 tgttgtcatttcctctatctaacaaaaaa 254  Q
    | |||||||||| |||||||| |||||||    
39284596 ttttgtcatttcgtctatctaccaaaaaa 39284568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 122 - 254
Target Start/End: Complemental strand, 49882837 - 49882702
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccg-ggatacaaccccgg---ctccacttgtgtgtgtaagttt 217  Q
    |||| |||||||||||||||||||||||||  ||||||||||||||| ||| | |||||| || |  ||||||||   |||||||||||||||| |||||    
49882837 tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgaggttcgaaccccggtacctccacttgtgtgtgtgagttt 49882738  T
218 ctaataactgttgtcatttcctctatctaacaaaaaa 254  Q
     ||||  || ||| |||||| |||||||| |||||||    
49882737 ataatggct-ttgccatttcgtctatctaccaaaaaa 49882702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 122 - 183
Target Start/End: Original strand, 1982561 - 1982622
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccggg 183  Q
    |||| |||||||||||||||||||||||||  ||||||||||||||| ||||| ||||||||    
1982561 tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccgtatgtcatgaccggg 1982622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 122 - 217
Target Start/End: Complemental strand, 3848946 - 3848847
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagttt 217  Q
    |||| |||||||||||||||||||||||||  ||||||| ||||||| ||| | |||||||| | | ||||||||   ||||||||||||||||||||||    
3848946 tccagaagtcctagctcaactggcaaaatgccgaaattgctaggccggatgccatgaccggggttcgaaccccggtgcctccacttgtgtgtgtaagttt 3848847  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 127 - 254
Target Start/End: Original strand, 24407502 - 24407632
Alignment:
127 aagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagtttctaat 222  Q
    |||||||||||||||||||||||||| |||||||||||| || ||| | |||||||||| | ||||||||   || ||||||||||||| | ||| ||||    
24407502 aagtcctagctcaactggcaaaatgtcgaaattgttaggtcggatgccatgaccgggattcgaaccccggtaccttcacttgtgtgtgtgaatttataat 24407601  T
223 aactgttgtcatttcctctatctaacaaaaaa 254  Q
      ||  ||||||||| |||||||| |||||||    
24407602 ggct-ctgtcatttcgtctatctaccaaaaaa 24407632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 127 - 254
Target Start/End: Original strand, 28033197 - 28033327
Alignment:
127 aagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagtttctaat 222  Q
    |||||||||||||||||| ||||||  ||||||||||||||| ||| | |||||||| | | |||||| |   |||||||||||||||| ||||| ||||    
28033197 aagtcctagctcaactggtaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccagtatctccacttgtgtgtgtgagtttataat 28033296  T
223 aactgttgtcatttcctctatctaacaaaaaa 254  Q
     ||| ||| |||||| |||||||| |||||||    
28033297 gact-ttgccatttcgtctatctaccaaaaaa 28033327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 127 - 262
Target Start/End: Original strand, 37050706 - 37050844
Alignment:
127 aagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccg---gctccacttgtgtgtgtaagtttctaat 222  Q
    ||||| |||||||||||||||||||  ||||||||||||||| ||| | |||||||| | | |||||||   ||||||||| ||||||| ||||| ||||    
37050706 aagtcttagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccgatagctccacttatgtgtgtgagtttataat 37050805  T
223 aactgttgtcatttcctctatctaacaaaaaatataaaat 262  Q
      || ||| |||||| |||||||| ||||||| |||||||    
37050806 ggct-ttgccatttcgtctatctaccaaaaaaaataaaat 37050844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 127 - 222
Target Start/End: Original strand, 37166143 - 37166242
Alignment:
127 aagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagtttctaat 222  Q
    |||||||||||||||||||||||||  ||||||||||||||| ||||| ||| |||| | | ||||||||   |||||||||||||||| ||||| ||||    
37166143 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgatcggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 37166242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 122 - 254
Target Start/End: Original strand, 6487849 - 6487981
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagttt 217  Q
    |||| |||||||||||||||   |||||||  ||||||||||||||| |||||||||||||| | | ||||||||   |||||||||||||||| |||||    
6487849 tccagaagtcctagctcaac---caaaatgccgaaattgttaggccggatgtcgtgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt 6487945  T
218 ctaataactgttgtcatttcctctatctaacaaaaaa 254  Q
     ||||  || ||| |||||| |||||||| |||||||    
6487946 ataatggct-ttgccatttcgtctatctaccaaaaaa 6487981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 122 - 254
Target Start/End: Complemental strand, 9064917 - 9064781
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg----ctccacttgtgtgtgtaagtt 216  Q
    ||||||||||||||||||||| | |||||| ||||||||||||| |||||| | | | |||| | | ||||||||    |||||||||||||||| ||||    
9064917 tccacaagtcctagctcaactagtaaaatgctgaaattgttaggtcgaatgccataatcggggttcgaaccccggtaccctccacttgtgtgtgtgagtt 9064818  T
217 tctaataactgttgtcatttcctctatctaacaaaaaa 254  Q
    | |||| ||| |||||||||  |||||||| |||||||    
9064817 tataatgact-ttgtcattttgtctatctaccaaaaaa 9064781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 132 - 222
Target Start/End: Original strand, 34684212 - 34684306
Alignment:
132 ctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagtttctaat 222  Q
    ||||||||||||||||||||  ||||||||||||||| ||||| |||||||| | | ||||||||   |||||||||||||||| ||||| ||||    
34684212 ctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 34684306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 122 - 254
Target Start/End: Original strand, 12821165 - 12821298
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagttt 217  Q
    |||| |||||||||||||||||||||||||  ||||||||||||||| ||| | |||||||| | | ||||||||   |||||||||||||||  |||||    
12821165 tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtg--agttt 12821262  T
218 ctaataactgttgtcatttcctctatctaacaaaaaa 254  Q
     ||||  || ||| |||||| |||||||| |||||||    
12821263 ataatggct-ttgccatttcgtctatctaccaaaaaa 12821298  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 122 - 254
Target Start/End: Original strand, 29428055 - 29428190
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagttt 217  Q
    |||| ||||||||||||||||||||||||   ||||||||||||||| ||||| ||| |||| | | ||||||||   ||||||||||||| || |||||    
29428055 tccagaagtcctagctcaactggcaaaataccgaaattgttaggccggatgtcatgatcggggttcgaaccccggtacctccacttgtgtgagtgagttt 29428154  T
218 ctaataactgttgtcatttcctctatctaacaaaaaa 254  Q
     ||||  || ||| |||||| |||||||| |||||||    
29428155 ataatggct-ttgccatttcgtctatctaccaaaaaa 29428190  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 122 - 254
Target Start/End: Complemental strand, 31263629 - 31263494
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagttt 217  Q
    |||| |||||||||||||||||||||||||| |||||| |||| ||| ||| | |||||||| | | ||||||||   |||||||| ||||||| |||||    
31263629 tccagaagtcctagctcaactggcaaaatgtcgaaattattagaccggatgccatgaccggggttcgaaccccggtacctccacttatgtgtgtgagttt 31263530  T
218 ctaataactgttgtcatttcctctatctaacaaaaaa 254  Q
     ||||  || ||| |||||| |||||||| |||||||    
31263529 ataatggct-ttgccatttcgtctatctaccaaaaaa 31263494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 127 - 211
Target Start/End: Original strand, 35828279 - 35828367
Alignment:
127 aagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgt 211  Q
    |||||||||||||||||||||||||  ||||||||||||||| ||| | |||||||| | | ||||||||   ||||||||||||||||    
35828279 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgt 35828367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 122 - 222
Target Start/End: Complemental strand, 50779919 - 50779815
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagttt 217  Q
    |||| ||||| ||| |||||||||||||||  ||||||||||||||| ||| | |||||||||| | ||||||||   |||||||||||||||| |||||    
50779919 tccagaagtcttagttcaactggcaaaatgccgaaattgttaggccggatgccatgaccgggattcgaaccccggttcctccacttgtgtgtgtgagttt 50779820  T
218 ctaat 222  Q
     ||||    
50779819 ataat 50779815  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 127 - 254
Target Start/End: Original strand, 18371351 - 18371481
Alignment:
127 aagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgac-cgggatacaaccccgg---ctccacttgtgtgtgtaagtttctaat 222  Q
    |||| ||||||||||||||||||||  |||||||||||||||||| || ||||  ||| |  ||||||||   |||||||| ||||||| ||||| ||||    
18371351 aagttctagctcaactggcaaaatgccgaaattgttaggccgaatatcatgactggggtttgaaccccggtacctccacttatgtgtgtgagtttataat 18371450  T
223 aactgttgtcatttcctctatctaacaaaaaa 254  Q
      || |||||||||| |||||||| |||||||    
18371451 ggct-ttgtcatttcgtctatctatcaaaaaa 18371481  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #32
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 122 - 253
Target Start/End: Complemental strand, 28010179 - 28010045
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagttt 217  Q
    |||| |||||||||||||||||||||||||   |||||||||||| | || || |||||||| | | ||||||||   |||||||||||||||| |||||    
28010179 tccagaagtcctagctcaactggcaaaatgccaaaattgttaggcaggatatcatgaccggggttcgaaccccggtaactccacttgtgtgtgtgagttt 28010080  T
218 ctaataactgttgtcatttcctctatctaacaaaaa 253  Q
     ||||  || ||| |||||| |||||||| ||||||    
28010079 ataatggct-ttgccatttcatctatctaccaaaaa 28010045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #33
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 127 - 183
Target Start/End: Complemental strand, 1033572 - 1033516
Alignment:
127 aagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccggg 183  Q
    |||||||||||||||||||||||||  ||||||||||||||| ||| | ||||||||    
1033572 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg 1033516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #34
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 122 - 182
Target Start/End: Complemental strand, 23974770 - 23974710
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgg 182  Q
    |||| |||||||||||||||||||||||||  ||||||||||||||| || || |||||||    
23974770 tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatatcatgaccgg 23974710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #35
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 133 - 254
Target Start/End: Complemental strand, 1053000 - 1052876
Alignment:
133 tagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagtttctaataactgt 228  Q
    ||||||||||| |||||||| ||||||||||||||| ||||| |||||||| | | ||||| ||   |||||||||| ||||| ||||| ||||  || |    
1053000 tagctcaactgacaaaatgtcgaaattgttaggccggatgtcatgaccggggttcgaaccctggtacctccacttgtatgtgtgagtttataatggct-t 1052902  T
229 tgtcatttcctctatctaacaaaaaa 254  Q
    | ||||||| |||||||| |||||||    
1052901 tatcatttcatctatctaccaaaaaa 1052876  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #36
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 122 - 254
Target Start/End: Original strand, 13632089 - 13632225
Alignment:
122 tccacaagtcctagctcaactggc-aaaatgttgaaattgttaggccgaatgtcgtgaccg-ggatacaaccccgg---ctccacttgtgtgtgtaagtt 216  Q
    |||| ||||||||||||||||||| ||||||| ||||||||||||||| ||| | |||||| || |  |||||| |   |||||||||||||||| ||||    
13632089 tccagaagtcctagctcaactggcaaaaatgtcgaaattgttaggccggatgccatgaccgaggttcgaaccccagtacctccacttgtgtgtgtgagtt 13632188  T
217 tctaataactgttgtcatttcctctatctaacaaaaaa 254  Q
    | ||||  || ||| |||||| |||||||| |||||||    
13632189 tataatggct-ttgccatttcgtctatctatcaaaaaa 13632225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #37
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 122 - 168
Target Start/End: Complemental strand, 35273435 - 35273388
Alignment:
122 tccacaagtcctagctcaactggc-aaaatgttgaaattgttaggccg 168  Q
    |||||||||||||||||||||||| ||||||| |||||||||||||||    
35273435 tccacaagtcctagctcaactggcaaaaatgtcgaaattgttaggccg 35273388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #38
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 130 - 254
Target Start/End: Complemental strand, 579362 - 579235
Alignment:
130 tcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagtttctaataac 225  Q
    ||||||||||||||  ||||||| ||||||||||||||| ||||| ||| |||| | | ||||||||   |||||||| ||||||| ||||| ||||  |    
579362 tcctagctcaactgataaaatgtcgaaattgttaggccggatgtcatgatcggggttcgaaccccggtacctccacttatgtgtgtgagtttataatggc 579263  T
226 tgttgtcatttcctctatctaacaaaaaa 254  Q
    | ||| |||||| ||||||||| ||||||    
579262 t-ttgccatttcgtctatctaaaaaaaaa 579235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #39
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 196 - 262
Target Start/End: Complemental strand, 3802981 - 3802915
Alignment:
196 ctccacttgtgtgtgtaagtttctaataactgttgtcatttcctctatctaacaaaaaatataaaat 262  Q
    |||||||||||||||| ||||| |||| ||| ||| |||||| |||||||| ||||||| |||||||    
3802981 ctccacttgtgtgtgtgagtttataatgacttttgccatttcgtctatctaccaaaaaaaataaaat 3802915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #40
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 122 - 254
Target Start/End: Original strand, 14285095 - 14285230
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgg-gatacaaccccgg---ctccacttgtgtgtgtaagttt 217  Q
    |||| ||||||||||||||||| |||||||   |||||||||||||| ||| | ||||||| | |  ||||||||   |||||||||||||||| |||||    
14285095 tccagaagtcctagctcaactgacaaaatgccaaaattgttaggccggatgccatgaccggcgttcgaaccccggtacctccacttgtgtgtgtgagttt 14285194  T
218 ctaataactgttgtcatttcctctatctaacaaaaaa 254  Q
     ||||  || ||| |||||| |||||||| |||||||    
14285195 ataatggct-ttgccatttcatctatctaccaaaaaa 14285230  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #41
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 121 - 179
Target Start/End: Complemental strand, 17815271 - 17815213
Alignment:
121 gtccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgac 179  Q
    ||||||||||||||| |||||||||||||||  |||||||||||| |||| ||| ||||    
17815271 gtccacaagtcctagttcaactggcaaaatgccgaaattgttaggtcgaacgtcatgac 17815213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #42
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 122 - 254
Target Start/End: Original strand, 28983732 - 28983867
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagttt 217  Q
    |||| |||| ||||||||||||||||||||| || ||||||||| || ||| | |||||||| | | ||| ||||   |||||||| ||||||| |||||    
28983732 tccagaagttctagctcaactggcaaaatgtcgacattgttaggtcggatgccatgaccggggttcgaactccggtacctccacttatgtgtgtgagttt 28983831  T
218 ctaataactgttgtcatttcctctatctaacaaaaaa 254  Q
     |||| ||| |||||||||  |||||||| |||||||    
28983832 ataatgact-ttgtcattttgtctatctaccaaaaaa 28983867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #43
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 122 - 222
Target Start/End: Complemental strand, 31436046 - 31435942
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagttt 217  Q
    |||||||||||||| |||||||| ||||||  ||||||||||||||| ||||| |||  ||| | | ||||||||   |||||||||||||||| |||||    
31436046 tccacaagtcctagttcaactggtaaaatgccgaaattgttaggccggatgtcatgattggggttcgaaccccggtacctccacttgtgtgtgtgagttt 31435947  T
218 ctaat 222  Q
     ||||    
31435946 ataat 31435942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #44
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 122 - 168
Target Start/End: Original strand, 42856563 - 42856609
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccg 168  Q
    |||| |||||||||||||||||||||||||  |||||||||||||||    
42856563 tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccg 42856609  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #45
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 122 - 168
Target Start/End: Original strand, 49535885 - 49535931
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccg 168  Q
    |||| |||||||||||||||||||||||||  |||||||||||||||    
49535885 tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccg 49535931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #46
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 122 - 183
Target Start/End: Original strand, 12694523 - 12694584
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccggg 183  Q
    |||| ||||||||||||||||| ||||||| ||||| |||||||||| ||| | ||||||||    
12694523 tccagaagtcctagctcaactgacaaaatgctgaaactgttaggccggatgccatgaccggg 12694584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #47
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 196 - 265
Target Start/End: Original strand, 32233690 - 32233758
Alignment:
196 ctccacttgtgtgtgtaagtttctaataactgttgtcatttcctctatctaacaaaaaatataaaataaa 265  Q
    |||||||||||||||| ||||| |||| ||| |||||||||| |||||||||| ||||| | ||||||||    
32233690 ctccacttgtgtgtgtgagtttataatgact-ttgtcatttcgtctatctaaccaaaaaaaaaaaataaa 32233758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #48
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 122 - 183
Target Start/End: Original strand, 35318540 - 35318601
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccggg 183  Q
    |||| |||||||| ||||||||||||||||  ||||||||||||||| || || ||||||||    
35318540 tccagaagtcctaactcaactggcaaaatgccgaaattgttaggccggatatcatgaccggg 35318601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #49
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 122 - 183
Target Start/End: Original strand, 49319731 - 49319792
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccggg 183  Q
    |||| ||||||||||||||||  |||||||| ||||||||||||||| ||| | ||||||||    
49319731 tccagaagtcctagctcaactaacaaaatgtcgaaattgttaggccggatgccatgaccggg 49319792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #50
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 127 - 168
Target Start/End: Complemental strand, 54908015 - 54907974
Alignment:
127 aagtcctagctcaactggcaaaatgttgaaattgttaggccg 168  Q
    |||||||||||||||||||||||||  |||||||||||||||    
54908015 aagtcctagctcaactggcaaaatgccgaaattgttaggccg 54907974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #51
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 127 - 183
Target Start/End: Complemental strand, 5880409 - 5880353
Alignment:
127 aagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccggg 183  Q
    |||||||| ||||||||||||||||| ||||||||||| ||| ||| | ||||||||    
5880409 aagtcctaactcaactggcaaaatgtcgaaattgttagaccggatgccatgaccggg 5880353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #52
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 127 - 183
Target Start/End: Original strand, 8017855 - 8017911
Alignment:
127 aagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccggg 183  Q
    |||| ||||||||||||  ||||||||||||||||||||||| ||||  ||||||||    
8017855 aagtactagctcaactgataaaatgttgaaattgttaggccggatgttatgaccggg 8017911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #53
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 122 - 165
Target Start/End: Complemental strand, 3084370 - 3084327
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttagg 165  Q
    |||| |||||||||||||||||||||||||  ||||||||||||    
3084370 tccagaagtcctagctcaactggcaaaatgccgaaattgttagg 3084327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #54
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 127 - 166
Target Start/End: Complemental strand, 17846873 - 17846834
Alignment:
127 aagtcctagctcaactggcaaaatgttgaaattgttaggc 166  Q
    |||| ||||||||||||||||||||| |||||||||||||    
17846873 aagttctagctcaactggcaaaatgtcgaaattgttaggc 17846834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #55
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 124 - 167
Target Start/End: Complemental strand, 32662728 - 32662685
Alignment:
124 cacaagtcctagctcaactggcaaaatgttgaaattgttaggcc 167  Q
    ||||||||||||||||||| |||||||| | |||||||||||||    
32662728 cacaagtcctagctcaactagcaaaatgctaaaattgttaggcc 32662685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #56
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 121 - 164
Target Start/End: Original strand, 36608000 - 36608043
Alignment:
121 gtccacaagtcctagctcaactggcaaaatgttgaaattgttag 164  Q
    ||||||||||||||| |||| ||||||||||| |||||||||||    
36608000 gtccacaagtcctagttcaattggcaaaatgtcgaaattgttag 36608043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #57
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 127 - 174
Target Start/End: Original strand, 46194254 - 46194301
Alignment:
127 aagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtc 174  Q
    ||||||||||||||||||||||||||  ||||||||||| || |||||    
46194254 aagtcctagctcaactggcaaaatgtcaaaattgttaggtcggatgtc 46194301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #58
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 154 - 254
Target Start/End: Complemental strand, 7944320 - 7944217
Alignment:
154 gaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagtttctaataactgttgtcatttcctctatctaaca 249  Q
    ||||||||||||||| ||||| |||||||| | | ||||||||   |||||||||||||||| ||||| ||||  || ||| |||||| |||||||| ||    
7944320 gaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataatggct-ttgccatttcatctatctacca 7944222  T
250 aaaaa 254  Q
    |||||    
7944221 aaaaa 7944217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #59
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 130 - 168
Target Start/End: Original strand, 26440975 - 26441013
Alignment:
130 tcctagctcaactggcaaaatgttgaaattgttaggccg 168  Q
    ||||||||||||||||||||||  |||||||||||||||    
26440975 tcctagctcaactggcaaaatgccgaaattgttaggccg 26441013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #60
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 122 - 180
Target Start/End: Original strand, 29648764 - 29648822
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgacc 180  Q
    |||| |||||||||||||||| ||||||||  ||| ||||||||||| ||||| |||||    
29648764 tccagaagtcctagctcaactagcaaaatgccgaatttgttaggccggatgtcatgacc 29648822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #61
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 122 - 222
Target Start/End: Complemental strand, 42412116 - 42412012
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg---ctccacttgtgtgtgtaagttt 217  Q
    |||| ||||| |||||||||||||||||||  ||||||||||||||  ||| | |||||||| | | ||||||||   |||||||| ||||||| |||||    
42412116 tccagaagtcatagctcaactggcaaaatgccgaaattgttaggccagatgccatgaccggggttcgaaccccggtacctccacttatgtgtgtgagttt 42412017  T
218 ctaat 222  Q
     ||||    
42412016 ataat 42412012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #62
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 120 - 149
Target Start/End: Complemental strand, 4432022 - 4431993
Alignment:
120 agtccacaagtcctagctcaactggcaaaa 149  Q
    ||||||||||||||||||||||||||||||    
4432022 agtccacaagtcctagctcaactggcaaaa 4431993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #63
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 125 - 166
Target Start/End: Original strand, 11673296 - 11673337
Alignment:
125 acaagtcctagctcaactggcaaaatgttgaaattgttaggc 166  Q
    ||||||||||||||||||||||||||   |||||||||||||    
11673296 acaagtcctagctcaactggcaaaataccgaaattgttaggc 11673337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #64
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 127 - 168
Target Start/End: Complemental strand, 28187287 - 28187246
Alignment:
127 aagtcctagctcaactggcaaaatgttgaaattgttaggccg 168  Q
    |||||||||||||||||  ||||||| |||||||||||||||    
28187287 aagtcctagctcaactgataaaatgtcgaaattgttaggccg 28187246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #65
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 122 - 243
Target Start/End: Original strand, 42116481 - 42116604
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgggatac-aaccccgg--ctccacttgtgtgtgtaagtttc 218  Q
    |||| ||| |||||||||||||| ||||||| |||||| ||||| || ||| | ||| |||| | | ||||||||  |||||||||||||||| |||||     
42116481 tccagaagccctagctcaactggtaaaatgtcgaaatttttaggtcggatgccatgatcggggttcgaaccccggtactccacttgtgtgtgtgagttta 42116580  T
219 taataactgttgtcatttcctctat 243  Q
     ||| ||| |||||||||| |||||    
42116581 caatgact-ttgtcatttcatctat 42116604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #66
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 133 - 182
Target Start/End: Original strand, 51281477 - 51281526
Alignment:
133 tagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgg 182  Q
    |||||||||||||||||||  ||||||||||||||| ||| | |||||||    
51281477 tagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg 51281526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #67
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 122 - 182
Target Start/End: Original strand, 4379307 - 4379367
Alignment:
122 tccacaagtcctagctcaactggcaaaatgttgaaattgttaggccgaatgtcgtgaccgg 182  Q
    |||| ||||||||| ||||||| |||||||  ||||||||||||||| |||