View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 454-NF4352-Insertion-3 (Length: 241)

Name: 454-NF4352-Insertion-3
Description: 454-NF4352
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 454-NF4352-Insertion-3
454-NF4352-Insertion-3
[»] chr6 (4 HSPs)
chr6 (31-232)||(15398620-15398822)
chr6 (31-232)||(15410407-15410609)
chr6 (36-94)||(3255444-3255502)
chr6 (36-94)||(10415923-10415981)
[»] chr4 (1 HSPs)
chr4 (40-164)||(14018063-14018187)


Alignment Details
Target: chr6 (Bit Score: 151; Significance: 5e-80; HSPs: 4)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 31 - 232
Target Start/End: Complemental strand, 15398822 - 15398620
Alignment:
31 ttaagatgcaaatcttctaggttaggacaagaagaaagaaagtttatgtaatcgttccaattttgaaagctaacgtaattcaacttcagggatttcagag 130  Q
    |||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||| ||||||  |||||||||||||||||||||||    
15398822 ttaagacgcaaatcttctaggttaggacaagatgaaagaaagtttatgtaatcgttccaattttcaaatctaacgcgattcaacttcagggatttcagag 15398723  T
131 atggaagattaacgcccgaagtatcatttccaatgtttaacatcgaaagtttgagaatagttagtgttttggagatg-aaatgatgggcttcaagatgtg 229  Q
    ||||||||||||||| |||||||||||||||||  ||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||| ||||    
15398722 atggaagattaacgcacgaagtatcatttccaacttttaacatcaaaagtttgagaatagttagtgttttggagatgaaaatgatgggcttcaaggtgtg 15398623  T
230 gaa 232  Q
    |||    
15398622 gaa 15398620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 31 - 232
Target Start/End: Complemental strand, 15410609 - 15410407
Alignment:
31 ttaagatgcaaatcttctaggttaggacaagaagaaagaaagtttatgtaatcgttccaattttgaaagctaacgtaattcaacttcagggatttcagag 130  Q
    |||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||| ||||||  |||||||||||||||||||||||    
15410609 ttaagacgcaaatcttctaggttaggacaagatgaaagaaagtttatgtaatcgttccaattttcaaatctaacgcgattcaacttcagggatttcagag 15410510  T
131 atggaagattaacgcccgaagtatcatttccaatgtttaacatcgaaagtttgagaatagttagtgttttggagatg-aaatgatgggcttcaagatgtg 229  Q
    ||||||||||||||| |||||||||||||||||  ||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||| ||||    
15410509 atggaagattaacgcacgaagtatcatttccaacttttaacatcaaaagtttgagaatagttagtgttttggagatgaaaatgatgggcttcaaggtgtg 15410410  T
230 gaa 232  Q
    |||    
15410409 gaa 15410407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 36 - 94
Target Start/End: Original strand, 3255444 - 3255502
Alignment:
36 atgcaaatcttctaggttaggacaagaagaaagaaagtttatgtaatcgttccaatttt 94  Q
    |||||||||||||||| ||||||||| | | ||||| ||||| ||||| ||||||||||    
3255444 atgcaaatcttctaggataggacaagcatagagaaaatttatataatcattccaatttt 3255502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 36 - 94
Target Start/End: Complemental strand, 10415981 - 10415923
Alignment:
36 atgcaaatcttctaggttaggacaagaagaaagaaagtttatgtaatcgttccaatttt 94  Q
    |||||||||||||||| ||||||||| |  |||||| ||||||||||| |||| |||||    
10415981 atgcaaatcttctaggataggacaagcatgaagaaaatttatgtaatcattccgatttt 10415923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 40 - 164
Target Start/End: Complemental strand, 14018187 - 14018063
Alignment:
40 aaatcttctaggttaggacaagaagaaagaaagtttatgtaatcgttccaattttgaaagctaacgtaattcaacttcagggatttcagagatggaagat 139  Q
    |||||||||||| ||||||||  | ||||||| ||||| ||||| |||||||||| |||   ||| || | ||| ||||||| ||| || || |||||||    
14018187 aaatcttctaggataggacaaccataaagaaaatttatataatcattccaattttcaaaagaaacatattccaaattcagggttttgagtgacggaagat 14018088  T
140 taacgcccgaagtatcatttccaat 164  Q
     ||| | ||||||||| ||| ||||    
14018087 caacacacgaagtatccttttcaat 14018063  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 1059304 times since January 2019
Visitors: 949