View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 454-NF4352-Insertion-5 (Length: 148)

Name: 454-NF4352-Insertion-5
Description: 454-NF4352
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 454-NF4352-Insertion-5
454-NF4352-Insertion-5
[»] chr4 (2 HSPs)
chr4 (5-108)||(40058736-40058839)
chr4 (93-148)||(40059056-40059111)


Alignment Details
Target: chr4 (Bit Score: 100; Significance: 8e-50; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 100; E-Value: 8e-50
Query Start/End: Original strand, 5 - 108
Target Start/End: Original strand, 40058736 - 40058839
Alignment:
5 ccttgacccaacaaaacttgtcccacatgtctatcttcctagtagatgaaccactctcttatttgggaacatatgaaatgtacatcgagaatcaataacc 104  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
40058736 ccttgacccaacaaaacttgtcccacatgtctatcttcctagtagatgaaccactctcttatttgggaacatatgaaatgtacaacgagaatcaataacc 40058835  T
105 catt 108  Q
    ||||    
40058836 catt 40058839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 56; E-Value: 1e-23
Query Start/End: Original strand, 93 - 148
Target Start/End: Original strand, 40059056 - 40059111
Alignment:
93 gaatcaataacccattcatgatgagttttatcttcaaggtatactccttcttaaga 148  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40059056 gaatcaataacccattcatgatgagttttatcttcaaggtatactccttcttaaga 40059111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 1059314 times since January 2019
Visitors: 949