View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 454-NF4352-Insertion-6 (Length: 117)

Name: 454-NF4352-Insertion-6
Description: 454-NF4352
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] 454-NF4352-Insertion-6
[»] chr4 (1 HSPs)
chr4 (6-117)||(55932755-55932867)

Alignment Details
Target: chr4 (Bit Score: 97; Significance: 4e-48; HSPs: 1)
Name: chr4

Target: chr4; HSP #1
Raw Score: 97; E-Value: 4e-48
Query Start/End: Original strand, 6 - 117
Target Start/End: Original strand, 55932755 - 55932867
6 tatgtatgaatatatatgtgcatgcatggaagttcctatggcaaagaaaa-acaaaataaaagttgatgtatcaatgagaaaaacaacttcaaaccatgg 104  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||| |||||||||||||    
55932755 tatgtatgaatatatatgtgcatgcatggaagttcctatggcaaagaaaaaacaaaatcaaagttgatgtatcaatgagaaaaacagcttcaaaccatgg 55932854  T
105 caccacttttcta 117  Q
55932855 caccacttttcta 55932867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 1059320 times since January 2019
Visitors: 949