View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 454-NF4353-Insertion-10 (Length: 161)

Name: 454-NF4353-Insertion-10
Description: 454-NF4353
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 454-NF4353-Insertion-10
454-NF4353-Insertion-10
[»] chr4 (2 HSPs)
chr4 (35-161)||(42356481-42356607)
chr4 (6-148)||(42357519-42357661)
[»] chr6 (1 HSPs)
chr6 (46-124)||(13998096-13998174)
[»] chr5 (1 HSPs)
chr5 (46-124)||(33305864-33305942)
[»] chr3 (1 HSPs)
chr3 (46-124)||(31636752-31636830)


Alignment Details
Target: chr4 (Bit Score: 119; Significance: 4e-61; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 119; E-Value: 4e-61
Query Start/End: Original strand, 35 - 161
Target Start/End: Original strand, 42356481 - 42356607
Alignment:
35 acacaagtttctaacctttggtgggagtttaagcttccaaatgatactccaatgacctgttactctatgttgcgtcataacactatcattgtcgatgatt 134  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
42356481 acacaagtttctaacctttggtgggagtttaagcttccaaatgatactccaatgacctgttactctatgttgcgtcacaacactatcattgtcgatgatt 42356580  T
135 tcccgataagcattgcagtatgtgtaa 161  Q
    ||||||||||||||||| |||||||||    
42356581 tcccgataagcattgcaatatgtgtaa 42356607  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 79; E-Value: 3e-37
Query Start/End: Original strand, 6 - 148
Target Start/End: Original strand, 42357519 - 42357661
Alignment:
6 catcatacccgacacataccacacagataacacaagtttctaacctttggtgggagtttaagcttccaaatgatactccaatgacctgttactctatgtt 105  Q
    |||||| | |||||||||||||| | ||||||||||||| || |||||||||| | |||||||||||| ||||||||||||||| || ||||||| ||||    
42357519 catcatgctcgacacataccacataaataacacaagtttttagcctttggtggcattttaagcttccagatgatactccaatgatctattactctttgtt 42357618  T
106 gcgtcataacactatcattgtcgatgatttcccgataagcatt 148  Q
    |||||| |||||||||||||| ||||||||| | |||||||||    
42357619 gcgtcacaacactatcattgttgatgatttctcaataagcatt 42357661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 31; Significance: 0.00000001; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 46 - 124
Target Start/End: Original strand, 13998096 - 13998174
Alignment:
46 taacctttggtgggagtttaagcttccaaatgatactccaatgacctgttactctatgttgcgtcataacactatcatt 124  Q
    |||||||||||||||||||||| ||||||||   | ||||||| || | |||||||||||||  ||| ||| |||||||    
13998096 taacctttggtgggagtttaagattccaaatagaattccaatgcccaggtactctatgttgcagcatgacaatatcatt 13998174  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 31; Significance: 0.00000001; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 46 - 124
Target Start/End: Original strand, 33305864 - 33305942
Alignment:
46 taacctttggtgggagtttaagcttccaaatgatactccaatgacctgttactctatgttgcgtcataacactatcatt 124  Q
    |||||||||||||||||||||| ||||||||   | ||||||| || | |||||||||||||  ||| ||| |||||||    
33305864 taacctttggtgggagtttaagattccaaatagaattccaatgcccaggtactctatgttgcagcatgacaatatcatt 33305942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 31; Significance: 0.00000001; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 46 - 124
Target Start/End: Complemental strand, 31636830 - 31636752
Alignment:
46 taacctttggtgggagtttaagcttccaaatgatactccaatgacctgttactctatgttgcgtcataacactatcatt 124  Q
    |||||||||||||||||||||| ||||||||   | ||||||| || | |||||||||||||  ||| ||| |||||||    
31636830 taacctttggtgggagtttaagattccaaatagaattccaatgcccaggtactctatgttgcagcatgacaatatcatt 31636752  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 299727 times since January 2019
Visitors: 1059