View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 454-NF4353-Insertion-11 (Length: 197)

Name: 454-NF4353-Insertion-11
Description: 454-NF4353
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] 454-NF4353-Insertion-11
[»] chr5 (1 HSPs)
chr5 (1-196)||(7117499-7117694)

Alignment Details
Target: chr5 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr5

Target: chr5; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 1 - 196
Target Start/End: Complemental strand, 7117694 - 7117499
1 tgtgcttctttacttttggtacaattagcttaaatcgacgagttccgactttgtctttctgcgcaagacaatgaccaacaacaacatacnnnnnnncctt 100  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||    
7117694 tgtgcttctttacttttgggacaattagcttaaatcgacgagttccgactttgtctttctgcgcaagacaatgaccaacaacaacatacaaaaaaacctt 7117595  T
101 ccgatatttctcaatcatcaacgtcaaccacgtttccgtgccatgacaaacttttaggttcaatttagagccctcaaatccgagaaaaagaagata 196  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
7117594 ccgatatttctcaatcatcaacgtcaaccacgtttctgtgccatgacaaacttttaggttcaaattagagccctcaaatccgagaaaaagaagata 7117499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 301018 times since January 2019
Visitors: 1059