View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 454-NF4353-Insertion-11 (Length: 197)

Name: 454-NF4353-Insertion-11
Description: 454-NF4353
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 454-NF4353-Insertion-11
454-NF4353-Insertion-11
[»] chr5 (1 HSPs)
chr5 (1-196)||(7117499-7117694)


Alignment Details
Target: chr5 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 1 - 196
Target Start/End: Complemental strand, 7117694 - 7117499
Alignment:
1 tgtgcttctttacttttggtacaattagcttaaatcgacgagttccgactttgtctttctgcgcaagacaatgaccaacaacaacatacnnnnnnncctt 100  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||    
7117694 tgtgcttctttacttttgggacaattagcttaaatcgacgagttccgactttgtctttctgcgcaagacaatgaccaacaacaacatacaaaaaaacctt 7117595  T
101 ccgatatttctcaatcatcaacgtcaaccacgtttccgtgccatgacaaacttttaggttcaatttagagccctcaaatccgagaaaaagaagata 196  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
7117594 ccgatatttctcaatcatcaacgtcaaccacgtttctgtgccatgacaaacttttaggttcaaattagagccctcaaatccgagaaaaagaagata 7117499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC