View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 454-NF4353-Insertion-12 (Length: 144)

Name: 454-NF4353-Insertion-12
Description: 454-NF4353
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 454-NF4353-Insertion-12
454-NF4353-Insertion-12
[»] chr3 (1 HSPs)
chr3 (6-144)||(3039919-3040057)


Alignment Details
Target: chr3 (Bit Score: 127; Significance: 6e-66; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 127; E-Value: 6e-66
Query Start/End: Original strand, 6 - 144
Target Start/End: Original strand, 3039919 - 3040057
Alignment:
6 agctattcgaggatggtgatattcctagacagagaaaatttatgggtacagaagaatttatttttggatgaattgcataaggtaagaccaaataggccct 105  Q
    ||||||| ||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3039919 agctatttgaggatggtgataatcctagacagggaaaatttatgggtacagaagaatttatttttggatgaattgcataaggtaagaccaaataggccct 3040018  T
106 tacagtttctatgtaaacccttatttcaaccttcacatg 144  Q
    |||||||||||||||||||||||||||||||||||||||    
3040019 tacagtttctatgtaaacccttatttcaaccttcacatg 3040057  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC