View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 454-NF4353-Insertion-13 (Length: 125)

Name: 454-NF4353-Insertion-13
Description: 454-NF4353
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] 454-NF4353-Insertion-13
[»] chr1 (1 HSPs)
chr1 (3-125)||(52340556-52340678)
[»] chr7 (2 HSPs)
chr7 (28-125)||(9190384-9190481)
chr7 (28-125)||(9181254-9181351)

Alignment Details
Target: chr1 (Bit Score: 115; Significance: 7e-59; HSPs: 1)
Name: chr1

Target: chr1; HSP #1
Raw Score: 115; E-Value: 7e-59
Query Start/End: Original strand, 3 - 125
Target Start/End: Complemental strand, 52340678 - 52340556
3 caactatataccacaacatcacaattcacaaaacaatgctatattatattgtcaagaacataataatctcgaaatcatgctataattagggagcaatggc 102  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52340678 caactatataccacaacatcacaattcacaaaacaatgcaatattatattgtcaagaacataataatctcgaaatcatgctataattagggagcaatggc 52340579  T
103 tacaccgtctatgacctcattgg 125  Q
    |||||||||| ||||||||||||    
52340578 tacaccgtctgtgacctcattgg 52340556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 94; Significance: 3e-46; HSPs: 2)
Name: chr7

Target: chr7; HSP #1
Raw Score: 94; E-Value: 3e-46
Query Start/End: Original strand, 28 - 125
Target Start/End: Complemental strand, 9190481 - 9190384
28 tcacaaaacaatgctatattatattgtcaagaacataataatctcgaaatcatgctataattagggagcaatggctacaccgtctatgacctcattgg 125  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
9190481 tcacaaaacaatgctatattatattgtcaagaacataataatctcgaaatcatgctataattagggagcaatggctacaccgtctgtgacctcattgg 9190384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 86; E-Value: 1e-41
Query Start/End: Original strand, 28 - 125
Target Start/End: Complemental strand, 9181351 - 9181254
28 tcacaaaacaatgctatattatattgtcaagaacataataatctcgaaatcatgctataattagggagcaatggctacaccgtctatgacctcattgg 125  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||| |||||||    
9181351 tcacaaaacaatgctatattatattgtcaagaacataataatctcgaaaacatgctataattagggagcaatggctacaccgtctgtgacgtcattgg 9181254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 95066 times since January 2019
Visitors: 2228