View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 454-NF4353-Insertion-13 (Length: 125)

Name: 454-NF4353-Insertion-13
Description: 454-NF4353
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 454-NF4353-Insertion-13
454-NF4353-Insertion-13
[»] chr1 (1 HSPs)
chr1 (3-125)||(52340556-52340678)
[»] chr7 (2 HSPs)
chr7 (28-125)||(9190384-9190481)
chr7 (28-125)||(9181254-9181351)


Alignment Details
Target: chr1 (Bit Score: 115; Significance: 7e-59; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 115; E-Value: 7e-59
Query Start/End: Original strand, 3 - 125
Target Start/End: Complemental strand, 52340678 - 52340556
Alignment:
3 caactatataccacaacatcacaattcacaaaacaatgctatattatattgtcaagaacataataatctcgaaatcatgctataattagggagcaatggc 102  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52340678 caactatataccacaacatcacaattcacaaaacaatgcaatattatattgtcaagaacataataatctcgaaatcatgctataattagggagcaatggc 52340579  T
103 tacaccgtctatgacctcattgg 125  Q
    |||||||||| ||||||||||||    
52340578 tacaccgtctgtgacctcattgg 52340556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 94; Significance: 3e-46; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 94; E-Value: 3e-46
Query Start/End: Original strand, 28 - 125
Target Start/End: Complemental strand, 9190481 - 9190384
Alignment:
28 tcacaaaacaatgctatattatattgtcaagaacataataatctcgaaatcatgctataattagggagcaatggctacaccgtctatgacctcattgg 125  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
9190481 tcacaaaacaatgctatattatattgtcaagaacataataatctcgaaatcatgctataattagggagcaatggctacaccgtctgtgacctcattgg 9190384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 86; E-Value: 1e-41
Query Start/End: Original strand, 28 - 125
Target Start/End: Complemental strand, 9181351 - 9181254
Alignment:
28 tcacaaaacaatgctatattatattgtcaagaacataataatctcgaaatcatgctataattagggagcaatggctacaccgtctatgacctcattgg 125  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||| |||||||    
9181351 tcacaaaacaatgctatattatattgtcaagaacataataatctcgaaaacatgctataattagggagcaatggctacaccgtctgtgacgtcattgg 9181254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC