View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 454-NF4353-Insertion-2 (Length: 205)

Name: 454-NF4353-Insertion-2
Description: 454-NF4353
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 454-NF4353-Insertion-2
454-NF4353-Insertion-2
[»] chr8 (3 HSPs)
chr8 (7-167)||(3053861-3054022)
chr8 (30-181)||(3039595-3039743)
chr8 (152-205)||(3054166-3054219)


Alignment Details
Target: chr8 (Bit Score: 154; Significance: 7e-82; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 7 - 167
Target Start/End: Original strand, 3053861 - 3054022
Alignment:
7 agacaaacttcatctcatctatgttgtagctcaatgaggtgatgtggcaaaa-aatctaggttttagttttagacctaaaagaagtgatatggcaaacca 105  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
3053861 agacaaacttcatctcatctatgttgtagctcaatgaggtgatgtggcaaaaaaatctaggttttagttttagacctaaaagaagtgatatggcaaacca 3053960  T
106 tttattaacatggcatataacgttacttttgtaaaatcatttagataaattaaccaagtaat 167  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3053961 tttattaacatggcatataacgttacttttgtaaaatcatttagataaattaaccaagtaat 3054022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 97; E-Value: 7e-48
Query Start/End: Original strand, 30 - 181
Target Start/End: Original strand, 3039595 - 3039743
Alignment:
30 ttgtagctcaatgaggtgatgtggcaaaaaatctaggttttagttttagacctaaaagaagtgatatggcaaaccatttattaacatggcatataacgtt 129  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||| |||||||||||||||||||||||| || ||    
3039595 ttgtggctcaatgaggtgatgtggcaaaaaatctaggttttagttttagacctaagagaagtgatgtgggaaaccatttattaacatggcatatgac-tt 3039693  T
130 acttttgtaaaatcatttagataaattaaccaagtaattatggtcaaatgat 181  Q
     |||||| ||||||||||  | |||||||||||||| |||||||||||||||    
3039694 gcttttgaaaaatcattt--acaaattaaccaagtacttatggtcaaatgat 3039743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 152 - 205
Target Start/End: Original strand, 3054166 - 3054219
Alignment:
152 aaattaaccaagtaattatggtcaaatgatttcgatgagactatacttatctca 205  Q
    |||||||||||||||||||||||||||||||| ||| |||||||||||||||||    
3054166 aaattaaccaagtaattatggtcaaatgattttgatcagactatacttatctca 3054219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 298285 times since January 2019
Visitors: 1053