View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 454-NF4353-Insertion-4 (Length: 79)

Name: 454-NF4353-Insertion-4
Description: 454-NF4353
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] 454-NF4353-Insertion-4
[»] chr4 (1 HSPs)
chr4 (1-79)||(1218442-1218520)

Alignment Details
Target: chr4 (Bit Score: 79; Significance: 1e-37; HSPs: 1)
Name: chr4

Target: chr4; HSP #1
Raw Score: 79; E-Value: 1e-37
Query Start/End: Original strand, 1 - 79
Target Start/End: Original strand, 1218442 - 1218520
1 gttagaatttagaatagcaaccatgattcaaaggtaaggttacatatatgaaaaatgcaaacaaagaacacgcgatatt 79  Q
1218442 gttagaatttagaatagcaaccatgattcaaaggtaaggttacatatatgaaaaatgcaaacaaagaacacgcgatatt 1218520  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC