View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 454-NF4354-Insertion-2 (Length: 70)

Name: 454-NF4354-Insertion-2
Description: 454-NF4354
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 454-NF4354-Insertion-2
454-NF4354-Insertion-2
[»] chr6 (1 HSPs)
chr6 (1-70)||(3239127-3239196)


Alignment Details
Target: chr6 (Bit Score: 70; Significance: 3e-32; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 70; E-Value: 3e-32
Query Start/End: Original strand, 1 - 70
Target Start/End: Original strand, 3239127 - 3239196
Alignment:
1 gaaggagctataaaaacattgaaatgaggaagatggttattccttcaaatccagaagccattgattttgg 70  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3239127 gaaggagctataaaaacattgaaatgaggaagatggttattccttcaaatccagaagccattgattttgg 3239196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 105665 times since January 2019
Visitors: 2328