View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 454-NF4354-Insertion-5 (Length: 65)

Name: 454-NF4354-Insertion-5
Description: 454-NF4354
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 454-NF4354-Insertion-5
454-NF4354-Insertion-5
[»] chr1 (1 HSPs)
chr1 (5-65)||(48584499-48584559)
[»] chr3 (1 HSPs)
chr3 (33-65)||(19666474-19666506)


Alignment Details
Target: chr1 (Bit Score: 61; Significance: 6e-27; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 61; E-Value: 6e-27
Query Start/End: Original strand, 5 - 65
Target Start/End: Original strand, 48584499 - 48584559
Alignment:
5 gttaacattattaattaatgatgcatgtttcttaatgtcttccataaactcatcaagattc 65  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48584499 gttaacattattaattaatgatgcatgtttcttaatgtcttccataaactcatcaagattc 48584559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 29; Significance: 0.00000007; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.00000007
Query Start/End: Original strand, 33 - 65
Target Start/End: Complemental strand, 19666506 - 19666474
Alignment:
33 ttcttaatgtcttccataaactcatcaagattc 65  Q
    |||||||||||||||||||| ||||||||||||    
19666506 ttcttaatgtcttccataaattcatcaagattc 19666474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 95147 times since January 2019
Visitors: 2229