View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: D611-LTR4-TNT-insertion-1 (Length: 713)

Name: D611-LTR4-TNT-insertion-1
Description: D611-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] D611-LTR4-TNT-insertion-1
D611-LTR4-TNT-insertion-1
[»] chr1 (1 HSPs)
chr1 (12-708)||(36452659-36453355)


Alignment Details
Target: chr1 (Bit Score: 689; Significance: 0; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 689; E-Value: 0
Query Start/End: Original strand, 12 - 708
Target Start/End: Complemental strand, 36453355 - 36452659
Alignment:
12 cctgaaacgtgaaaagtgttattattgatggaaaataactccatataattcatactatctagcaaggtagctaattaattttcagaccctggtgcctttg 111  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36453355 cctgaaacgtgaaaagtgttattattgatggaaaataactccatataattcatactatctagcaaggtagctaattaattttcagaccctggtgcctttg 36453256  T
112 aacttcttctcagcctccctactgtcaataactgcatcatggaatccataacgtcctctatcatccctcctataataatcatcatcgtaatcacttgcat 211  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36453255 aacttcttctcagcctccctactgtcaataactgcatcatggaatccataacgtcctctatcatccctcctataataatcatcatcgtaatcacttgcat 36453156  T
212 catcaatgaacgtgacacgtgtttgtgaatcacgtggtggtgactgaagctggttaacatttccataaggcctcatggcagcaccggaaccagtcctgtc 311  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36453155 catcaatgaacgtgacacgtgtttgtgaatcacgtggtcgtgactgaagctggttaacatttccataaggcctcatggcagcaccggaaccagtcctgtc 36453056  T
312 agtaaagcgaggagaggcattacctggagttggactatgttgttgatcacgctttgcagcttccatcttcaacaactccatggccttgtcaatgtcatga 411  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36453055 agtaaagcgaggagaggcattacctggagttggactatgttgttgatcacgctttgcagcttccatcttcaacaactccatggccttgtcaatgtcatga 36452956  T
412 attggctcgcttaattgagtcccttttcttggtgctgcagtccaatatgaattaatttttggcccattgaaattggatctgttgttgtaataattagcag 511  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36452955 attggctcgcttaattgagtcccttttcttggtgctgcagtccaatatgaattaatttttggcccattgaaattggatctgttgttgtaataattagcag 36452856  T
512 cgttatcaccatcatcatatttaggattgctactacttacaaacggcttatcgttgtggttactaataccatagccgttaccatagttgccgttcctagt 611  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36452855 cgttatcaccatcatcatatttaggattgctactacttacaaacggcttatcgttgtggttactaataccatagccgttaccatagttgccgttcctagt 36452756  T
612 gggcttgtatccttcttttttgttgtagtcactgccatatccattagggctatcatagccatcttgagtactcctcatgctacctactccaattggt 708  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
36452755 gggcttgtatccttcttttttgttgtagtcactgccatatccattagggctatcatagccatcttgagtactccttatgctacctactccaattggt 36452659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC